a collaborative research initiative for childhood act
Tài liệu THE CHICAGO WOMEN’S HEALTH RISK STUDY RISK OF SERIOUS INJURY OR DEATH IN INTIMATE VIOLENCE A COLLABORATIVE RESEARCH PROJECT doc
... 114 Data Management 115 Management of Name, Name2 and Name3 Information Management of Incident-Level Data 115 Individual versus Incident Level Data 116 Aggregating Incident-Level Data for Each ... financial and respondent safety obstacles, and required many years for results to be available for practical application This is because intimate partner homicide is such a rare event in Chicago ... file cabinet At data entry, a permanent identification number was assigned to the case, and thereafter used in place of any names as an identifier in the automated dataset The project had an elaborate...
- 341
- 496
- 1
Báo cáo y học: "Public health, conflict and human rights: toward a collaborative research agenda" potx
... differentiating between the impacts of air and ground attacks NATO air raids appeared to scatter Taliban forces, leading to fewer civilian casualties; NATO ground attacks against Taliban fighters who held ... input, to Aimee Charest for research assistance, and to Gaya Sanmugam for administrative support We also thank Richard Garfield, Paul Spiegel, Jennifer Leaning, Iain Levine, Sam Zia-Zarifi, Robert ... adverse mental health impacts are part of a conflict's overall human costs, and should be factored into broader impact assessments Mental health impacts can also have important political consequences...
- 12
- 401
- 0
Toward Sustainability A Plan for Collaborative Research on Agriculture and Natural Resource Management potx
... A Plan for Collaborative Research on Agriculture and Natural Resource Management http://www.nap.edu/catalog/1822.html SANREM PROGRAM MANAGEMENT AND GRANT ADMINISTRATION 37 arrangements, and communications ... this publication as the authoritative version for attribution Toward Sustainability: A Plan for Collaborative Research on Agriculture and Natural Resource Management http://www.nap.edu/catalog/1822.html ... this publication as the authoritative version for attribution Toward Sustainability: A Plan for Collaborative Research on Agriculture and Natural Resource Management http://www.nap.edu/catalog/1822.html...
- 163
- 402
- 0
To amend the Public Health Service Act to provide for a Pancreatic Cancer Initiative, and for other purposes. ppt
... principal investigators 12 in pancreatic cancer, who are each an as- 13 sistant-level professor in a major academic 14 research institution and who have each re- 15 ceived at least grant from the National ... of the National Cancer Institute in ac- cordance with paragraph (5) regarding the prioritization and award of National Institutes of Health research grants relating to pancreatic 10 cancer 11 ... 17 nation of extramural and intramural pan- 18 creatic cancer research initiatives and pos- 19 sibilities for partnerships among the na- 20 tional research institutes, including the 21 National...
- 18
- 296
- 0
A Collaborative Project of The Mickey Leland National Urban Air Toxics Research Center and The National Center for Health Statistics pot
... Behavioral, Socioeconomic, and Demographic Characteristics A Collaborative Project of The Mickey Leland National Urban Air Toxics Research Center and The National Center for Health Statistics TABLE ... examination center NCHS National Center for Health Statistics NHANES National Health and Nutrition Examination Surveys NUATRC National Urban Air Toxics Research Center RFA Request for Applications ... 10 NA NA NA NA NA NA 2.3 × 10− NA NA NA RfC b (μg m− 3) 30 NA 1000 NA NA NA 800 NA NA NA 3000 CAS=Chemical Abstracts Service, MW=molecular weight, MP=melting point, and BP=boiling point are all...
- 52
- 607
- 0
Tài liệu Báo cáo khoa học: Peroxiredoxin II functions as a signal terminator for H2O2-activated phospholipase D1 doc
... ·) Rabbit antibody to PrxII and an Alexa-647-labeled goat antirabbit IgG secondary were used to visualize PrxII Mouse monoclonal antibody to HA and an Alexa 488-labeled goat anti-mouse secondary ... Jenco JM, Nakashima S, Cadwallader K, Gu Q, Cook S, Nozawa Y, Prestwich GD, Frohman MA & Morris AJ (1997) Characterization of two alternately spliced forms of phospholipase D1 Activation of the ... mm NaCl, and · protease inhibitor cocktail at 37 °C for 20 The lysate was spun down at 50 000 g for 15 The supernatant was mixed with pre-equilibrated anti-HA affinity matrix and rocked at °C for...
- 9
- 401
- 0
Tài liệu The Little Guide To Beating Procrastination, Perfectionism and Blocks: A Manual for Artists, Activists, Entrepreneurs, Academics and Other Ambitious Dreamers docx
... know, those aren’t the actual cause of your procrastination the cause is fear but they are the activities we turn to when we are afraid, and they serve to distract us from both the fear, and the guilty knowledge that we are procrastinating. Procrastination has, in fact, an amazing ability to disguise itself: that is one of its most powerful weapons. What ... Chapter 7 Fear II. Fear of Failure “You have to have the courage to fail.” Russian political activist, and former world chess champion, Garry Kasparov Garry Kasparov is one of my heroes: a former world chess champion who, after ... got a lot of money, you’re a success, and if you don’t, you’re a failure. Capitalism doesn’t care what ethical lapses, if any, someone may have committed to make their fortune; nor does it make any allowances for inequities or misfortunes that may have limited ...
