a case study of monogenic arrhythmia syndromes

Báo cáo khoa học: "Immunohistochemistry of Voltage-Gated Calcium Channel α1B Subunit in Mouse Cerebellum" pptx

Báo cáo khoa học: "Immunohistochemistry of Voltage-Gated Calcium Channel α1B Subunit in Mouse Cerebellum" pptx

Ngày tải lên : 07/08/2014, 15:20
... Pileblad, E and Nissbrandt, H Effects of local administration of L-, N-, and P/Q-type calcium channel blockers on spontaneous dopamine release in the striatum and the substantia nigra: a microdialysis ... Catterall, W .A Evidence for a voltage-dependent enhancement of neurotransmitter release mediated via 2+ the synaptic protein interaction site of N-type Ca channels Proc Natl Acad Sci U.S .A 1998, ... immunoreactive Purkinje cell dendrites are clustered to form a parasagittal array of bands that is generally reproducible between individuals and symmetrical about the midline (Fig 2) In the anterior...
  • 4
  • 236
  • 0
Báo cáo y học: " Open Access A key role for STIM1 in store operated calcium channel activation in airway smooth muscle" pptx

Báo cáo y học: " Open Access A key role for STIM1 in store operated calcium channel activation in airway smooth muscle" pptx

Ngày tải lên : 12/08/2014, 16:20
... cell capacitance STIM-2 forward primer: ACGACACTTCCCAGGATAGCA reverse primer: GACTCCGGTCACTGATTTTCAAC probe: TGCACGAACCTTCATT Measurement of [Ca2+]i HASMs (passage 4–5) were plated in black walled, ... the latter study also implicating a role for STIM2 In particular, STIM1 appears to be a major activator of calcium release activated calcium channels (ICRAC) in T lymphocytes via a mechanism ... (Hertfordshire, UK) Statistical analysis Averaged data are presented as mean ± sem Where appropriate, statistical significance was assessed by unpaired Students T tests or one-way ANOVA followed by the...
  • 8
  • 341
  • 0
Báo cáo y học: "Bench-to-bedside review: Hyperinsulinaemia/euglycaemia therapy in the management of overdose of calcium-channel blockers" ppt

Báo cáo y học: "Bench-to-bedside review: Hyperinsulinaemia/euglycaemia therapy in the management of overdose of calcium-channel blockers" ppt

Ngày tải lên : 12/08/2014, 23:23
... consumption Arterial concentrations and myocardial uptake of free fatty acids were reduced, whereas arterial concentrations and myocardial uptake of glucose and lactate remained unchanged Improvement of ... myocardial contractile efficiency by a combination of metabolic synergistic effects and calcium channel blockade Although the availability of free fatty acids is maintained, myocardial extraction ... hypokalaemia The duration of HIET should be guided by the clinical response, especially haemodynamic parameters: the goal should be haemodynamic stability after the withdrawal of vasoactive agents...
  • 6
  • 267
  • 0
Báo cáo y học: "Hyperinsulinemia-euglycemia therapy: a useful tool in treating calcium channel blocker poisoning" pps

Báo cáo y học: "Hyperinsulinemia-euglycemia therapy: a useful tool in treating calcium channel blocker poisoning" pps

Ngày tải lên : 12/08/2014, 23:24
... Critical Care Vol 10 No Boyer and Levine failing if the therapy was administered, for example, at the end of cardiopulmonary resuscitation After all, when the myocardium dies, along with ... few if any therapies are likely to satisfy any true measure of effectiveness It may also be that some patients are simply beyond recovery for any combination of therapies, even those that include ... Unfortunately, these questions are answered best by comparative clinical studies So, are we likely to ever see a clinical trial to ascertain the effectiveness of HIE therapy for the treatment of calcium...
  • 2
  • 124
  • 0
Single channel and whole cell electrophysiological characterizations of l type cav1 2 calcium channel splice variants relevance to cardiac and nervous system functions

Single channel and whole cell electrophysiological characterizations of l type cav1 2 calcium channel splice variants relevance to cardiac and nervous system functions

Ngày tải lên : 08/09/2015, 19:30
... Hypothetical model of calcium channel inactivation 96 Figure 39: Idealized steady-state activation/inactivation kinetics 99 VII ABBREVIATIONS Abbreviations AD/DA ATP+ fA nA pA ANOVA AV BaCl2 bp BLAST ... Nano Ampere Pico Ampere Analysis of Varianz Atrioventricular Barium chloride Base pair Basic Local Alignment Search Tool banana network cable Degree Celsius Calcium chloride Genes of the calcium ... the aimed evolutionary beneficial character of anxiety to serve and protect and to increase the survival chances has been lost In humans and rodents, limbic and cortical areas as the amygdala,...
  • 139
  • 444
  • 0
Functional characterization of RNA editing and alternative splicing in the carboxyl terminus of cav 1 3 calcium channel

