a brief introduction to predictive toxicology

PREDICTIVE TOXICOLOGY - CHAPTER 3 pps

PREDICTIVE TOXICOLOGY - CHAPTER 3 pps

Ngày tải lên : 11/08/2014, 17:22
... the array by array approach and the procedure based on analysis of variance (ANOVA) (Fig 3) The array by array approach is a multistep procedure comprising log transformation, normalization, and ... from DNA microarray © 2005 by Taylor & Francis Group, LLC 80 Marchal et al data using analysis of variance and a Bayesian statistical framework Analysis of global gene expression in Escherichia coli ... with an f value of 0.02 on the normalized data (R ¼ red; G ¼ green) 3.1.3 ANOVA-based Preprocessing ANOVA can be used as an alternative to the array by array approach (24,27) In this case, it can...
  • 56
  • 160
  • 0
Báo cáo y học: "Computational Biology and Bioinformatics" doc

Báo cáo y học: "Computational Biology and Bioinformatics" doc

Ngày tải lên : 09/08/2014, 20:20
... MH analyzed mRNA microarray data, XG performed miRNA target gene expression assays, XC analyzed miRNA data, BAT and DMS contributed plant materials, and PM, VA, AWW and ZJC analyzed data and ... 5'AAGAGUUCCCUUCAAUCCAAG3' 3'AUCUCGAGGGAAGUUAGGUUU5' 9/ 10 109 5'UGGCAUGCAGGGAGCCAGGCA3' 3'ACCGUAUGUCCCUCGGUCCGU5' 3/ 10 2005 5'AGGCAUACAGGGAGCCAGGCA3' 3'ACCGUAUGUCCCUCGGUCCGU5' 10/ 10 91 5'UUUACGUGCCCUGCUUCUCCA3' ... their targets Cellular RNAs were annotated based on homology to: A thaliana and Brassica napus mitochondrial DNA; G hirsutum plastid DNA; plant small nuclear RNAs (snRNAs) and small nucleolar RNAs...
  • 21
  • 250
  • 0
Computational Biology and Applied Bioinformatics

Computational Biology and Applied Bioinformatics

Ngày tải lên : 11/04/2015, 11:27
... that attempts can be made to maximize the gain on huge amount of available sequence data As compared to classical phylogeny based on morphological data, molecular phylogeny has distinct advantages, ... to accelerate biological data analysis that use that algorithm Hasan and Al-Ars provide a thorough discussion and comparison of available methods and hardware implementations for sequence alignment ... 187 Laiq Hasan and Zaid Al-Ars Case Studies 203 Chapter 10 Retrieving and Categorizing Bioinformatics Publications through a MultiAgent System 205 Andrea Addis, Giuliano Armano, Eloisa Vargiu and...
  • 456
  • 175
  • 0
Computational Intelligence and Pattern Analysis in Biology Informatics potx

Computational Intelligence and Pattern Analysis in Biology Informatics potx

Ngày tải lên : 30/03/2014, 03:20
... Sourangshu Bhattacharya, Chiranjib Bhattacharyya, and Nagasuma R Chandra Characterization of Conformational Patterns in Active and Inactive Forms of Kinases using Protein Blocks Approach 169 G Agarwal, ... Soumi Sengupta and Sanghamitra Bandyopadhyay PART IV MICROARRAY DATA ANALYSIS 11 Integrated Differential Fuzzy Clustering for Analysis of Microarray Data 259 Indrajit Saha and Ujjwal Maulik 12 Identifying ... Indian Statistical Institute, Kolkata, India Chiranjib Bhattacharyya, Department of Computer Science and Automation, Indian Institute of Science, Bangalore, India Malay Bhattacharyya, Machine Intelligence...
  • 395
  • 366
  • 0
algebraic statistics for computational biology - lior pachter and bernd sturmfels

algebraic statistics for computational biology - lior pachter and bernd sturmfels

Ngày tải lên : 08/04/2014, 13:10
... ℓ(θ) Example 1.16 Our data are two DNA sequences of length 40: ATCACCAAACATTGGGATGCCTGTGCATTTGCAAGCGGCT ATGAGTCTTAAACGCTGGCCATGTGCCATCTTAGACAGCG (1.41) We wish to test the hypothesis that these ... which to describe the process at the heart of DiaNA’s randomness Chapter offers a fairly self-contained introduction to algebraic statistics Many concepts of statistics have a natural analog in algebraic ... language of abstract algebra The algebraic language for statistics clarifies many of the ideas central to the analysis of discrete data, and, within the context of biological sequence analysis,...
  • 432
  • 267
  • 0
SYSTEMS AND COMPUTATIONAL BIOLOGY – BIOINFORMATICS AND COMPUTATIONAL MODELING ppt