- 87
- 610
- 0
Báo cáo khoa học: Alternative splicing: regulation of HIV-1 multiplication as a target for therapeutic action docx
... UUAGGACAUAUAGUUAGCCCUAGG unknown UGGGU CUAGACUAGA CCAGUAGAUCCUAGACUAGA GAAGAAGCGGAGACAGCGACGAAGA AGAUCCAUUCGAUUAG unknown UAGUGAAUAGAGUUAGGCAGGGA GAAGAAGAA UAGAAGAAGAA 4995–5017 [5, 12, 38, 40] 5362–5366 ... CBP coactivators J Virol 76, 9724–9734 HIV-1 alternative splicing regulation 34 Kuramitsu M, Hashizume C, Yamamoto N, Azuma A, Kamata M, Yamamoto N, Tanaka Y & Aida Y (2005) A novel role for Vpr ... cells Proc Natl Acad Sci USA 91, 7311–7315 32 Kamata M, Nitahara-Kasahara Y, Miyamoto Y, Yoneda Y & Aida Y (2005) Importin-alpha promotes passage through the nuclear pore complex of human immunodeficiency...
- 10
- 434
- 0
A Review of the EPA Water Security Research and Technical Support Action Plan ppt
... Weir, who as our project assistant was responsible for meeting logistics, research assistance, and editorial tasks The panel also appreciates the assistance of Jon Herrmann and Alan Hais, EPA Office ... WATER SECURITY RESEARCH AND TECHNICAL SUPPORT ACTION PLAN 15 Overarching Framework for Research and Technical Support, 15 Action Plan Implementation, 18 Communication, Information Sharing, and ... when appropriate, transmit information on contaminants and threat scenarios applicable to drinking water supplies and systems Contaminant Monitoring and Analysis The Action Plan includes a broad...
- 131
- 458
- 0
Embedded, Everywhere A Research Agenda for Networked Systems of Embedded Computers pot
... Project Assistant SUZANNE OSSA, Senior Project Assistant DAVID DRAKE, Project Assistant DAVID PADGHAM, Research Assistant BRANDYE WILLIAMS, Office Assistant vi Preface C ontinued advances in information ... to an easily replenishable energy source and have a small form factor (size, shape, and total volume), as well as those that exist where heat dissipation is a negative factor Small form factor ... system that functions properly for the application domain while remaining understandable and manageable by human operators, users, and—in many cases—casual passersby, is a large challenge for EmNet...
- 236
- 323
- 1
Báo cáo khoa học: MR solution structure of the precursor for carnobacteriocin B2, an antimicrobial peptide fromCarnobacterium piscicola Implications of the a-helical leader section for export and inhibition of type IIa bacteriocin activity pdf
... Engineering Research Council of Canada, the Alberta Heritage Foundation for Medical Research, CanBiocin Ltd (Edmonton, AB), and the Canada Research Chair in Bioorganic and Medicinal Chemistry ... Isolation, purification and partial characterization of plantaricin 423, a bacteriocin produced by Lactobacillus plantarum J Appl Microbiol 84, 1131–1137 22 Jack, R.W., Wan, J., Gordon, J., Harmark, ... antimicrobial activity [2,10] For example, Fimland et al [42] have shown that interchange of large domains of different type IIa bacteriocins, such as pediocin PA-1, sakacin P, and curvacin A, ...
- 9
- 519
- 0
Báo cáo khoa học: " a Movie Dialogue Corpus for Research and Development" potx
... Della Pietra S, Della Pietra V, Mercer R (1993) The mathematics of statistical machine translation: parameter estimation Computational Linguistics 19(2):263-311 Stallard D (2000) Talk’n’travel: a ... Meeting of the ACL, demo session Rieser V, Lemon O (2011) Reinforcement learning for adaptive dialogue systems: a data-driven methodology for dialogue management and natural language generation Springer ... utterance and speaker information elements contain what is said at each dialogue turn and the corresponding character who says it, respectively Context information elements, on the other hand, contain...
- 5
- 424
- 0
Báo cáo khoa học: Molecular cloning of the Matrix Gla Protein gene from Xenopus laevis Functional analysis of the promoter identifies a calcium sensitive region required for basal activity doc
... Splice acceptor Phase of intron acag|gtaag tatg|gtaag tatg|gtaag agag|gtaag g(t)5aacag|aagaa c(t)4gtatacag|actc a( t)4cag|atcc c(t)4ag|aatc Not in coding region I I II (2929) (986) (1985) (1490) Table ... stranded oligonucleotides spanning the region from )70 to )36 of the xMGP promoter (5Â-GATCCAGGGGAGGGAAAACAAGGA GATGAGGAGGTGTGGT-3Â, and 5Â-GATCTACCA CACCTCCTCATCTCCTTGTTTTCCCTCCCCTG-3Â) as BamHI/BglII ... the manufacturer (Promega) in a ML3000 luminometer (Dynatech) Relative light units were normalized to b-galactosidase activity and protein concentration using the Bradford dye-assay (BioRad) All...
