... Ma Xiaoxiao, Wang Xi, Nirmalya Bag, Sun Guangyu, Angela Koh, Huang Shuangru, Sibel Yavas, Andreas Karampatzakis, Shi Hua Teo, Shiying Lim, Patrick Kramer, Kaijie Herbert Fan, and Kumaravel Kandaswamy ... And special thanks to SPIM users Antonija, Adam, Angela, Xuewen, Andreas, and Kumar I would like to acknowledge nancial, academic and technical support from department of chemistry and center ... levels of my academic career, thanks a lot for your constant help and support To all my friends, Ajay, Anuradha, Debanjan, Jasmine, Kuldeep, Rahul, Subha, Veer Bhadur, Zubair and many more for their...
... also made available Anand’s model uses an internal scalar variable called the deformation resistance to represent the isotropic resistance to the inelastic flow ofthe material, and is thus able ... solver such as the AMG (Algebraic Multi Grid) equation is a particular strength ofthe ANSYS Mechanical program Moreover, the calculation can take advantage of parallel processing in a shared memory ... troubleshooting tools ANSYS offered contact analysis features as early as Release 2.0, and then evolved the state ofthe art according to advancing analysis needs Table provides a summary of that evolution...
... ANOVA The effect ofthe amino acid supplement on egg ␦13C was tested in the 1998 data set with ANOVA, including sugar type, day, andthe interaction between sugar and amino acids as effects The ... standard deviation of carbon standards combusted, distilled, and analyzed together with samples was 0.028‰ 13 Egg protein composition and ovarian dynamics The elemental composition of five batches ... the two years ␦13C of larval and adult dietary components Samples of larval host plant (including V labrusca, V novae-angliae, andA brevipedunculata from several collection sites) ranged in ␦13C...
... division is between East and West The border between these two areas goes around Pleven and Teteven, and it is the border of “yat” realization as presented in the traditional dialectological atlases ... Multidimensional scaling is data analysis technique that provides a spatial display ofthe data revealing relationships betweenthe instances in the data set (Davison, 1992) On both the maps the biggest ... structure ofthe dialect divisions It is an important step towards more general investigation ofthe role ofthe regular sound changes in the language dialect variation The main drawback ofthe method...
... comparison ofthe output ofa summarisation method with a gold standard which is specified by the user The quality ofthe summary is computed in terms of precision and recall The drawback of such ... the help ofthe tool in a random order After a period of at least months has lapsed so that any effect of familiarity is extinguished, subjects will be asked to produce the same summaries again ... who can transform the extract into an abstract As not all sentences identified automatically are worth including in a summary, the user has the option to override the program's decisions and...
... human or a machine, expects all translations to be accurate We evaluated 2000 randomly selected Japanese entries from the initial translation candidates, scoring all Hungarian translations as correct ... dictionary Our method maintains the recall value ofthe initial translation candidates, owing to the bidirectional selection method with local thresholds However, the recall value ofa manually created ... translation in the intermediate (i) language We consider each such source-target pair a translation candidate Next we eliminate erroneous candidates We examine the translation candidates one by...
... fine sandy loam Madawaska fine sandy loam Madawaska fine sandy loam Made land Mapleton shaly silt loam Mapleton shaly silt loam Mapleton shaly silt loam Mixed alluvial land Monarda and Burnham silt ... Howland gravelly loam Howland gravelly loam Howland gravelly loam Howland very stony loam Howland very stony loam Machias gravelly loam Machias gravelly loam Machias gravelly loam Madawaska fine ... the town of Grande Isle to the town of Hamlin The two areas were delineated as the research site because they are areas that contain all four ofthe data sources The surface area is approximately...
... principle ofthe two-step evaluation, common in the machine translation domain and already used for paraphrase evaluation (Bannard and Callison-Burch, 2005) The question asked to the human evaluator ... propose a variation ofthe UCT algorithm for paraphrase generation named MCPG for MonteCarlo based Paraphrase Generation The main part ofthe algorithm is the sampling step An episode of this ... impose the constraint that any transformed part ofthe source sentence cannot be transformed anymore This paradigm is more approriate for paraphrase generation than the standard SMT approach in...
... Annals of Mathematics, 168 (2008), 1025–1054 A quantitative version ofthe idempotent theorem in harmonic analysis By Ben Green* and Tom Sanders Abstract Suppose that G is a locally compact abelian ... refinement of) Ruzsa’s analogue of Freiman’s theorem, which gives a fairly strong characterisation of subsets A ⊆ Fn satisfying a small doubling condition |A + A| K |A| An analogue of this theorem for any ... suppose that there are at least δ |A| 3 additive quadruples (a1 , a2 , a3 , a4 ) in A4 with a1 + a2 = a3 + a4 Then there is a regular Bourgain system S satisfying dim(S) Cδ −C ; |S| e−Cδ −C |A| and...
... capability to display text andthe ability to enter text in other languages than the default one It also provides a means of entering text in a variety oflanguagesand scripts, using virtual ... An online demo of ANNIE is available at http://gate.ac.uk /a, nnie/index.jsp A set of movies demonstrating document and corpus loading, processing and storing, manual annotation of documents and ... has been adapted to IE in Bulgarian, Romanian, Bengali, Greek, Spanish, Swedish, German, Italian, and French, and we are currently porting it to Arabic, Chinese and Russian, as part ofthe MUSE...
