a brief neuropsychological report based on halstead reitan and other information
Study of a rockfall protective fence based on both experimental and numerical approches
Ngày tải lên :
21/05/2016, 23:07
... based on a finite element method requires the consideration of nonlinear geometrical and mechanical behavior and particularly adequate contact conditions For this reason, nonlinear dynamic analysis ... to have a remarkable capacity to catch rocks and thereby prevent damage to vehicles and houses as well as fatalities Basically, with regarding self-standing and accordance with narrow spaces ... animals, and earthquakes Additionally, human activities such as construction practices, blasting, vibration from equipment and trains, and stress relief due to excavation may be considered as...
- 99
- 253
- 0
Tài liệu Youth Safety on a Living Internet: Report of the Online Safety and Technology Working Group pptx
Ngày tải lên :
18/02/2014, 00:20
... technological mandates and instead enhance funding and encourage collaborative, multifaceted, and multi-stakeholder initiatives and approaches to enhance online safety via innovation and cooperation ... fraud and consumer Digital dating abuse / protection sexting Copyright and piracy Security and privacy Cyberwellness and balance Social engineering awareness Online/Digital Reputation Gaming Safety ... parent/teachers guide to educate 9-15 year olds about Cyber Bullying, CyberPredators and Plagiarism School assembly details are also available AT&T Education Advocates Program AT&T Education Advocates/Directors...
- 148
- 435
- 0
Tài liệu Báo cáo khoa học: Shaped by the environment – adaptation in plants Meeting report based on the presentations at the FEBS Workshop ‘Adaptation Potential in Plants’ 2009 (Vienna, Austria) pdf
Ngày tải lên :
18/02/2014, 11:20
... commensal and pathogenic isolates, has revealed that mutation rates vary between isolates [6,7] and, furthermore, that mutation rates are not constant but can increase in response to environmental stress ... vernalization and methylation Plant Cell 11, 445–458 Johanson U, West J, Lister C, Michaels S, Amasino R & Dean C (2000) Molecular analysis of FRIGIDA, a major determinant of natural variation in Arabidopsis ... could play a pivotal role in adaptation and speciation Mechanisms of speciation A species, the lowest taxonomic category in the hierarchical classification of living organisms introduced by Carolus...
- 10
- 666
- 0
Báo cáo khoa học: "A New Statistical Parser Based on Bigram Lexical Dependencies" potx
Ngày tải lên :
08/03/2014, 07:20
... accuracy as the beam is narrowed DARPA Speech and Natural Language Workshop T Briscoe and J Carroll 1993 Generalized LR Parsing of Natural Language (Corpora) with Unification -Based Grammars Computational ... Dalton, Ga., has annual sales of about $1.18 billion, and has economies o f scale and lower raw-material costs that are expected to boost the profitability o f Armstrong's brands, sold under the Armstrong ... 33rd Annual Acknowledgements 128-135 L Ramshaw and M Marcus 1995 Text Chunking using Transformation -Based Learning Pro- I would like to thank Mitch Marcus, Jason Eisner, Dan Melamed and Adwait Ratnaparkhi...
- 8
- 320
- 0
Báo cáo khoa học: Sequences and structural organization of phospholipase A2 genes from Vipera aspis aspis, V. aspis zinnikeri and Vipera berus berus venom Identification of the origin of a new viper population based on ammodytin I1 heterogeneity docx
Ngày tải lên :
17/03/2014, 03:20
... CAGGAAACAGCTATGAC CGGAATTCTGAAGGTGGCCCGCC AGGTGACAG CGCGGATCCAATCTTGATGGGGC AGCCGGAGAGG AGGAYTCTCTGGATAGTGG CTCACCACAGACGATWTCC CGGTAAGCCCATAACGCCCA CAGGCCAGGATTTGCAGCC CATAAACAYGAGCCAGTTGCC GAGTGGATGCACAGTCGTTG ... GAGTGGATGCACAGTCGTTG GAAACGGAGGTAGTGACACAT GCCTGCTCGAATTCGGGATG CTCCTTCTTGCACAAAAAGTG CTGCTCGAATTCGGGATG GTCYGGGTAATTCCTATATA GTGATCGAATTTGGGAAGATGATCCA CCCTTGCATTTAAACCTCAGGTACAC a Specific primers ... contained a TAA stop codon, an AATAAA polyadenylation site 80 bp downstream from the stop codon, and a TATA-like box (CATAAAA) 270 bp upstream from the ATG translation initiation codon, as found in other...
