a biomarker for human aging
Báo cáo khoa học: Effects of the G376E and G157D mutations on the stability of yeast enolase – a model for human muscle enolase deficiency pdf
... QuickChange method (Stratagene, La Jolla, CA, USA) The primer sequences were as follows: 5¢-GG GGT GTT ATG GTT TCC CAT CGA TCT GAA GAA ACT GAA GAC (G376E) and 5¢-CCA TTC TTG AAC GTT TTA AAC GGT GAT ... was increased by approximately 103 for the G376E variant: at mgÆmL)1 and 15 °C, the protein was partially dissociated The Kd value for the G157D variant was also increased, but by a smaller amount, ... samples, A Padovani for making the W56F variant and J A Kornblatt for encouragement and advice Financial support was provided by the Natural Sciences and Engineering Research Council of Canada 12 13...
- 10
- 520
- 0
Báo cáo y học: "Down-regulation of kallikrein-related peptidase 5 (KLK5) expression in breast cancer patients: a biomarker for the differential diagnosis of breast lesions" doc
... 5’-CCGGTGACAAAGCAGGTAGAG-3’ and reverse 5’-GTGAACTTGCAGAGGTTCGTGTA-3’ pair of primers, whereas the use of the HPRT1 forward 5’TGGAAAGGGTGTTTATTCCTCAT-3’ and reverse 5’-ATGTAATCCAGCAGGTCAGCAA-3’ primers ... expression in breast cancer patients: a biomarker for the differential diagnosis of breast lesions Margaritis Avgeris1, Georgia Papachristopoulou1,2, Athanasios Polychronis2 and Andreas Scorilas1* * Correspondence: ... and the HPRT1 reference gene sequences were amplified in separate duplicate reactions for each sample and the average CT value was calculated Relative quantification analysis, using the comparative...
- 12
- 340
- 0
Báo cáo y học: "UniPep - a database for human" ppsx
... The accurate mass and time tag approach is such an approach [47] that substantially benefits from a mapped out proteomic space Because this and other similar strategies transform proteomic analyses ... Initiative), which are open file formats for the representation of MS data Other data formats will be translated into these formats and are therefore also acceptable In step 2, sequence assignment, ... The potential N-linked glycosites were parsed and loaded into a relational database and the data are easily searchable using SQL (structured query language) User access to the database Genome...
- 12
- 302
- 0
Tài liệu Báo cáo khoa học: Evidence for noncooperative metal binding to the a domain of human metallothionein ppt
... (Aldrich, Oakville, ON, Canada); isopropyl-b-d-thiogalactoside (Sigma-Aldrich, Oakville, ON, Canada); ammonium hydroxide (BDH Chemicals ⁄ VWR, Mississauga, ON, Canada); formic acid (J T Baker Chemical ... columns (Amersham Biosciences ⁄ GE Healthcare, Piscataway, NJ, USA), superfine G-25 Sephadex (Pharmacia ⁄ Pfizer, Oakville, ON, Canada) and a stirred ultrafiltration cell (Amicon Bioseparations ⁄ ... corresponding fraction of the metal-saturated Cd 4a species if the metallation mechanism proceeds by a positively cooperative pathway Alternatively, the partially filled Cd 1a, Cd 2a and Cd 3a intermediate species...
- 9
- 533
- 0
Báo cáo khoa học: Hematopoietic differentiation from human ESCs as a model for developmental studies and future clinical translations Invited review following the FEBS Anniversary Prize received on 5 July 2009 at the 34th FEBS Congress in Prague docx
... Nature 460, 909–913 89 Hong H, Takahashi K, Ichisaka T, Aoi T, Kanagawa O, Nakagawa M, Okita K & Yamanaka S (2009) Suppression of induced pluripotent stem cell generation by the p53–p21 pathway ... Cuthbert A, Yang C, Miller DM, DiIorio P, Laning J, Burzenski L, Gott B, Foreman O, Kavirayani A et al (2010) Parameters for establishing humanized mouse models to study human immunity: analysis of human ... from Leukemia and Lymphoma UK, Fanconi New advances in human hematopoiesis from human ESCs Hope UK and the Fanconi Anemia Research Fund USA, and funds for research in the field of regenerative medicine...
