0

a bag is useful and the word

Báo cáo khoa học:

Báo cáo khoa học: "A Bag of Useful Techniques for Efficient and Robust Parsing" ppt

Báo cáo khoa học

... items give an im- pression of the lexical and syntactic ambiguity of the respective grammars 4 The German and Japanese corpora and half of the English corpus consist of transliterations of ... grammars have between 20 and 120 unary and binary rule schemata. Since all rule schemata in our system bear a unique number, this filter can be realized as a three di- mensional boolean array. ... disjunctive normal form (DNF). Of course, the ratio of the number of rules and lexical entries in the original grammar and the DNFed grammar depends on the 'style' of the grammar...
  • 8
  • 340
  • 0
Báo cáo Y học: Incorporation of 3-nitrotyrosine into the C-terminus of a-tubulin is reversible and not detrimental to dividing cells potx

Báo cáo Y học: Incorporation of 3-nitrotyrosine into the C-terminus of a-tubulin is reversible and not detrimental to dividing cells potx

Báo cáo khoa học

... dysfunction.ACKNOWLEDGEMENTSWe thank Drs Carlos E. Argaran˜ a and Mario Guido for criticalreading of the manuscript, Mrs S. N. Deza and Mrs M. G. Schachnerfor technical assistance and Dr Stephen Anderson ... days. The antisera were usually collected 15 days aftereach injection and tested for affinity and specificity and stored at )20 °C. Mouse monoclonal antibodies againstTyr-tubulin (Tub 1A2 ) and total ... Secretarı´adeCienciayTe´cnicadelaUniver-sidad Nacional de Co´rdoba y Agencia Co´rdoba Ciencia del Gobiernode la Provincia de Co´rdoba, Argentina.REFERENCES1. Barra, H.S., Arce, C .A. ,...
  • 9
  • 518
  • 0
Đề tài

Đề tài " A Mass Transference Principle and the Duffin-Schaeffer conjecture for Hausdorff measures " pdf

Thạc sĩ - Cao học

... BERESNEVICH AND SANJU VELANI5.5. The measure of an arbitrary ball. Set ro:= min{r(B):B ∈ K(2)}.Take an arbitrary ball A in Rkwith r (A) <ro. The aim of this section is toestablish (13) for A; ... Lemma 5, it is clear that (P2) and (P3) are fulfilled for i = 1. By (14) and the fact that the balls in KfG,Bare disjoint, we also have that (P1) is satisfiedwithin this first sub-level. Clearly, ... Hk(B). This can be established by first noting that the ratio of the radii of the balls Bki and Bfiare uniformly bounded betweenpositive constants and then adapting the proof of Lemma 6 in the...
  • 23
  • 304
  • 0
Báo cáo khoa học: IMP1 interacts with poly(A)-binding protein (PABP) and the autoregulatory translational control element of PABP-mRNA through the KH III-IV domain pdf

Báo cáo khoa học: IMP1 interacts with poly(A)-binding protein (PABP) and the autoregulatory translational control element of PABP-mRNA through the KH III-IV domain pdf

Báo cáo khoa học

... EcoRI-T7-ccccaaaaaaatttacaaaaaatc-BamHI A ăARS-S EcoRI-T7-ccccaaaaaaattt-BamHIPoly (A) 50EcoRI-T7-aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa-BamHIBinding of IMP1 to PABP and PABP-mRNA G. P. Patel and J. Bag 5686 ... EcoRI-T7-tccaaaaaaaatctaaaaaaatcttttaaaaaaccccaaaaaaattt-BamHI A ăARS-L EcoRI-T7-aaaaaatccaaaaaaaatct-BamHI A ăARS-C EcoRI-T7-tctaaaaaaatcttttaaaaaacccc-BamHI A ăARS-R EcoRI-T7-ccccaaaaaaatttacaaaaaatc-BamHI A ăARS-S ... wereTable 1. Primers used to create various ARS constructs.Primer Sense sequenceARS EcoRI-T7-aaaaaatccaaaaaaaatctaaaaaaatcttttaaaaaaccccaaaaaaatttacaaaaaa-BamHI A ăARS-4 EcoRI-T7-tccaaaaaaaatctaaaaaaatcttttaaaaaaccccaaaaaaattt-BamHI A ăARS-L...
  • 13
  • 466
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "A Theory of Parallelism and the Case of VP Ellipsis" pot