- 10
- 451
- 0
Báo cáo khoa học: A novel transmembrane topology of presenilin based on reconciling experimental and computational evidence pptx
Ngày tải lên :
23/03/2014, 13:20
... Evidence for a six-transmembrane domain structure of presenilin J Biol Chem 272, 12047–12051 Nakai T, Yamasaki A, Sakaguchi M, Kosaka K, Mihara K, Amaya Y & Miura S (1999) Membrane topology of Alzheimer’s ... site aspartate residues are located in TM regions six and seven (indicated with ‘D’) HRs are indicated in Roman numerals (TLN) and APP have also been shown to interact with PS Once again, PS ... study we have used computational prediction methods to analyze PS topology, and have combined these results with previous data from low-resolution experiments and functional data on c-secretase to...
- 7
- 458
- 0
Báo cáo khoa học: From functional genomics to systems biology Meeting report based on the presentations at the 3rd EMBL Biennial Symposium 2006 (Heidelberg, Germany) Sergii Ivakhno pot
Ngày tải lên :
30/03/2014, 09:20
... protein interaction data with data on gene expression, localization, function, evolutionary conservation, protein structure and binary interactions Finally, Gavin reported the development of a new scoring ... et al [12] is already available through Agendia), it could be the first one to obtain FDA approval for clinical tests Haferlach estimates that, once the AmpliChip is available, it will provide a ... the chip -on- chip approach The advantage of chromosome conformation capture is that it can detect regulatory elements that are active only in a particular cellular state, developmental stage or...
- 10
- 478
- 0
Báo cáo khoa học: "A Novel Discourse Parser Based on Support Vector Machine Classification" docx
Ngày tải lên :
30/03/2014, 23:20
... gold standard) Standard performance indicators for such a task are precision, recall and F-score as measured by the PARSEVAL metrics (Black et al., 1991), with the specific adaptations to the case ... impact of using homogeneous newspaper articles that could carry important biases in prose style and lexical 2.3 Input Data and Feature Extraction Both S and L classifiers are trained using manually ... discourse parsing and summarization MIT Press N Asher and A Lascarides 2003 Logics of conversation Cambridge University Press J Oberlander, J.D Moore, J Oberlander, A Knott, and J Moore 1999 Cue phrases...
- 9
- 390
- 0
Báo cáo sinh học: " Development of a model for marburgvirus based on severe-combined immunodeficiency mice" doc
Ngày tải lên :
18/06/2014, 18:20
... Research was conducted in compliance with the Animal Welfare Act and other federal statutes and regulations relating to animals and experiments involving animals and adhered to principles stated ... of guinea pigs that can be evaluated at one time (based on BSL-4 space limitations, as well as physical demands on investigators and technicians) and the large amounts of compounds that must ... Molecular characterization of guinea pig-adapted variants of Ebola virus Virology 2000, 277(1):147-155 Ebihara H, Takada A, Kobasa D, Jones S, Neumann G, Theriault S, Bray M, Feldmann H, Kawaoka Y:...
- 13
- 456
- 0
Báo cáo hóa học: " A biofeedback cycling training to improve locomotion: a case series study based on gait pattern classification of 153 chronic stroke patients" pdf
Ngày tải lên :
19/06/2014, 08:20
... walking share a similar kinematic pattern: both tasks are cyclical, require reciprocal flexion and extension movements of hip, knee, and ankle, and have an alternating activation of agonist/antagonist ... MG, Balasubramanian CK, Behrman AL, Kautz SA: Validation of a speed -based classification system using quantitative measures of walking performance poststroke Neurorehabilitation and Neural Repair ... writing; EA participated to study design, data collection and analysis, and manuscript definition; PR participated at data collection; EG participated at data collection; FM participated to recruitment...
