a changing role for securitization

Tài liệu Báo cáo khoa học: The most C-terminal tri-glycine segment within the polyglycine stretch of the pea Toc75 transit peptide plays a critical role for targeting the protein to the chloroplast outer envelope membrane ppt

Tài liệu Báo cáo khoa học: The most C-terminal tri-glycine segment within the polyglycine stretch of the pea Toc75 transit peptide plays a critical role for targeting the protein to the chloroplast outer envelope membrane ppt

Ngày tải lên : 19/02/2014, 07:20
... and its derivatives used in this study Name Sequence (residues 91–100) WT polyAla AGG GAG GGA GAA AGA AAG GGD GGE GGL GGN GGS GGP GGGAGGGGGG *SA*AAAAA* AAA******* ****AAA*** *******AAA ****AAAAAA ... ****AAAAAA AAA****AAA AAA*AAA*** *******DDD *******EEE *******LLL *******NNN *******SSS *******PPP chloroplasts used for this assay [15] Furthermore, the intermediate and mature forms of Toc75 in a ... apparatus, faces the stromal compartment J Biol Chem 273, 16583–16588 Gunasekaran K, Nagarajaram HA, Ramakrishnan C & Balaram P (1998) Stereochemical punctuation marks in protein structures: glycine and...
  • 9
  • 496
  • 0
International Labor Migration: A Responsible Role for Business pdf

International Labor Migration: A Responsible Role for Business pdf

Ngày tải lên : 15/03/2014, 21:20
... Lanka, Thailand, and Vietnam »  estination Country Participants: Bahrain, Italy, Kuwait, Malaysia, Qatar, D Republic of Korea, Saudi Arabia, and United Arab Emirates In January 2008, the Abu Dhabi ... Saudi Arabia 383,031 United Arab Emirates 18,551 Egypt Unknown Jordan 16,821 Malaysia 85,835 Oman 31,317 Qatar Unknown Saudi Arabia 114,981 United Arab Emirates 6,443 Jordan Malaysia Pakistan ... available in villages and towns » Make the passport and visa application process more straightforward South-South Labor Migration Flows Jordan Egypt Kuwait Saudi Arabia Qatar U .A. E Pakistan India...
  • 64
  • 252
  • 0
Báo cáo y học: "A proinflammatory role for Fas in joints of mice with collagen-induced arthritis" docx

Báo cáo y học: "A proinflammatory role for Fas in joints of mice with collagen-induced arthritis" docx

Ngày tải lên : 09/08/2014, 01:23
... instructions Anticollagen antibody assay Sera were collected from control DBA-lpr/+ and mutant DBA-lpr/lpr mice before immunization and at days 20 and 47 after immunization and a standard ELISA was used ... original inbred strains Arthritis Rheum 2002, 46:1067-1074 Sugiyama M, Tsukazaki T, Yonekura A, Matsuzaki S, Yamashita S, Iwasaki K: Localization of apoptosis and expression of apoptosis related ... 93:1029-1034 Amasaki Y, Kobayashi S, Takeda T, Ogura N, Jodo S, Nakabayashi T, Tsutsumi A, Fujisaku A, Koike T: Up-regulated expression of Fas antigen (CD95) by peripheral naive and memory T...
  • 11
  • 469
  • 0
Báo cáo y học: "Atherosclerotic disease is increased in recent-onset rheumatoid arthritis: a critical role for inflammation" ppsx

Báo cáo y học: "Atherosclerotic disease is increased in recent-onset rheumatoid arthritis: a critical role for inflammation" ppsx

Ngày tải lên : 09/08/2014, 10:21
... sedimentation rate, and the patient global assessment of disease activity (100 mm visual analogue scale) [15] Cardiovascular risk factor ascertainment CV risk factors were ascertained among RA patients ... first maximum slope of the change in signal for the near and far walls, and repeating the analysis to identify the media–adventitia interface The software calculates the mean and standard deviation ... Statistical analysis Continuous variables are described as the mean ± standard deviation, and categorical variables presented as the percentage Log transformations were applied to non-normally...
  • 9
  • 346
  • 0
Báo cáo y học: "Identification of possible candidate genes regulating Sjögren''''s syndrome-associated autoimmunity: a potential role for TNFSF4 in autoimmune exocrinopathy" docx