- 12
- 550
- 0
Ruta 6 selectively induces cell death in brain cancer cells but proliferation in normal peripheral blood lymphocytes: A novel treatment for human brain cancer doc
... culture PATHAK et al: RUTA 6: A NOVEL TREATMENT FOR HUMAN BRAIN CANCER 978 Figure Histograms showing percentages of mitotic index (MI) and normal and abnormal metaphases of human brain cancer and ... therapy to treat 15 patients diagnosed with advanced intracranial malignant brain cancer at the PBH Research Foundation, Kolkata, India The other two authors (S.P and A. S.M.) have performed in vitro ... Multani AS, Ozen M, Narayan S, Kumar V, Chandra J, McConkey DJ, Newman RA and Pathak S: Caspase-dependent apoptosis induced by telomere cleavage and TRF2 loss Neoplasia 2: 339-345, 2000 12 Pathak...
- 8
- 670
- 0
HMDB: A Large Video Database for Human Motion Recognition pdf
... to-date the largest and perhaps most realistic available dataset Each clip was validated by at least two human observers to ensure consistency Additional meta information allows for a precise selection ... spatiotemporal maximum average correlation height filter for action recognition CVPR, 2008 [17] B Russell, A Torralba, K Murphy, and W Freeman Labelme: a database and web-based tool for image annotation ... algorithms with accuracy about 23%, this dataset is arguably a good place to start (performance on the CalTech-101 database for object recognition started around 16% [6]) Furthermore our exhaustive...
- 8
- 469
- 0
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx
... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGCTGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGCTCGTGTTGACGCAGCCGCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCCAGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGATGTTGTGATGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC...
- 11
- 679
- 0
BUSINESS LEADERS INITIATIVE ON HUMAN RIGHTS: A Guide for Integrating Human Rights into Business Management docx
... areas A great advantage offered by a rights-aware approach is that the categories (shown across the column headings of the Matrix) are universal and therefore global in application, as are many ... responsibility targets that are contained in the company’s “balanced scorecard.” Staff appraisals and management bonuses are dependent on performance toward these targets Facilitators, who are a group ... For business, human rights provide a universal benchmark for minimum standards of behavior Many national laws and regulations have evolved as a result of a State’s obligation to implement human...
- 45
- 264
- 0
Helping Older Adults Search for Health Information Online A Toolkit for Trainers from the National Institute on Aging potx
... students, asking them to compare the usefulness of the site map to the search box on the NIA home page What are the advantages and disadvantages of each? Make a list on the board or flip chart as points ... Older Adults Search for Health Information Online: A Toolkit for Trainers from the National Institute on Aging reinforcement activity Summarizing (5 Minutes) “Now let’s take a look at the Goals ... Search for Health Information Online: A Toolkit for Trainers from the National Institute on Aging Using a Search Box PRACTICE activity (20 Minutes) “Let’s look at Goal – learning to use the Search...
- 42
- 344
- 0
báo cáo hóa học:" A highly invasive human glioblastoma pre-clinical model for testing therapeutics" pot
... Acknowledgements We are grateful to Drs David Wenkert and Yuehai Shen for 17AAG characterization and to Drs Jacob Zhang and Kyle Furge for statistical analysis We thank Michelle Bassett for assistance in ... test was used for comparison of 17AAG treatments against DBM2 pulmonary metastases Results GBM tumor cells have metastatic potential Primary and metastatic brain tumors are often aggressive and ... recorded Statistical analysis Statistical analysis of 17AAG-treated DBM2 intracranial tumor growth was performed with a student's "t" test Log-rank test was used to analyze survival time Chisquare test...