Functional characterization of RNA editing and alternative splicing in the carboxyl terminus of cav 1 3 calcium channel

Ngày tải lên : 10/09/2015, 15:48
... 1B5407IQF ACGAAGCAGCACCAGTGTGATGCT Anti-sense 1B5717IQR TTTTGCCGAAGGAAAACCCGAGCTCCT Sense 1E5940IQF GTGGTGCAGACAGACAGCAGCTAGACT Anti-sense 1E6268IQR ACTCCGACCACTCAGGCCAGAAACA Ta (°C) CaV 54 CaV1.2 ... HA-tag-overlap-F TGTGGGAAGTTGTCGAAGGT Sense HA-tag-oligo-F CGGAGGGAAGTTCAATTTCGATGAGACAC Ta (°C) 58 58 AGACTCGTCATTATCCTTATGATGTTCCTG ATTATGCTGTTACTTTTGATG Anti-sense HA-tag-oligo-R TGTGGGAAGTTGTCGAAGGTGCTTCGCTT ... TGTGGGAAGTTGTCGAAGGTGCTTCGCTT 58 GGTTTGCATTTCATCAAAAGTAACAGCAT AATCAGGAACATCATAAGGATA Hippocampal neuron culture and transfection Low-density dissociated-cell culture of hippocampal neurons rat embryonic...
  • 174
  • 400
  • 0
Characterisation of alternative splicing of the cav1 4 calcium channel gene

Characterisation of alternative splicing of the cav1 4 calcium channel gene

Ngày tải lên : 12/09/2015, 09:42
... but retains BclI at nt4354 CATAAGCTTCTACATGCTCTGTGC GCTCTAGATAGAAGCTTATGAAGTAGAAGACA GC ATAAGAATGCGGCCGCATGCATGGAATACATT T GCTCTAGATCAGTGGGTGTTGGATCCAGC 48 For cloning Ch- 37 TCCTGATCATAAATCTCTTTGTGGCTGTCATCAT ... GCTCTGTGCCTTCCTGGGGCCGCATCAAACAC GTGTTTGATGCGGCCCCAGGAAGGCACAGAG C A1 F:5706stopXba1L EcoR1kozakMetCT MU40 A1 F5977L17Xba1 GCTCTAGATCACAGACAGGTGAAGGTGCG CCGGAATTCGCCACCATGTGTCTGCACGTGCCT GGAACCC GCTCTAGAGAGGGCGTGGACGCAGG ... GGCTGGATCCAACACC A1 F:5271U28 CCCAAGGGAACCAAAGGGCAAAACAAGC A1 F:5319L20 AGGTAGGAAAGCCGATCAGG A1 F:5411L21 CTCCTTCACCATCCAGTGTCTGC A1 F:5490U16 CGCCAGGGCAGTTGTG A1 F:5498L20 41 43 44 Reverse primer for transcript...
  • 139
  • 248
  • 0
Tài liệu Báo cáo khoa học: Effect of gadolinium on the ryanodine receptor/ sarcoplasmic reticulum calcium release channel of skeletal muscle docx

Tài liệu Báo cáo khoa học: Effect of gadolinium on the ryanodine receptor/ sarcoplasmic reticulum calcium release channel of skeletal muscle docx

Ngày tải lên : 19/02/2014, 16:20
... Tripathy et al and Herrmann-Frank et al have found activation of the channel at 100–250 lm and inactivation at higher luminal calcium concentrations [15,16] As the effect of the luminal calcium ... ¨ S Sarkozi et al The Ca2+ release channel ⁄ ryanodine receptor (RyR1) is regulated by several cytoplasmic ligands It is activated by millimolar concentrations of ATP and micromolar Ca2+, and ... Fill et al [11] and Ma et al [12] Sitsapesan & Williams observed that the channel was only regulated by the luminal calcium if it was first preactivated by ATP and cyclic ADP-ribose (cADPR) on the...
  • 8
  • 587
  • 1
Channel Characteristics

Channel Characteristics

Ngày tải lên : 14/09/2012, 11:26
... Overview Narrowband channel characterisation is primarily aimed at establishing the amplitude variation of the signal transmitted through the channel The vast majority of measurement campaigns have ... circular polarisation, the axial ratio is equal dB, while for linear polarisation, a theoretical value of infinity would be obtained Left and right hand circular polarisation’s are orthogonal, as are ... vertical and horizontal Thus, an antenna receiving a horizontally polarised wave cannot receive a vertically polarised wave and vice versa Similarly, an antenna receiving a LHCP wave cannot receive...
  • 31
  • 547
  • 0
Những giải pháp marketing nhằm nâng cao hoạt động xúc tiến cho sản phẩm Calcium Hasan 500 mg của Công ty Hasan - Dermapharm” tại thị trường Thành phố Hồ Chí Minh.pdf