Báo cáo y học: "Identification of possible candidate genes regulating Sjögren''''s syndrome-associated autoimmunity: a potential role for TNFSF4 in autoimmune exocrinopathy" docx

Ngày tải lên : 09/08/2014, 13:22
... study, ANA staining, saliva collections, data analyses, and manuscript preparation All authors read and approved the final manuscript Proposed genetic predisposition for and fatty acid homeostasis/trans6.NOD-Aec1Aec2 ... O-acyltransferase-1 (SOAT-1) using FCs and free fatty acids (FFAs) ABCA1, ATP-binding cassette, subfamily A [ABC1] member 1; ACAT, acyl-coenzyme A: cholesterol acyltransferase; ApoE, apolipoprotein ... primarily the pathophysiological and biochemical abnormalities that subsequently result in the activation of the autoimmune attack against the submandibular and lacrimal glands [10], is a single...
  • 12
  • 399
  • 0
báo cáo khoa học: "Gene-expression and network-based analysis reveals a novel role for hsa-mir-9 and drug control over the p38 network in Glioblastoma Multiforme progression" ppsx

báo cáo khoa học: "Gene-expression and network-based analysis reveals a novel role for hsa-mir-9 and drug control over the p38 network in Glioblastoma Multiforme progression" ppsx

Ngày tải lên : 11/08/2014, 12:21
... Materials and methods Gene datasets TCGA Data were obtained from The Cancer Genome Atlas (TCGA) database This dataset comprises of molecular characterizations from 373 GBM patients For each patient, ... state, and (iii) of the complementary event Survival analysis Kaplan-Meier survival analysis was done on all pathway measurements in all five datasets [21], through clinical data (Vital Status) ... scores (a score for each pathway in the database) to each sample in every dataset Network information has been obtained from The National Cancer Institute's Pathway Interaction Database (PID) [12]...
  • 26
  • 278
  • 0
Báo cáo y học: "A crucial role for tumor necrosis factor receptor 1 in synovial lining cells and the reticuloendothelial system in mediating experimental arthritis" pps

Báo cáo y học: "A crucial role for tumor necrosis factor receptor 1 in synovial lining cells and the reticuloendothelial system in mediating experimental arthritis" pps

Ngày tải lên : 12/08/2014, 12:20
... statistical and data analysis, interpretation of data, and drafting of the manuscript WBvdB conceived of the study and helped draft the manuscript All authors read and approved the final manuscript ... 5'-TCTAGAGATCCGACGCCGCCATCTCTA-3' and reverse 5'-GTCGACGTTAACAAGGCTTTTCTCCA-3' The target sequence for silencing the Tnfrsf 1a gene [EMBL:M60468] was ATCTTCGGTCCTAGTAACT (base pairs 1095 to 1113), and we used ACTCATGTCTTGATCAGCT ... of TNFR1 may be a promising and safer approach for TNFα blockade in RA patients Page 10 of 11 Additional material Additional file Supplemental Methods Primerdesign Abbreviations APC: antigen-presenting...
  • 11
  • 319
  • 0
Báo cáo y học: " Open Access A key role for STIM1 in store operated calcium channel activation in airway smooth muscle" pptx

Báo cáo y học: " Open Access A key role for STIM1 in store operated calcium channel activation in airway smooth muscle" pptx