SYSTEMS AND COMPUTATIONAL BIOLOGY – BIOINFORMATICS AND COMPUTATIONAL MODELING ppt

Ngày tải lên : 28/06/2014, 10:20
... Rodríguez-Garc a and Juan de Dios Alché Chapter 13 Biological Data Modelling and Scripting in R 261 Srinivasan Ramachandran, Rupanjali Chaudhuri, Srikant Prasad Verma, Ab Rauf Shah, Chaitali Paul, ... Shreya Chakraborty, Bhanwar Lal Puniya and Rahul Shubhra Mandal Chapter 14 Improving Bio-technology Processes Using Computational Techniques 289 Avinash Shankaranarayanan and Christine Amaldas Chapter ... continuously updated database of genetic and molecular biology data for the model higher plant Arabidopsis thaliana is maintained (TAIR Database, 2009) This data available from TAIR include the...
  • 346
  • 251
  • 0
Báo cáo y học: " Bioinformatics and Computational Biology, University of North Carolin" ppsx

Báo cáo y học: " Bioinformatics and Computational Biology, University of North Carolin" ppsx

Ngày tải lên : 14/08/2014, 07:21
... C57BL6 Wap Tag CA-21 5A C57BL6 Wap Tag CA-21 3A C57BL6 Wap Tag CA-22 6A C57BL6 Wap Tag CA-226B C57BL6 Wap Tag CA-22 4A FVB/N C3(1) Tag #84 FVB/N C3(1) Tag E29- 5A- 645 FVB/N C3(1) Tag #86 FVB/N C3(1) Tag ... 232 human samples and classified them as basallike, luminal, HER2+/ER-, claudin-low, and normal breastlike according to a clustering analysis of the human dataset only (Additional data file 6), ... following additional data are available with the online version of this paper Additional data file is a table listing mouse tumor and normal sample associated data, including source, transgene and...
  • 17
  • 224
  • 0
Báo cáo y học: "Computational Biology, Dana-Farber Cancer Institute and Harvard School of Public Health" pptx

Báo cáo y học: "Computational Biology, Dana-Farber Cancer Institute and Harvard School of Public Health" pptx

Ngày tải lên : 14/08/2014, 20:22
... case, we cannot use a sample swap to calculate FDR, and the data quality of each sample needs to be evaluated against a real control Model evaluation The two key features of MACS are: empirical ... bias from a ChIP sample alone when a control is not available To demonstrate this, we applied MACS to FoxA1 ChIP-Seq and control data separately Using the same parameters, all the control peaks ... data are available Additional data file contains supporting Figures S1-S6, and supporting Tables S1 and S2 Acknowledgements We thank Barbara Wold, Ting Wang, Jason Lieb, Sevinc Ercan, Julie Ahringer,...
  • 9
  • 325
  • 0
Post-Harvest Biology and Technology of Citrus Fruits

Post-Harvest Biology and Technology of Citrus Fruits

Ngày tải lên : 03/04/2013, 20:58
... Respiration and Ethylene Production Rates These respiration rates are about double those reported in USDA Handbook 66 (2-4 at 5ºC and 10-17 ml CO2/kg.hr at 20ºC) for mandarins and oranges Skin Staining ... Plant Pattern Packer -1 Hand Packing Citrus Fruits Pattern Packer -2 Packing Into Consumer Bags Packed Boxes May Be Slightly Vibrated to Settle Fruits With the Box Palletized Boxes In Storage ... Symptoms on Lemons From: Jim Adaskaveg Alternatives For Citrus Decay Control • New chemicals (e.g Gauzatine, Prochloraz) • Controlled atmospheres (including carbon monoxide) • Ionizing radiation...
  • 10
  • 617
  • 1
Tài liệu Computational Biology & Bioinformatics: A Gentle Overview ppt