Những giải pháp marketing nhằm nâng cao hoạt động xúc tiến cho sản phẩm Calcium Hasan 500 mg của Công ty Hasan - Dermapharm” tại thị trường Thành phố Hồ Chí Minh.pdf

Ngày tải lên : 05/10/2012, 16:44
... học Bihasal Glisan 30 MR (Nguồn: Phòng phát triển thị trường) Những sản phẩm chiến lược công ty cho thị trường OTC: AceHasan 200, Hasangastryl, Hasanvit, AziHasan, Hasanclar, Nifedipine Hasan 20 ... TỔNG QUAN CÔNG TY TNHH HASAN – DERMAPHARM VÀ SẢN PHẨM CALCIUM HASAN 500 MG 2.1 Công ty Hasan – Dermapharm: 2.1.1 Thông tin liên lạc: Tên giao dịch nƣớc: CÔNG TY TNHH HASAN – DERMAPHARM Tên giao dịch ... citric khan, Natri hydrocarbonat khan, Đường trắng, Natri saccharin, Kolidon, K30, PEG 6000, Hương vị cam, Ethanol TÍNH CHẤT DƢỢC LÝ: Calcium Hasan ch a muối calci ion h a dễ tan, có hàm lượng calci...
  • 69
  • 2.4K
  • 8
Intelligent Software Agents on the Internet: an inventory of currently offered functionality in the information society & a prediction of (near-)future developments

Intelligent Software Agents on the Internet: an inventory of currently offered functionality in the information society & a prediction of (near-)future developments

Ngày tải lên : 08/10/2012, 15:22
... generally agreed upon, open standards JAVA itself is not an agent-application Yet, the Java Agent Template is available which "provides basic agent functionality packaged as a Java application ... ideas and observations - an essential part of the intellectual capital of a company - will be available for everyone And neatly integrated with authoritative external sources"; Internal Databases: ... Summary Currently available agent-systems and agent-enabled applications are of a rather basic and ad hoc nature However, more complex and elaborated systems are in the making In this chapter,...
  • 100
  • 811
  • 3
Chuyển hóa Calcium and Phosphorus trên bệnh nhân suy thận

Chuyển hóa Calcium and Phosphorus trên bệnh nhân suy thận

Ngày tải lên : 22/10/2012, 15:59
... nhận hiệu cinacalcet theo hướng nhìn Calcium, Phosphorus, Parathyroid Hormone, and Cardiovascular Disease in Hemodialysis Patients: The USRDS Waves 1,3, and Study Cơ sở • Gần đây, Ca, Phos, PTH ... Cinacalcet gây giảm đáng kể CaxP  Nồng độ Calci máu thấp dùng Cinacalcet, điển hình triệu chứng, điều trò điều chỉnh thuốc gắn kết phosphate ch a Calcium, Sterol củ Vitamine D giảm liều cinacalcet ... J et al,Hypertension (2001) 38;938 Calci h a uré máu cao trình lý h a ( “di căn”) Nguyên nhân calci h a mạch máu -Sản phẩm phức hợp Ca x PO4 ( “di căn” trình họat h a - Vai trò lipids - Vai trò...
  • 70
  • 957
  • 6
Channel strategy and plan- kế hoạch chiến lược kênh phân phối

Channel strategy and plan- kế hoạch chiến lược kênh phân phối

Ngày tải lên : 24/10/2012, 14:05
... [release/version] [0.0] of the Channel Strategy and Plan The Channel Strategy and Plan is a managed document For identification of amendments, each page contains a release number and a page number Changes will ... Version [x.x] Page Channel Strategy and Plan 4.1 CHANNELS ASSESSMENT Channels Available [Insert list of all available channels here.] [Example] Direct Marketing Paid Advertising o Radio o Television ... selection will align with strategic objectives.] 6.4 Advantages [List the advantages of using the preferred channel.] 6.5 Disadvantages [List the disadvantages of using the preferred channel.] 6.6...
  • 13
  • 840
  • 1
Báo cáo y học: "A Comparative Effectiveness Study of Bone Density Changes in Women Over 40 Following Three Bone Health Plans Containing Variations of the Same Novel Plant-sourced Calcium"

Báo cáo y học: "A Comparative Effectiveness Study of Bone Density Changes in Women Over 40 Following Three Bone Health Plans Containing Variations of the Same Novel Plant-sourced Calcium"

Ngày tải lên : 25/10/2012, 11:10
... data, some of the explanation may be attributed to what appears to be optimal levels of vitamin D3 (1,000 IU) and calcium (750 mg) that were in the Plan version of AC An additional benefit may ... had an average age of 57.4 (41-89) which is consistent with the age-related decline of 1% to 2% cited above for women of menopausal age as well as with the data reported in the meta-analysis As ... benefit may be attributed to the use of a plant-sourced form of calcium that, as discussed above, appears to be more bio-available than more traditional forms of calcium Additionally, there are studies...
  • 12
  • 663
  • 0
Cắt hình phức tập sử dụng channel.