Báo cáo khoa học

... parallelism between clauses 1 and 2, and cases *c and *d from the parallelism between clauses 1 and 3. However, because parallelism is also required be- tween clauses 2 and 3, we cannot choose these ... in a natural and straightforward fash- ion. Furthermore, the generality of the approach makes it directly applicable to a variety of other types of ellipsis and reference in natural language. ... Phenomenon Example 'Do It' Anaphora 'Do So' Anaphora Stripping Comparative Deletion 'Same As' Reference 'Me Too' Phenomena 'one' Anaphora Lazy...
  • 8
  • 361
  • 0
Báo cáo khoa học: Monitoring the prevention of amyloid fibril formation by a-crystallin Temperature dependence and the nature of the aggregating species pdf

Báo cáo khoa học: Monitoring the prevention of amyloid fibril formation by a-crystallin Temperature dependence and the nature of the aggregating species pdf

Báo cáo khoa học

... a- crystallinTemperature dependence and the nature of the aggregating speciesAgata Rekas1,2, Lucy Jankova3, David C. Thorn4, Roberto Cappai5,6 and John A. Carver41 Department of Chemistry, ... Australia2 Institute for Environmental Research, Australian Nuclear Science and Technology Organization, Menai, Australia3 ATA Scientific Pty Ltd ANSTO Woods Centre, Lucas Heights, Australia4 ... a- synucleinaggregation by aB-crystallinDPI was used to monitor real-time a- synuclein aggrega-tion and the effect of aB-crystallin on this, particularlyat the very early stages of this process. In a...
  • 16
  • 577
  • 0
Báo cáo khoa học: A possible physiological function and the tertiary structure of a 4-kDa peptide in legumes potx

Báo cáo khoa học: A possible physiological function and the tertiary structure of a 4-kDa peptide in legumes potx

Báo cáo khoa học

... des-pentapeptide analogue and comparison with crystal structure.Biochemistry 29, 10545–10555.21. Nagata, K., Hatanaka, H., Kohda, D., Kataoka, H., Nagasawa,H.,Isogai ,A. ,Ishizaki,H.,Suzuki ,A. &Inagaki,F.(1995)Three-dimensional ... legumesToshimasa Yamazaki1, Motoko Takaoka2,3, Etsuko Katoh1, Kazuki Hanada2, Masashi Sakita2,Kyoko Sakata2, Yuji Nishiuchi4 and Hisashi Hirano21National Institute of Agrobiological Sciences, ... DNAs astemplates and the synthetic primers legF1 (5Â-AGCAGCAGATTGTAATGGTG-3Â)andlegR1(5Â-CAGCACTTCAGAATCAGAGTC-3Â). PCR products werecloned on pT7Blue T-vector (Novagen, Darmstadt) and their...
  • 8
  • 386
  • 0
Tài liệu Báo cáo Y học: Thermostability of manganese- and iron-superoxide dismutases from Escherichia coli is determined by the characteristic position of a glutamine residue pdf

Tài liệu Báo cáo Y học: Thermostability of manganese- and iron-superoxide dismutases from Escherichia coli is determined by the characteristic position of a glutamine residue pdf

Báo cáo khoa học

... mutants) and per-manganese metal basis (manganesesuperoxide dismutase mutants).Table 2. Metal contents of mutant superoxide dismutases. Metal con-tent was measured by atomic absorbance and is ... residues.Further analysis of these and other mutant SODs is currently underway.ACKNOWLEDGEMENTSWe are indebted to G. Peplow, F. Yamakura and T. Matsumoto for the analyses of iron and manganese in ... programCE [35] while mutational analyses were carried out using the CARA and ENCAD algorithms included in the GENEMINEprogram.Bacterial strains and vectors The mutagenesis and expression phagemid,...
  • 12
  • 740
  • 0
Báo cáo khoa học: The SWI⁄SNF protein BAF60b is ubiquitinated through a signalling process involving Rac GTPase and the RING finger protein Unkempt doc