- 13
- 443
- 0
Báo cáo hóa học: " Development of a model for marburgvirus based on severe-combined immunodeficiency mice" docx
Ngày tải lên :
20/06/2014, 01:20
... Research was conducted in compliance with the Animal Welfare Act and other federal statutes and regulations relating to animals and experiments involving animals and adhered to principles stated ... of guinea pigs that can be evaluated at one time (based on BSL-4 space limitations, as well as physical demands on investigators and technicians) and the large amounts of compounds that must ... Molecular characterization of guinea pig-adapted variants of Ebola virus Virology 2000, 277(1):147-155 Ebihara H, Takada A, Kobasa D, Jones S, Neumann G, Theriault S, Bray M, Feldmann H, Kawaoka Y:...
- 13
- 431
- 0
Báo cáo hóa học: " A human motion model based on maps for navigation systems" pptx
Ngày tải lên :
21/06/2014, 01:20
... where a large conference hall is close to more constraining rooms and corridors Multimodal situations arise when a person walks past a door at an angle and a certain fraction of the particles walk ... and implementation The developed model was tested and evaluated using an already available distributed simulation and demonstration environment for positioning indoors and outdoors The environment ... Novel approach to nonlinear and nonGaussian Bayesian state estimation Proc Inst Elect Eng 140, 107–113 (1993) GK Schmidt, K Azam, Mobile robot path planning and execution based on a diffusion equation...
- 14
- 488
- 0
Báo cáo hóa học: " Research Article A Skin Detection Approach Based on Color Distance Map" doc
Ngày tải lên :
21/06/2014, 22:20
... USA, January 2006 M.-H Yang and N Ahuja, “Gaussian mixture model for human skin color and its applications in image and video databases,” in Storage and Retrieval for Image and Video Databases ... the standard deviation, σ, of the portion of histogram at the right side of SSC We then generated ideal data for a Gaussian distribution having the mean at SSC and standard deviationσ and plotted ... any color space Though the algorithm mainly operates on a grayscale image (DM), the processing is actually done based on color information The scalar distance map contains the information of the...
- 10
- 227
- 0
Báo cáo hóa học: "Research Article A Color Topographic Map Based on the Dichromatic Reflectance Model" doc
Ngày tải lên :
21/06/2014, 22:20
... that [1] J Serra, Image Analysis and Mathematical Morphology, Academic Press, Orlando, Fla, USA, 1983 [2] V Caselles, B Coll, and J.-M Morel, “Topographic maps and local contrast changes in natural ... EURASIP Journal on Image and Video Processing [23] S K Nayar, X.-S Fang, and T Boult, “Separation of reflection components using color and polarization,” International Journal of Computer Vision, ... [24] A Tr´ meau, C Fernandez-Maloigne, and P Bonton, Image e num´rique couleur: De l’acquisition au traitement, Dunod, e Paris, France, 2004 [25] X Zhang and B A Wandell, A spatial extension of...
- 14
- 343
- 0
Báo cáo hóa học: " Research Article A Suboptimal PTS Algorithm Based on Particle Swarm Optimization Technique for PAPR Reduction in OFDM Systems" potx
Ngày tải lên :
21/06/2014, 23:20
... monopole antenna using a particle swarm optimization approach,” IEEE Transactions on Antennas and Propagation, vol 53, no 10, pp 1–7, 2005 [24] J Robinson and Y Rahmat-Samii, “Particle swarm optimization ... et al Start define solution space Generate initial population random position and velocity vectors Evaluate finess of each particle and store the global and person best positions Decision taken ... and also associated to the position of the particle itself and that of the global best one by acceleration factors c1 and c2 The c1 and c2 are therefore referred to as the cognitive and social...