Ngày tải lên : 12/08/2014, 16:20
... cell capacitance STIM-2 forward primer: ACGACACTTCCCAGGATAGCA reverse primer: GACTCCGGTCACTGATTTTCAAC probe: TGCACGAACCTTCATT Measurement of [Ca2+]i HASMs (passage 4–5) were plated in black walled, ... the latter study also implicating a role for STIM2 In particular, STIM1 appears to be a major activator of calcium release activated calcium channels (ICRAC) in T lymphocytes via a mechanism ... AGGCAGTCCGTAACATCCAC, Reverse; CTTCAGTCCGTAACATCCAC) and STIM2 (Forward; TCCCTGCATGTCACTGAGTC, Reverse; GGGAAGTGTCGTTCCTTTGA) Cycling was performed 35 times; 94°C, followed by 55°C (annealing temperature),...
  • 8
  • 341
  • 0
Báo cáo y học: " Investigating a pathogenic role for TXNDC5 in rheumatoid arthritis" ppsx

Báo cáo y học: " Investigating a pathogenic role for TXNDC5 in rheumatoid arthritis" ppsx

Ngày tải lên : 12/08/2014, 17:22
... bactin, 5’-TGGCACCCAGCACAATGAA-3’; and reverse primer for human b-actin, 5’-CTAAGTCATAGTCCGCCTAGAAGCA-3’ Primer efficiency was determined by serially diluting a standard RT reaction product PCR ... and the experimental results are comparable Additional file in the supplementary materials summarizes the epidemiological data All AS, RA and OA patients got treatment with NSAIDs Synovial samples ... criteria for AS Patients with AS and RA took disease-modifying antirheumatic drugs (DMARDs) before surgery Patients with AS, RA and OA were also medicated with non-steroidal anti-inflammatory...
  • 16
  • 321
  • 0
Báo cáo khoa học: "Acute pancreatitis: a possible role for activated protein" pps

Báo cáo khoa học: "Acute pancreatitis: a possible role for activated protein" pps

Ngày tải lên : 12/08/2014, 22:21
... Nitric oxide regulates bacterial translocation in experimental acute pancreatitis Pancreatology 2003, 3:329335 11 Iba T, Kidokoro A, Fukunaga M, Nagakari K, Shirahama A, Ida Y: Activated protein C ... of established necrotizing pancreatitis has important clinical implications Indeed, one explanation for the therapeutic failure of the PAF antagonist lexipafant is that it might have been administered ... mortality in acute pancreatitis [9] Translocation of enteric bacteria from the intestine is postulated to play an important role in the development of this complication In the study by Yamanel and coworkers...
  • 2
  • 251
  • 0
Báo cáo y học: "A Functional Role for ADAM10 in Human Immunodeficiency Virus Type-1 Replication" pptx

Báo cáo y học: "A Functional Role for ADAM10 in Human Immunodeficiency Virus Type-1 Replication" pptx

Ngày tải lên : 13/08/2014, 01:20
... were against positions 1119-1138 (5’ CCCAAAGTCTCT CACATTA-3’), 1272-1280 (5’-GGACAAACTTAAC AACAAT-3’), 1591-1609 (GCAAGGGAAGGAATATGTA-3’), and 2070-2088 (5’-GCTAATGGCTGG ATTTATT-3’) TZM-bl and ... Mukherjee P, Narayanasamy K, Arora R, Sen SD, Gupta S, Natarajan K, Malhotra P: Proteome analysis of Plasmodium falciparum extracellular secretory antigens at asexual blood stages reveals a cohort ... Hikita A, Yana I, Wakeyama H, Nakamura M, Kadono Y, Oshima Y, Nakamura K, Seiki M, Tanaka S: Negative regulation of osteoclastogenesis by ectodomain shedding of receptor activator of NF-kappaB...
  • 14
  • 308
  • 0
Báo cáo y học: " Host-virus interaction: a new role for microRNAs" pdf

Báo cáo y học: " Host-virus interaction: a new role for microRNAs" pdf

Ngày tải lên : 13/08/2014, 09:20
... microRNAs can act as a trans-acting element for reversible and dynamic regulation of spatial and temporal protein expression Computational tools for discovery of microRNA and their targets Computational ... (shRNAs) can saturate the RNA interference machinery [17] This would have far reaching implications on determining dosage of artificial microRNAs for therapeutics as well as for experimental research ... important as siRNA based therapeutics for viral pathogens in different stages of clinical trials and are showing promising results Artificial microRNAs (amiRNAs) and microRNA engineering MicroRNAs...
  • 9
  • 340
  • 0
Báo cáo y học: "Breakdown of accommodation in nerve: a possible role for persistent sodium current" potx