Báo cáo khoa học: The SWI⁄SNF protein BAF60b is ubiquitinated through a signalling process involving Rac GTPase and the RING finger protein Unkempt doc

Báo cáo khoa học

... shown).However, taken together, these data support the ideathat Rac and Unkempt can translocate in the nuclearcompartment and activate BAF60b ubiquitination;how these processes are co-ordinated remains ... complexes are largemultisubunit assemblies containing either Brm or Brg1as the catalytic ATPase subunit and a variable subsetof approximately 10 Brg ⁄ Brm-associated factors(BAF). Among the later, ... 5ÂTCTTCGAGTGCAAGTCCAAA and 5ÂAAGATCACCTGTGCCTCCAC, and normalized against endogenous glutamic acid decar-boxylase mRNA levels, detected by RT-PCR with specicprimers 5ÂGTCAGCCGCATCTTCTTTTG and 5ÂGCAGAGATGATGACCCTTT.Cell...
  • 12
  • 432
  • 0
Báo cáo khoa học: A characteristic Glu17 residue of pig carnitine palmitoyltransferase 1 is responsible for the low Km for carnitine and the low sensitivity to malonyl-CoA inhibition of the enzyme docx

Báo cáo khoa học: A characteristic Glu17 residue of pig carnitine palmitoyltransferase 1 is responsible for the low Km for carnitine and the low sensitivity to malonyl-CoA inhibition of the enzyme docx

Báo cáo khoa học

... used the construct pGEMT5ÂHumanCPT1B as a template in a PCR reaction with primers DH673 (5Â-AGCTGAATTCATGGCGGAAGCTCACCAG-3Â) and DH803 (5Â-TCCACCCATGGTAGCAGAGAAGCAGCTTAAGGGTTTGGCGGA-3Â). The ... human D17E, and analyzed the affinity for the substrate carnitine and malonyl-CoA sensitivity. These mutants wereactive (Table 2) and expressed in P. pastoris at the same level as wild-type human ... Site-Directed Mutagenesis Kit (Strata-gene). The primers used were DH801 (5Â-TTCTTCCGCCAAACCCTTAAGCTGCTGCTTTCCTAC-3Â) and DH802(5Â-GTAGGAAAGCAGCAGCTTAAGGGTTTGGCGGAAGAA-3Â). Using this procedure,...
  • 9
  • 550
  • 0
Báo cáo Y học: Nuclear proteins that bind to metal response element a (MREa) in the Wilson disease gene promoter are Ku autoantigens and the Ku-80 subunit is necessary for basal transcription of the WD gene ppt

Báo cáo Y học: Nuclear proteins that bind to metal response element a (MREa) in the Wilson disease gene promoter are Ku autoantigens and the Ku-80 subunit is necessary for basal transcription of the WD gene ppt

Báo cáo khoa học

... and characterized the MREa-binding activity, which consistedof two polypeptides of approximately 70 and 82 kDa.N-terminal and internal amino acid sequencing and immunoanalyses revealed that ... alsoobserved another band of 82 kDa when the MREa-proteinband from the EMSA was excised from the native gel and resolved by SDS/PAGE (unpublished data). We purified the MREa-binding proteins using the avidin–biotin ... (base pairs) Annealingtemperature(C)Target CompetitorWilson gene 5Â-TGTTAAGTTTGACCCGGAAATTATC 911 713 555Â-CCGGTCAGCCAGCTGCTG a- actin 5Â-TGATGGTGGGCATGGGTCAG 791 555Â-TACATGGTGGTGCCGCCAGAFig....
  • 11
  • 628
  • 0

Xem thêm

Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008