Tài liệu Computational Biology & Bioinformatics: A Gentle Overview ppt

Ngày tải lên : 13/12/2013, 00:15
... GATCATGTCCATGTTCTAGTCAT GATAGTTGATTCTAGTGTCCTG (b) RNA Data (4 letter strings) ACAGAGGAGAGCUAGCUUCAG GCUAGCACGCCUAGUAAGCGCU GCAGUAAGUAGUUAGCCUGCUG AGUCAGGCUGAGUUCAAGCUAG (c) Protein Data (20 letter strings) ... Laboratory DNA database (EMBL), GenBank at National Center for Biotechnology information, Bethesda and DNA Data Bank Japan (DDBJ), and Protein databases at SWISS-PROT (Protein sequence database at ... nonsensical sequences of A, G, C and T: TCCTGAT AAGTCAG TGTCTCCT GAGTCTA GCTTCTG TCCATGC TGATCAT GTCCATG TTCTAGT CATGATA GTTGATTC TAGTGTCC TGATTAG CCTTGA ATCTTCT AGTTCT GTCCAT TATCCAT But it...
  • 13
  • 362
  • 0
Tài liệu Measuring Immunity: Basic Biology and Clinical Assessment doc

Tài liệu Measuring Immunity: Basic Biology and Clinical Assessment doc

Ngày tải lên : 14/02/2014, 15:20
... John H Yim 543 48 Autoimmunity – vasculitis Jan Willem Cohen Tervaert and Jan Damoiseaux 560 49 Transplantation Darshana Dadhania, Choli Hartono and Manikkam Suthanthiran 569 50 Viral responses – ... many cell types and mediates both apoptosis by activation of caspases thru death domain signaling and nuclear factor kappa B (NF␬B) activation of proinflammatory cytokine transcription; whereas, ... Kellermann and Kenneth A Foon 14 Rheumatoid factors Martin A. F.J van de Laar 15 Autoantibodies Ezio Bonifacio and Vito Lampasona 16 Antibody affinity using fluorescence Sergey Y Tetin and Theodore...
  • 758
  • 349
  • 0
Tài liệu Báo cáo khoa học: Computational processing and error reduction strategies for standardized quantitative data in biological networks doc

Tài liệu Báo cáo khoa học: Computational processing and error reduction strategies for standardized quantitative data in biological networks doc

Ngày tải lên : 19/02/2014, 07:20
... dynamics for phosphorylated and total cytoplasmic STAT3 obtained by immunoblotting of cytoplasmic lysates, as well as immunoprecipitates (data not shown), demonstrated that our automated computational ... computational data processing is robust and reliably applicable for both methods These tools facilitate the standardized and automated generation of quantitative data and permit the cost-effective assembly ... immunoglobulin and quantified by LumiImager analysis (B) Time after Epo stimulation was plotted against the signals of HA-EpoR and the calibrator GST-EpoR A spline smoothing the calibrator signal was used to...
  • 12
  • 467
  • 0
Optical Interferometry for Biology and Medicine docx

Optical Interferometry for Biology and Medicine docx

Ngày tải lên : 05/03/2014, 10:20
... representation of a complex number plots the real part along the x-axis and the imaginary part along the y-axis using Euler’s formula to separate a complex exponential into a real and an imaginary part ... phase quadrature) along the imaginary axis In a phasor diagram, phase modulation on a wave is represented as a small phasor orthogonal to the carrier phasor In this example, the phase modulation ... in a holographic film, or it can be recorded as a digital hologram on the surface of a detector array like a chargecoupled device (CCD) as in a digital video recorder or a digital camera Physical...
  • 367
  • 5.4K
  • 0
Computational Complexity and Information Asymmetry in Financial Products pptx

Computational Complexity and Information Asymmetry in Financial Products pptx

Ngày tải lên : 06/03/2014, 19:20
... defaults) is that if we let X be a random variable equalling if Party X defaults (say in one year) and equal to otherwise, then Party A pays a certain amount iff X = Naturally, the value that ... Journal of Finance, pages 785–798, 1997 [BCC+ 09] A Bhaskara, M Charikar, E Chlamtac, U Feige, and A Vijayaraghavan Detecting high log-density: An o(n1/4 )-approximation for densest k-subgraph Manuscript ... by Applebaum et al [ABW09] as a source for public key cryptography7 The state of art algorithms for both the worst-case and average-case problems are from a recent paper of Bhaskara et al [BCC+...
  • 27
  • 605
  • 0
Báo cáo khoa học: "COMPUTATIONAL PLEXITY AND LEXICAL FUNCTIONAL GRAMMAR" docx