- 13
- 413
- 0
Báo cáo hóa học: " Development and application of a biomarker assay for determining the pharmacodynamic activity of an antagonist candidate biotherapeutic antibody to IL21R in whole blood" pptx
... that will be required upon hand-off for assay validation SJ, AW, SWA and KA performed the in vitro assays on monkeys treated with Ab-01 and control Ig and analyzed the data, and KA and SA performed ... this basic approach (ex vivo stimulation of whole blood) to develop pharmacodynamic biomarker assays for a candidate therapeutic antibody, Ab-01 Ab-01, a human antibody generated by phage display, ... the American Association for Accreditation of Laboratory Animal Care guidelines The Wyeth Institutional Animal Arai et al Journal of Translational Medicine 2010, 8:51 http://www.translational-medicine.com/content/8/1/51...
- 13
- 528
- 0
Báo cáo hóa học: " Research Article A Framework for Automatic Time-Domain Characteristic Parameters Extraction of Human Pulse Signals" ppt
... approximate the baseline wander of the pulse signal, and A4 − A8 is just the pulse signal filtered The reason that A4 − A8 and A8 are chosen as the approximation of pulse signal and its baseline wander ... waveform is a TDC-Wave For TDC-Wave, the two characteristic points after P are labeled as E(K,F) and L, as shown in Figure 8(b) For PTL-Wave, the characteristic points P, E, and K are overlapping, ... (ms) (a) 300 (b) Figure 7: A period of a DOU-Wave sample and its graphical representation of chain code string (a) , and a period of a TRI-Wave sample and its graphical representation of chain code...
- 9
- 207
- 0
Báo cáo hóa học: " A Real-Time Model-Based Human Motion Tracking and Analysis for Human Computer Interface Systems" docx
... MOTION PARAMETERS ESTIMATION There are 25 motion parameters (22 angular parameters and position parameters) for describing human body motion Here, we assume that three rotation angles of head and ... A Real-Time Model-Based Human Motion Tracking and Analysis It can only track the restricted movement of walking human parallel to the image plane Another real time system, Pfinder [11], starts ... Computational Imaging and Vision, chapter 8, pp 171–198, Kluwer Academic Publishers, Boston, Mass, USA, 1997 [11] C R Wren, A Azarbayejani, T Darrell, and A Pentland, “Pfinder: real-time tracking...
- 15
- 350
- 0
Báo cáo y học: "Complement C3 serum levels in anorexia nervosa: a potential biomarker for the severity of disease" pdf
... power of our statistical analysis and make our data vulnerable to a statistical type II error Therefore, our data not allow for advocating complement serum levels as a new biomarker until definitively ... the traditional activation cascade using C3 convertases or C5 convertases [13] As a result, C 5a may be generated via thrombin-mediated coagulation abnormalities that have been documented in anorexia ... severe forms of anorexia nervosa Upon primary medical stabilization, patients are transferred to a psychiatrically based inpatient eating disorder program further treatment and follow-up Patients and...
- 6
- 441
- 0
Báo cáo y học: "A need for a ‘whole-istic functional genomics’ approach in complex human diseases: arthritis" pptx
... using a singular rather than a plural noun, implying that it might be a single process or a type of process The avascular, alymphatic and aneural human OA-affected articular cartilage harboring ... data platforms and the ability to visualize retrieved complex data in a way that aids their interpretation Integrating various incompatible bioinformatics platforms is essential Such efforts are ... skeletal development Osteoarthritis Cartilage 2001, 9(suppl A) :S150S159 Clouthier DE, Williams SC, Yanagisawa H, Wieduwilt M, Richardson JA, Yanagisawa M: Signaling pathways crucial for craniofacial...
