... items give an im- pression of the lexical and syntactic ambiguity of the respective grammars 4 The German and Japanese corpora and half of the English corpus consist of transliterations of ... grammars have between 20 and 120 unary and binary rule schemata. Since all rule schemata in our system bear a unique number, this filter can be realized as a three di- mensional boolean array. ... disjunctive normal form (DNF). Of course, the ratio of the number of rules and lexical entries in the original grammar andthe DNFed grammar depends on the 'style' of the grammar...
... dysfunction.ACKNOWLEDGEMENTSWe thank Drs Carlos E. Argaran˜ a and Mario Guido for criticalreading of the manuscript, Mrs S. N. Deza and Mrs M. G. Schachnerfor technical assistance and Dr Stephen Anderson ... days. The antisera were usually collected 15 days aftereach injection and tested for affinity and specificity and stored at )20 °C. Mouse monoclonal antibodies againstTyr-tubulin (Tub 1A2 ) and total ... Secretarı´adeCienciayTe´cnicadelaUniver-sidad Nacional de Co´rdoba y Agencia Co´rdoba Ciencia del Gobiernode la Provincia de Co´rdoba, Argentina.REFERENCES1. Barra, H.S., Arce, C .A. ,...
... BERESNEVICH AND SANJU VELANI5.5. The measure of an arbitrary ball. Set ro:= min{r(B):B ∈ K(2)}.Take an arbitrary ball A in Rkwith r (A) <ro. The aim of this section is toestablish (13) for A; ... Lemma 5, it is clear that (P2) and (P3) are fulfilled for i = 1. By (14) and the fact that the balls in KfG,Bare disjoint, we also have that (P1) is satisfiedwithin this first sub-level. Clearly, ... Hk(B). This can be established by first noting that the ratio of the radii of the balls Bki and Bfiare uniformly bounded betweenpositive constants and then adapting the proof of Lemma 6 in the...
... EcoRI-T7-ccccaaaaaaatttacaaaaaatc-BamHI A ăARS-S EcoRI-T7-ccccaaaaaaattt-BamHIPoly (A) 50EcoRI-T7-aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa-BamHIBinding of IMP1 to PABP and PABP-mRNA G. P. Patel and J. Bag 5686 ... EcoRI-T7-tccaaaaaaaatctaaaaaaatcttttaaaaaaccccaaaaaaattt-BamHI A ăARS-L EcoRI-T7-aaaaaatccaaaaaaaatct-BamHI A ăARS-C EcoRI-T7-tctaaaaaaatcttttaaaaaacccc-BamHI A ăARS-R EcoRI-T7-ccccaaaaaaatttacaaaaaatc-BamHI A ăARS-S ... wereTable 1. Primers used to create various ARS constructs.Primer Sense sequenceARS EcoRI-T7-aaaaaatccaaaaaaaatctaaaaaaatcttttaaaaaaccccaaaaaaatttacaaaaaa-BamHI A ăARS-4 EcoRI-T7-tccaaaaaaaatctaaaaaaatcttttaaaaaaccccaaaaaaattt-BamHI A ăARS-L...
... parallelism between clauses 1 and 2, and cases *c and *d from the parallelism between clauses 1 and 3. However, because parallelism is also required be- tween clauses 2 and 3, we cannot choose these ... in a natural and straightforward fash- ion. Furthermore, the generality of the approach makes it directly applicable to a variety of other types of ellipsis and reference in natural language. ... Phenomenon Example 'Do It' Anaphora 'Do So' Anaphora Stripping Comparative Deletion 'Same As' Reference 'Me Too' Phenomena 'one' Anaphora Lazy...
... a- crystallinTemperature dependence andthe nature of the aggregating speciesAgata Rekas1,2, Lucy Jankova3, David C. Thorn4, Roberto Cappai5,6 and John A. Carver41 Department of Chemistry, ... Australia2 Institute for Environmental Research, Australian Nuclear Science and Technology Organization, Menai, Australia3 ATA Scientific Pty Ltd ANSTO Woods Centre, Lucas Heights, Australia4 ... a- synucleinaggregation by aB-crystallinDPI was used to monitor real-time a- synuclein aggrega-tion andthe effect of aB-crystallin on this, particularlyat the very early stages of this process. In a...
... mutants) and per-manganese metal basis (manganesesuperoxide dismutase mutants).Table 2. Metal contents of mutant superoxide dismutases. Metal con-tent was measured by atomic absorbance andis ... residues.Further analysis of these and other mutant SODs is currently underway.ACKNOWLEDGEMENTSWe are indebted to G. Peplow, F. Yamakura and T. Matsumoto for the analyses of iron and manganese in ... programCE [35] while mutational analyses were carried out using the CARA and ENCAD algorithms included in the GENEMINEprogram.Bacterial strains and vectors The mutagenesis and expression phagemid,...
... shown).However, taken together, these data support the ideathat Rac and Unkempt can translocate in the nuclearcompartment and activate BAF60b ubiquitination;how these processes are co-ordinated remains ... complexes are largemultisubunit assemblies containing either Brm or Brg1as the catalytic ATPase subunit anda variable subsetof approximately 10 Brg ⁄ Brm-associated factors(BAF). Among the later, ... 5ÂTCTTCGAGTGCAAGTCCAAA and 5ÂAAGATCACCTGTGCCTCCAC, and normalized against endogenous glutamic acid decar-boxylase mRNA levels, detected by RT-PCR with specicprimers 5ÂGTCAGCCGCATCTTCTTTTG and 5ÂGCAGAGATGATGACCCTTT.Cell...
... used the construct pGEMT5ÂHumanCPT1B as a template in a PCR reaction with primers DH673 (5Â-AGCTGAATTCATGGCGGAAGCTCACCAG-3Â) and DH803 (5Â-TCCACCCATGGTAGCAGAGAAGCAGCTTAAGGGTTTGGCGGA-3Â). The ... human D17E, and analyzed the affinity for the substrate carnitine and malonyl-CoA sensitivity. These mutants wereactive (Table 2) and expressed in P. pastoris at the same level as wild-type human ... Site-Directed Mutagenesis Kit (Strata-gene). The primers used were DH801 (5Â-TTCTTCCGCCAAACCCTTAAGCTGCTGCTTTCCTAC-3Â) and DH802(5Â-GTAGGAAAGCAGCAGCTTAAGGGTTTGGCGGAAGAA-3Â). Using this procedure,...
... and characterized the MREa-binding activity, which consistedof two polypeptides of approximately 70 and 82 kDa.N-terminal and internal amino acid sequencing and immunoanalyses revealed that ... alsoobserved another band of 82 kDa when the MREa-proteinband from the EMSA was excised from the native gel and resolved by SDS/PAGE (unpublished data). We purified the MREa-binding proteins using the avidin–biotin ... (base pairs) Annealingtemperature(C)Target CompetitorWilson gene 5Â-TGTTAAGTTTGACCCGGAAATTATC 911 713 555Â-CCGGTCAGCCAGCTGCTG a- actin 5Â-TGATGGTGGGCATGGGTCAG 791 555Â-TACATGGTGGTGCCGCCAGAFig....