Cắt hình phức tập sử dụng channel.

Ngày tải lên : 25/10/2012, 15:24
... 2.Chọn Channel, tạo channel Red copy 3.Ctrl+L chọn hình Từ bước ,bạn thấy phân biệt màu đen trắng hình cô gái màu , chọn brush ,màu trắng tô hình 5.Tô xong , giữ Ctrl click chuột trái vào channel ... brush ,màu trắng tô hình 5.Tô xong , giữ Ctrl click chuột trái vào channel Red copy để chọn 6.Trở layer , Ctrl+shift+i , delete hình Đây kết Hy vọng giúp ích cho bạn ...
  • 8
  • 330
  • 2
Báo cáo y học: "Effect of corticosteroids on phlebitis induced by intravenous infusion of antineoplastic agents in rabbits"

Báo cáo y học: "Effect of corticosteroids on phlebitis induced by intravenous infusion of antineoplastic agents in rabbits"

Ngày tải lên : 26/10/2012, 09:57
... in animas and at the distal region in of the animals, edema (Grade 3) at the proximal region in animal and edema (Grade 2) at the proximal region in animals, and epidermal degeneration (Grades ... part of the vein in of the animals and in the distal part of the vein in of the animals Epidermal degeneration (Grades 1-3) was found in both the proximal and distal parts of the vein in all animals ... Japan) A 10 mg/mL vial of VNR was diluted with normal saline (Otsuka Normal Saline, Otsuka Pharmaceutical Factory, Inc., Tokushima, Japan) to provide a 0.6 mg/mL solution, while a 10 mg vial of...
  • 6
  • 711
  • 0
Báo cáo y học: "Thioglycosides as inhibitors of hSGLT1 and hSGLT2: Potential therapeutic agents for the control of hyperglycemia in diabetes"

Báo cáo y học: "Thioglycosides as inhibitors of hSGLT1 and hSGLT2: Potential therapeutic agents for the control of hyperglycemia in diabetes"

Ngày tải lên : 26/10/2012, 10:04
... Mizuma T, Hagi K, and Awazu S Intestinal transport of beta-thioglycosides by Na+/glucose cotransporter J Pharm Pharmacol 2000; 52: 303-310 28 Hirayama BA, Lostao MP, Panayotova-Heiermann M, et al ... significantly transported, while a ratio greater than demonstrates transport across the plasma membrane mediated by SGLT To validate this assay, studies with D-glucose as a substrate of SGLT ... cotransporter, in neonatally streptozotocin-treated rats European Journal of Pharmacology 2000; 391: 183-192 22 Oku A, Ueta K, Arakawa K, et al Antihyperglycemic effect of T-1095 via inhibition of...
  • 9
  • 650
  • 0
Hydraulic modeling of open channel flows over an arbitrary 3-d surface and its applications in amenity hydraulic engineering

Hydraulic modeling of open channel flows over an arbitrary 3-d surface and its applications in amenity hydraulic engineering

Ngày tải lên : 06/11/2012, 10:35
... conference papers: Anh T N and Hosoda T.: Depth-Averaged model of open channel flows over an arbitrary 3D surface and its applications to analysis of water surface profile Journal of Hydraulic Engineering, ... to analysis of water surface profile of flows in Amenity Hydraulic Structures A general mathematical model based on a new coordinate system attached to 3D arbitrary bottom surface with an axis ... calculated flow pattern in a shallow bend, in which the depth gradually approaches to zero toward the banks by mean of a depth-averaged model Ponce and Yabusaki (1981) applied the shallow water...
  • 127
  • 595
  • 0
Cắt hình phức tạp sử dụng Channel

Cắt hình phức tạp sử dụng Channel

Ngày tải lên : 13/11/2012, 15:39
... 2.Chọn Channel, tạo channel Red copy 3.Ctrl+L chọn hình Từ bước ,bạn thấy phân biệt màu đen trắng hình cô gái màu , chọn brush ,màu trắng tô hình 5.Tô xong , giữ Ctrl click chuột trái vào channel ... brush ,màu trắng tô hình 5.Tô xong , giữ Ctrl click chuột trái vào channel Red copy để chọn 6.Trở layer , Ctrl+shift+i , delete hình Đây kết Hy vọng giúp ích cho bạn ...
  • 8
  • 953
  • 6