- 4
- 322
- 0
Báo cáo y học: "The potential of human regulatory T cells generated ex vivo as a treatment for lupus and other chronic inflammatory diseases" pot
... 39 Yamamoto H, Hirayama M, Genyea C, Kaplan J: TGF-beta mediates natural suppressor activity of IL-2-activated lymphocytes J Immunol 1994, 152:3842-3847 40 Gray JD, Hirokawa M, Horwitz DA: The ... self-tolerance; deficit of a T cell subset as a possible cause of autoimmune disease J Exp Med 1985, 161:72-87 Kuniyasu Y, Takahashi T, Itoh M, Shimizu J, Toda G, Sakaguchi S: Naturally anergic and ... allogeneic organ transplants Acknowledgements This research was supported in part by National Institutes of Health grant AI 41768, The Nora Eccles Treadwell Foundation, and the Arthritis Foundation-Southern...
- 6
- 408
- 0
Báo cáo y học: "Soluble RAGE: a hot new biomarker for the hot joint" pdf
... Pullerits and colleagues adds to the growing body of human data on RAGE, sRAGE, genetic variants and inflammation These investigators placed sRAGE for the first time in synovial fluid and indicate that ... H, Yasui K, Takeuchi M, Makita Z, Takasawa S, et al.: Novel splice variants of the receptor for advanced glycation endproducts expressed in human vascular endothelial cells and pericytes, and ... Schmidt AM, Vianna M, Gerlach M, Brett J, Ryan J, Kao J, Esposito C, Hegarty H, Hurley W, Clauss M, et al.: Isolation and characterization of binding proteins for advanced glycosylation 143 Arthritis...
- 3
- 368
- 0
Báo cáo y học: " Tumour necrosis factor-α stimulates dehydroepiandrosterone metabolism in human fibroblast-like synoviocytes: a role for nuclear factor-κB and activator protein-1 in the regulation of expression of cytochrome p450 enzyme 7b" doc
... using random hexamer primers (Pharmacia, Woerden, The Netherlands) and reverse transcriptase (Pharmacia) For reverse transcription PCR, human Cyp7b sense (GTCCTGGAGAAATATTATGTGCAG) and antisense ... (CGCACACAGTAGTCCCCGG) primers were used For GAPDH we used CCCTTCATTGACCTCAACTACATGG (sense) and GGTCCACCACCCTGTTGCTGTAGCC (antisense) as primers Reverse transcription PCR was carried out using an ... system Nat Rev Immunol 2002, 2:725-734 Das J, Chen CH, Yang L, Cohn L, Ray P, Ray A: A critical role for NF-kappa B in GATA3 expression and TH2 differentiation in allergic airway inflammation Nat...
- 10
- 462
- 0
Báo cáo y học: "Differential expression, function and response to inflammatory stimuli of 11β-hydroxysteroid dehydrogenase type 1 in human fibroblasts: a mechanism for tissue-specific regulation of inflammation" pps
... Probes and primer sequences used Gene Primers and probes 11β-HSD1 Forward primer: AGGAAAGCTCATGGGAGGACTAG Reverse primer: ATGGTGAATATCATCATGAAAAAGATTC Probe: CATGCTCATTCTCAACCACATCACCAACA H6PDH Forward ... H6PDH Forward primer: CAGGTGTCCTAGTGCACATTGAC Reverse primer: GTAGCCCACTCTCTCGTCCAA Probe: AAGGCACGCCCTCCCAGCG GRα Forward primer: GCGATGGTCTCAGAAACCAAAC Reverse primer: GAGATTACAGAGGAAGTTATCCTCTGC ... Probe: TGCAGTGAAGGTTGCTGAGGCTCTGA GRβ Forward primer: AAC TGG CAG CGG TTT TAT CAA CT Reverse primer: AACTCTTGGATTCTATGCATGAAAATGTTA TGTGGTTA Probe: TGT GTG AGA TGT GCT TTC TGG TT C/EBPα Forward primer:...
- 10
- 438
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng 9 tr 25