- 10
- 475
- 0
Báo cáo khoa học: "A Practical Nonmonotonic Theory for Reasoning about Speech Acts" pot
... the above assumption This general approach proved inadequate because there is in fact no such statement about b.eliefs about goals about beliefs that is true in every performance of a speech act ... are two operators: [a] for a' s belief and {a} for a' s goals The formula [hI]c~, for example, means that the hearer believes ~b in the final situation, while {si}¢ means that the speaker intended ... complicated theories about how other agents apply defaults The simplest assumption we can make is that they reason in a uniform manner, exactly the same as the way we axiomatized Level Therefore,...
- 9
- 305
- 0
Báo cáo " Why is action research suitable for education? " ppt
... of action research has witnessed four main “streams” that have emerged as: (i) Traditional action research, (ii) Contextural action research (Action learning), (iii) Radical action research and ... action research as: ● A practical focus; ● The educator-researcher’s own practices; ● Collaboration; ● A dynamic process; ● A plan of action and; and ● Sharing research Creswell asserts that understanding ... may critique that action research is an informal research since teachers are not academic researchers, it is widely believed that action research is extremely suitable for education as its main...
- 10
- 487
- 0
Báo cáo khoa học: Catalytically active membrane-distal phosphatase domain of receptor protein-tyrosine phosphatase a is required for Src activation doc
... activate it Active RPTPa-D2 is required for Src activation Materials and methods Materials and antibodies Anti-HA-tag (12CA5), anti-Src (327) Igs and anti-RPTPa (5478AP) serum were prepared as ... biological function of RPTPa, impairing Src binding and its ability to activate Src Our results indicate that a catalytically active D2 domain is required for RPTPamediated Src binding and activation ... distinctive form of Noonan syndrome Nat Genet 39, 75–79 37 Razzaque MA, Nishizawa T, Komoike Y, Yagi H, Furutani M, Amo R, Kamisago M, Momma K, Katayama H, Nakagawa M et al (2007) Germline gain-of-function...
- 9
- 289
- 0
Embedded, Everywhere A Research Agenda for Networked Systems of Embedded Computers doc
... to an easily replenishable energy source and have a small form factor (size, shape, and total volume), as well as those that exist where heat dissipation is a negative factor Small form factor ... Assistant SUZANNE OSSA, Senior Project Assistant DAVID DRAKE, Project Assistant DAVID PADGHAM, Research Assistant BRANDYE WILLIAMS, Office Assistant vi Preface C ontinued advances in information ... system that functions properly for the application domain while remaining understandable and manageable by human operators, users, and—in many cases—casual passersby, is a large challenge for EmNet...
- 235
- 259
- 0
Báo cáo '''' A review on the visible light active titanium dioxide photocatalysts for environmental applications " docx
... superoxide radical anion, respectively [22] It is clear that photocatalysis implies photon-assisted generation of catalytically active species rather that the action of light as a catalyst in a reaction ... activated N–TiO2 has been achieved by a simple sol–gel method employing dodecylammonium chloride (DDAC) as surfactant [79] The DDAC surfactant acts simultaneously as a pore templating material ... Yamashita, M Harada, J Misaka, M Takeuchi, K Ikeue, M Anpo, Journal of Photochemistry and Photobiology A 148 (2002) 257–261 [140] H Yamashita, M Harada, J Misaka, M Takeuchi, B Neppolian, M Anpo,...
- 19
- 578
- 0
AGENDA 2020: A Technology Vision and Research Agenda for America''''s Forest, Wood and Paper Industry doc
... most valuable asset, an abundant and low cost raw material base, is being challenged by developments both domestically and abroad Land available for growing commercial wood is diminishing, and ... 1920s and grows over one-third more wood than is used and lost to natural causes each year Among the many favorable attributes of healthy, productive forests are: a favorable impact on the atmospheric ... importance of this raw material base for long range survival, companies in the industry have a long standing reputation for being stewards of America's forests Today, the U.S has far more trees than...
- 27
- 455
- 0
Safe and Effective Medicines for Children: Studies Conducted Under the Best Pharmaceuticals for Children Act and the Pediatric Research Equity Act potx
... Michael Hayes and Debra Gilliam, Chanda Chay, and John Bowers at Caset Associates Within the National Academies, we acknowledge the assistance of Adam Berger, Laura Harbold, Donna Randall, Vilija ... and Acronyms AAP ACR ADHD AERS AHA AHRQ BLA BPCA BPCIA CBER CDC CDER CDRH CNS COG CYP DESI DMC DSI EMA EU FDA FDAAA FDAMA FDC Act FEV1 FOIA GCP GERD HHS IBD IGIV American Academy of Pediatrics American ... POLICY FRAMEWORK FOR BPCA AND PREA Basic Regulatory Framework for Drug Development, Approval, and Surveillance Best Pharmaceuticals for Children Act Pediatric Research Equity Act FDA Administration...
- 351
- 420
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25