Báo cáo khoa học: "COMPUTATIONAL PLEXITY AND LEXICAL FUNCTIONAL GRAMMAR" docx

Ngày tải lên : 08/03/2014, 18:20
... categorizations; for example, baby can be both a Noun and a Verb If we had picked baby to be a Verb, and hence had adupted ~hatevcr features are associated with the Verb entry for baby to be propagated up the ... the language generated by a lexical-functional grammar is that it can be generated by this base grammar:, such a sentence is then said to have a well-formed constituent structure For example, ... "F" Finally, LFG also provides a way to express the familiar patterning of grammatical relations (e.g "Subject" and "Object") found in natural language For example, transitive verl~ must have objects...
  • 6
  • 390
  • 0
Cell biology and plamid

Cell biology and plamid

Ngày tải lên : 13/03/2014, 17:52
... membrane and many organelles - bacteria and their relatives are all prokaryotic _ cells - more complex cells - have a nucleus and many organelles - all cells of plants, animals, fungi, and ... surrounding a hollow core - similar to the basal body of flagella 26 Cytoskeleton - scaffolding of proteins that transport materials, position and move organelles, maintain and change cell shape, ... bacteria Mitochondria are the descendants of bacteria that were capable of oxidative respiration Chloroplasts are the descendants of photosynthetic bacteria 34 Evidence: Both have their own DNA and...
  • 35
  • 331
  • 1
Biotechnology of Microbial Xylanases: Enzymology, Molecular Biology and Application

Biotechnology of Microbial Xylanases: Enzymology, Molecular Biology and Application

Ngày tải lên : 13/03/2014, 21:56
... linked to rhamnose and galacturonic acid in order to make alkali resistant end groups of xylan chain Arabinoxylan is usually found in Poaceae (Fig 1) Similar to other biopolymers xylan is also capable ... xylanases from both bacterial and fungal microflora7 A Bacterial Xylanases Bacteria just like in the case of many industrial enzymes fascinated the researchers for alkaline thermostable xylanase ... thermostable xylanase from Bacillus sp strain SPS-0, Enzyme Microb.Technol 26, 187, 2000 97 Takahashi, H., Nakai, R and Nakamura, S., Purification and partial characterization of a basic xylanase...
  • 34
  • 635
  • 2
Papaya biology and biotechnology

Papaya biology and biotechnology

Ngày tải lên : 13/03/2014, 22:03
... Empoasca papayae Oman and E stevensi transmit the PBT agent Empoasca papayae is reported as the primary vector in Puerto Rico, the Dominican Republic, Haiti, and Jamaica, E papayae and E dilitara ... Chemical treatments can cause fruit damage and reduce the external fruit quality C papaya -galactosidase/galactanase (-galactoside galactohydrolase; EC 3.2.1.23) isoforms, -gal I, II and III are as softening ... names such as papayer and papaw are also heard The French refer to the fruit as papaya or to the plant as papayer, or sometimes as figuier des ẻles For standardization, we refer to C papaya as...
  • 27
  • 637
  • 0
Nanotechnology for Biology and Medicine docx

Nanotechnology for Biology and Medicine docx

Ngày tải lên : 14/03/2014, 10:20
... as healing progresses towards granulation tissue formation and facilitates fibroblast migration The neutrophils are activated during chemotaxis and produce elastase and collagenase to facilitate ... to each other or to the underlying basal lamina Examples would include capillaries that consist of a single layer of endothelial cells attached to a basal I Titushkin et al Fig Schematic cartoon ... they are four times smaller Aha! So I manufacture a quarter-size lathe; I manufacture quarter-size tools; and I make, at the one-quarter scale, still another set of hands again relatively onequarter...
  • 251
  • 4.8K
  • 0
HERONS, EGRETS AND BITTERNS Their biology and conservation in Australia docx

HERONS, EGRETS AND BITTERNS Their biology and conservation in Australia docx

Ngày tải lên : 14/03/2014, 21:20
... Ardeinae (day herons) Ardea ibis Ardea pacifica Ardea sumatrana Ardea alba Ardea pictata Ardea intermedia Egretta novaehollandiae Egretta garzetta Egretta sacra Butorides striatus Nyctocoracinae ... Gatton–Brisbane area Gatton Maryborough Palmwoods Buderim Bald Hills Doboy Murwillumbah New South Wales Grafton South Australia Newcastle area Victoria New Zealand 300 km King Island Tasmania ... on into larger streams and impoundments Australasian Bittern habitat near Leeton, New South Wales Across the world, heron habitats are under assault as wetlands are filled or drained for a variety...
  • 145
  • 918
  • 0