... Primary factor of interest: age of study participants 2.5 Statistical analysis We selected all papers that reported data on groups of subjects with a mean age of 65 and over From these papers, ... contrast, GMT was given in the original papers as a mean estimate for each sub-study and confidence intervals were rarely available Therefore, we could not calculate a summary estimate for GMTs that ... with a mean age above or below 75, as a best proxy for age In univariate and multivariate analysis, there was a significantly lower response in those over 75 years of age, suggesting that Ab response...
... Obtain an inventory of presently available Active Media (e.g., servers and desktops in use) and Passive Media (e.g., backups such as tapes and DVDs) Create additional backups of Active Media as ... national law firm IT managers and savvy litigators, seeking to gain an edge in electronic discovery Born in India, Mr Shingala was a National Merit Scholar anda graduate ofthe prestigious National ... Documentary Tools during a particular period See the Appendix for an example ofa path name/file name report that illustrates how path names and file names alone may arguably reveal potentially...
... presence of ATP Each BiP application was followed by application of running buffer The analysis was carried out employing the BIA evaluation software version 2.2.4 (BIACORE) Steady-state ATPase assay ... 11432–11443 Eki T, Naitou M, Hagiwara H, Ozawa M, Sasanuma SI, Sasanuma M, Tsuchiya Y, Shibata T, Hanaoka F & Murakami Y (1996) Analysis ofa 36.2 kb DNA sequence including the right telomere of chromosome ... mammalian microsomes Thus, lack of interchangeability between BiP and Kar2p at the level ofthe Hsp40s ERj1 and ERj2 and at the level ofthe nucleotide exchange factor Grp170 does not appear to...
... SRP-dependent manner and cotranslationally, yeast prepro -a- factor (Fig 2D, bars and vs and 2), anda precursor that is transported predominantly in an SRPdependent manner and cotranslationally when ... that in these mammalian microsomes the concentration of SR, rather than the concentrations ofthe translocase subunits Sec62p and Sec63p, may be the decisive factor for the ratio betweenthe two ... of all samples (including the luciferase translation reaction) were subjected to SDS/PAGE (19.4% acrylamide + urea) and phosphorimager analysis The quantification of ppl86mer was carried out as...
... current speaker andthe gender ofthe other speaker These categories are symbolized with two letters: the first characterizing the gender ofthe current speaker andthe second the gender ofthe other ... question is whether the high classification accuracies can be attributed to a small number of features or are rather the cumulative effect ofa high number of them In Table we apply the two feature selection ... each other At the beginning of each conversation a topic is suggested at random from a list of 40 The latest release ofthe Fisher collection has more than 16 000 telephone conversations averaging...
... comparisons of quantitative variables was in most cases straightforward, and always at least plausible The analysis ofthe linguistic tests and their combinations has also led to a computational method ... automatically extracts the relevant data for these tests from text corpora and corpora-based databases, and use this system to measure the applicability and accuracy of each method We apply statistical tests ... We have presented a quantitative analysis ofthe performance of measurable linguistic tests for the selection ofthe semantically unmarked term out ofa pair of antonymous adjectives The analysis...
... with advanced melanoma (Adelaide) From the serial CRP data-points a 'standard CRP curve' was mathematically derived patients The periodicity of days for this cycle appears reasonably stable and ... colorectal adenoma and cancer patients Clin Chem Lab Med 2008, 46(10):1423-8 Sawamura M, Yamaguchi S, Murakami H, Kitahara T, Itoh K, Maehara T, Kawada E, Matsushima T, Tamura J, Naruse T: Cyclic haemopoiesis ... have examined L-CRP in the serum of patients with advanced melanoma and ovarian cancer, measured serially 1-2 days apart, and identified an apparent 'cycle' in the CRP levels Serial L-CRP measurements...
... gcgcggatccttaacttgtatataaata cgcgctcgagctacttttcatataaata SEE M21319 ggtagccatatgagcgaagaaataaatgaa gcgcggatcctcaagttgtgtataaata SEG AF064773 tgtgcatatgcaacccgatcctaaatta gcgcggatcctcagtgagtattaaga SEI AF285760 ... tgctctcgaggatattggtgtaggtaac cgcgctcgagttagttactatctacata SElM AF285760 cgcacatatggatgtcggagttttgaat gcgcggatcctcaactttcgtccttata SElN AF285760 aatgctcatatggacaaaaaagatttaaag gcgcggatccttaatctttatataaaa ... gcgcggatccttaatctttatataaaa SElO AF285760 tgcactcgagaatgaagaagatcctaaa cgcgctcgagttatgtaaataaataaac Seo et al Journal of Translational Medicine 2010, 8:2 http://www.translational-medicine.com/content/8/1/2 Basal...
... management support AL and MN completed the analysis ofthe SAHA data MM assisted with the data analysis and participated in drafting and editing ofthe manuscript SL completed the analysis of ... analysis ofthe protocol selection study, participated in the analysis ofthe SAHA data and participated in the drafting and editing ofthe manuscript All authors read and approved the final manuscript ... expression of thousands of genes [9,12,13] Another challenge is that the specificity and sensitivity ofa given RNA profiling platform are affected by the abundance and variability ofthe globin transcripts,...
... dramatically Adequate preparation in primary and secondary education becomes even more crucial in the preparation ofa good supply of eligible and qualified applicants We also assume the MOH has ... to the labour market also have the potential to alter the government's ability to hire and retain graduates Moreover, we caution that these estimates of workforce need are made at the national ... of Zambia called for an increase in current training enrolment by over 90% across all cadres In May and June of 2008, the Government of Zambia andthe Clinton Foundation assessed all 39 of Zambia's...