Báo cáo y học: "Breakdown of accommodation in nerve: a possible role for persistent sodium current" potx

Ngày tải lên : 13/08/2014, 22:22
... obtaining a value for internodal leak resistance on the basis of experimental data alone For these reasons we believe that the present approach was justified Alternative explanations of breakdown ... error to a value that would enable the model to reproduce known experimental data This approach was used since few experimental data on the internodal leak resistance are available There are only ... nodal capacitance in experimental data and the nodal capacitance per square micrometer [39] The nodal resting potential was kept stable by a current leak to the internode, and the internodal...
  • 11
  • 262
  • 0
Báo cáo y học: "A genome wide analysis of the response to uncapped telomeres in budding yeast reveals a novel role for the NAD+ biosynthetic gene BNA2 in chromosome end protection" doc

Báo cáo y học: "A genome wide analysis of the response to uncapped telomeres in budding yeast reveals a novel role for the NAD+ biosynthetic gene BNA2 in chromosome end protection" doc

Ngày tải lên : 14/08/2014, 21:20
... measurements Table Primers for Q RT-PCR Primer Alias Sequence 1082 ACT1F GCCTTCTACGTTTCCATCCA 1083 ACT1R GGCCAAATCGATTCTCAAAA 1367 PAC2F AATAACGAATTGAGCTATGACACCAA 1368 PAC2R AGCTTACTCATATCGATTTCATACGACTT ... GTAACCAGTACGAAAAAAGATA CATTT 1165 MSC1F TCTTCGGATCACCCAGTTTC 1278 NPT1 5' 1166 MSC1R G AAGCCTTAGCGTCGTCAAC CATTGTGATTTTATTCAATGTTT CTTT 1084 CTT1F AAAGAGTTCCGGAGCGTGTA 1279 NPT1 3' CAGGGTGTGGAAGAACAGGT ... CAGGGTTTGGCCGATACTTA Primer Alias Sequence 1247 RNR3R CTTCTTTTTGGGCCAATTCA 1280 BNA2 5' CTCGACGCTGATTGGCTAA 1248 YKL161CF TGGCCGAACTACTTGGTAGG 1281 BNA2 3' 1249 YKL161CR GCAATGTTTCCTCAGGTGGT GTAACCAGTACGAAAAAAGATA...
  • 17
  • 432
  • 0
Tài liệu IE Brown Executive MBA- Liberal Arts meets the Developing innovative leaders for a changing world ppt

Tài liệu IE Brown Executive MBA- Liberal Arts meets the Developing innovative leaders for a changing world ppt

Ngày tải lên : 20/02/2014, 10:20
... Marketing Management, Organizational Behavior, Strategic Management, Accounting and Management Control, Financial Management, Managerial Economics, Operations and Supply Chain Management, Information ... programs in undergraduate, graduate, and medical education are characterized by a distinctive academic philosophy, a world-class faculty, and a tradition of innovative and rigorous multidisciplinary ... School is fully accredited by the three leading accreditation agencies in the management education arena: AACSB, EQUIS and AMBA, guaranteeing the quality and academic rigor of our programs IE Business...
  • 20
  • 480
  • 0
Tài liệu Báo cáo khoa học: A role for the intersubunit disulfides of seminal RNase in the mechanism of its antitumor action docx

Tài liệu Báo cáo khoa học: A role for the intersubunit disulfides of seminal RNase in the mechanism of its antitumor action docx

Ngày tải lên : 20/02/2014, 11:20
... proteins extracted from plasma membranes and membrane pellets were then analyzed by SDS/PAGE and autoradiography Figure shows that after incubation with labelled MSSAE, membranes contained radioactive ... Fig Autoradiography of SDS/PAGE runs of the labelled monomeric derivative of BS-RNase 125I-labelled MSSAE incubated with plasma membranes (PM) from SVT2 cells Lane 1, plasma membranes treated for ... dellUniversita e della Ricerca (Progetti di Rilevante Interesse Nazionale 2001) and Consorzio Interuniversitario Biotecnologie Aurora Bracale was supported by a fellowship from Fondazione Italiana per la...
  • 8
  • 604
  • 0
Báo cáo khoa học: A role for serglycin proteoglycan in granular retention and processing of mast cell secretory granule components ppt