- 8
- 406
- 0
Báo cáo hóa học: " Research Article A Fixed Point Theorem Based on Miranda Uwe Sch¨ fer a" doc
Ngày tải lên :
22/06/2014, 06:20
... was started References [1] C Miranda, “Un’osservazione su un teorema di Brouwer,” Bollettino dell’Unione Matematica Italiana, vol 3, pp 5–7, 1940 [2] M N Vrahatis, A short proof and a generalization ... remarks about Miranda’s theorem,” Analele Universitatii din Craiova Seria Matematica Informatica, vol 27, pp 6–13, 2000 Uwe Sch¨ fer: Institut f¨ r Angewandte und Numerische Mathematik, Fakult¨ ... Transactions on Numerical Analysis, vol 17, pp 102–111, 2004 [6] N H Pavel, “Theorems of Brouwer and Miranda in terms of Bouligand-Nagumo fields,” Analele Stiintifice ale Universitatii Al I Cuza din Iasi...
- 5
- 225
- 0
Báo cáo hóa học: " Research Article A Fixed Point Theorem Based on Miranda Uwe Sch¨ fer a" docx
Ngày tải lên :
22/06/2014, 19:20
... was started References [1] C Miranda, “Un’osservazione su un teorema di Brouwer,” Bollettino dell’Unione Matematica Italiana, vol 3, pp 5–7, 1940 [2] M N Vrahatis, A short proof and a generalization ... remarks about Miranda’s theorem,” Analele Universitatii din Craiova Seria Matematica Informatica, vol 27, pp 6–13, 2000 Uwe Sch¨ fer: Institut f¨ r Angewandte und Numerische Mathematik, Fakult¨ ... Transactions on Numerical Analysis, vol 17, pp 102–111, 2004 [6] N H Pavel, “Theorems of Brouwer and Miranda in terms of Bouligand-Nagumo fields,” Analele Stiintifice ale Universitatii Al I Cuza din Iasi...
- 5
- 242
- 0
Báo cáo hóa học: " Research Article Video Summarization Based on Camera Motion and a Subjective Evaluation Method" potx
Ngày tải lên :
22/06/2014, 19:20
... translation Frames Translation Zoom Static Shot Frames Static Translation Static (a) Frames Frames Frames Translation Translation Static Zoom 1st iteration Translation Static Frames (b) 2nd iteration ... static/dynamic separation Stage 3: temporal integration of zoom/translation Phase 3: camera motion description Camera motion classification and description Figure 1: System architecture for camera motion ... this paper, we propose a new method of video summary based on camera motions (translation and zoom) or on static camera We think that camera motion carries important information on video content...
- 12
- 342
- 0
Báo cáo hóa học: " A Receiver for Differential Space-Time π/2-Shifted BPSK Modulation Based on Scalar-MSDD and the EM Algorithm" ppt
Ngày tải lên :
23/06/2014, 00:20
... Bhargava in a transmit-diversity only scenario [14], and by Lao and Haimovich in an interference suppression and receive-diversity setting [15] In addition, Tarasak and Bhargava investigated ... modulation, space-time processing, channel estimation, and performance analysis He was the coauthor of a best paper award at IEEE VTC’04 Fall in Los Angeles, and at IEEE CCECE’04 in Niagara Falls Paul ... that the new fading gains g1 and g2 are independent Gaussian random variables, with a variance of Similarly, it can also be shown that the new noise samples w1 [k] and w2 [k] are independent and...
- 9
- 258
- 0
Báo cáo hóa học: " Video Waterscrambling: Towards a Video Protection Scheme Based on the Disturbance of Motion Vectors Yann Bodo" pdf
Ngày tải lên :
23/06/2014, 01:20
... book chapters, and international patents He gave several tutorials on digital watermarking and image compression at major conferences He has been an invited speaker and/ or member of the program committee ... cryptography and watermarking In [35], Cheng and Li perform a partial encryption of the content by using a wavelet trans- EURASIP Journal on Applied Signal Processing form and a quadtree data structure ... he can only find an approximation of the original block and an approximation of the original motion vector This approximation error causes highly visible artifacts that are drastically increased...
- 14
- 580
- 0