Báo cáo khoa học: A role for serglycin proteoglycan in granular retention and processing of mast cell secretory granule components ppt

Ngày tải lên : 07/03/2014, 11:20
... kinetics as for mMCP-5 In contrast, CPA protein was detected as early as after days of culture, and a maximal plateau of storage was already seen at day 12 Both proCPA and mature CPA were detected ... experiments As shown in Fig 3A, SG core protein mRNA was already expressed at day However, maximal MC protease accumulation was not obtained until about day 26 (Fig 3B), a finding that may appear contradictory, ... radioactivity As an internal standard, 200 lL of a mixture of unlabeled heparin (4 mgÆmL)1) and CS -A (5 mgÆmL)1; Sigma, Stockholm, Sweden) was added to each sample before anion exchange chromatography analysis...
  • 12
  • 438
  • 0
Risks Ahead for the Financial Industry in a Changing Interest Rate Environment pdf

Risks Ahead for the Financial Industry in a Changing Interest Rate Environment pdf

Ngày tải lên : 15/03/2014, 01:20
... losses a) Based on banks contained in respective countries' Datastream bank indices Note that such data are not available for Saudi Arabia b) From 1-Jan-10 to 29-Jul-10 c) Based on banks contained ... United Kingdom Italy France China Australia Japan Russian Federation Canada Brazil Germany Turkey South Korea India South Africa Indonesia Mexico Argentina G20 countries' total 2010b) 72.8 41.4 ... countries are: Austria, Australia, Belgium, Canada, Chile, Chinese Taipei, Finland, France, Germany, Greece, India, Ireland, Italy, Japan, the Netherlands, Norway, Portugal, Singapore, Spain, Sweden,...
  • 18
  • 384
  • 0
Báo cáo khoa học: Zinc-binding property of the major yolk protein in the sea urchin ) implications of its role as a zinc transporter for gametogenesis ppt

Báo cáo khoa học: Zinc-binding property of the major yolk protein in the sea urchin ) implications of its role as a zinc transporter for gametogenesis ppt

Ngày tải lên : 16/03/2014, 05:20
... substrate for localization of the labeled MYP Statistical analysis Data were expressed as the mean ± SEM Statistical analysis was performed using instat software (GraphPad Software) The normality ... was stored at ) 80 °C for analysis for metals Paraffin sections lm thick were prepared and stained with hematoxylin and eosin The gonadal maturity of each animal was classified into five stages according ... that in ovary at stage 1, and remained at a similar value to stage Testes at stage were not analyzed because of a lack of samples We calculated the amount of zinc bound to MYP in the gonad by multiplying...
  • 14
  • 442
  • 0
Báo cáo khoa học: A pre-docking role for microtubules in insulin-stimulated glucose transporter 4 translocation ppt

Báo cáo khoa học: A pre-docking role for microtubules in insulin-stimulated glucose transporter 4 translocation ppt

Ngày tải lên : 16/03/2014, 06:20
... translocation Statistical analysis For normally distributed data, population averages are given as mean ± SEM and statistical significance was tested using Student’s t-test Statistical significance ... GLUT4 translocation, has a functional Rab GTPase-activating protein domain Biochem J 391, 87–93 Larance M, Ramm G, Stockli J, van Dam EM, Winata S, Wasinger V, Simpson F, Graham M, Junutula JR, ... Fukuda M, Chuang TD, Chavez JA, Lienhard GE & McGraw TE (2007) Rab10, a target of the AS160 Rab GAP, is required for insulinstimulated translocation of GLUT4 to the adipocyte plasma membrane Cell...
  • 8
  • 420
  • 0