... the Lao PDR; Lao Securities Exchange; Lao Statistics Bureau Malaysia Bursa Malaysia; SME Corporation; Bank Negara Malaysia Mongolia Bank of Mongolia; Credit Guarantee Fund of Mongolia; Financial ... Corporation; Bangladesh Bureau of Statistics; Palli Karma Sahayak Foundation; Bangladesh Ventures Cambodia Cambodia Securities Exchange; National Institute of Statistics; National Bank of Cambodia ... China and the Republic of Korea in East Asia; (iii) Bangladesh, India, and Sri Lanka in South Asia; (iv) Cambodia, Indonesia, Malaysia, the Philippines, Thailand, and Viet Nam in Southeast Asia;...
... the value of shares and the income from them can go down as well as up and you may get back less than the amount invested Details about Aberdeen Latin American Income Fund are available at the ... subscription-based data and forecasting services The company also undertakes bespoke research and analysis projects on individual markets and business sectors More information is available at www.eiu.com ... business research, forecasting and analysis It provides accurate and impartial intelligence for companies, government agencies, financial institutions and academic organisations around the globe, inspiring...
... time-varying parameters can lead to gains in forecasting In particular, models that incorporate a gradual change in parameters and also include a large set of explanatory variables particularly ... methodology Data Our main data set consists of quarterly annualised real GDP growth, quarterly annualised inflation and the three-month Treasury bill rate Quarterly data on these variables is available ... TVP-VAR (General) TVP-VAR (Standard) TVP-VAR (Homoscedastic) TVP-FAVAR TVP-FAVAR (Homoscedastic) FAVAR UC TVAR (GDP) TVAR (Inflation) TVAR (Rate) ST-VAR (GDP) ST-VAR (Inflation) ST-VAR (Rate) VAR...
... and based on the proposition that density measured as stand basal area a ects both basal area growth and dominant height growth, we used the following equations to describe height and basal area ... well as for different strata and initial values of the model subject The summary statistics include average bias (AB), average absolute bias (AAB), root mean squared error (RMSE), R2 -statistics and ... for all models Average absolute bias (AAB) was 0.14 m for the height growth model, 0.18 m2 ha−1 for the basal area DISCUSSION 4.1 Parameter estimates The signs of the parameter estimates generally...
... and t0 represent the predictor stand basal area (m2 ha−1 ) and age (years), and G is the predicted stand basal area at age t The Korf base equation was also used to develop a stand basal area ... inventories available 2.6 Transition function for stand basal area growth The GADA was used to develop a function for projecting stand basal area This requires having an initial value for stand basal area ... a major problem because the initialization function would only be used to provide an initial value of stand basal area when no inventory data are available [4] A growthmodel for Pinus radiata...
... minimal and maximal daily air temperatures, mean daily soil temperature at 20 cm depth, daily global radiation, daily hours of sunshine and daily air VPD Hourly values of air temperature and radiation ... observations as far as possible However, data were not analysed statistically for several reasons One was that the model uses probability calculations in several cases Therefore, a statistical analysis ... to growth at t – and consequently according to C availability at t – (i.e if C availability allows growth to be high at t – 1, the demand at t may be greater than at t–1 and vice versa) The growth...
... Foliar weight and area related to current sapwood area in oak For Sci 25, Granier A, Anfodillo T, Sabatti M et al (1994) Axial and radial water flow in the trunk of oak trees: a quantitative and ... surface area) and measurements of tree growth (annual basal area and bole volume increments) A strong allometric relation exists between the measured tree basal area and calculated crown surface ... tertiary branches attached to the secondary branches From these data, we calculated the Cartesian coordinates (x,y,z) of the origin and tip of each growth unit A stem analysis gave basal area (at...
... CAGTGATGAGGACTTGGACTCATTCATGGTGC; β-actin, TGTGATGGTGGGAATGGGTCAG and TTTGATGTCACGCACGATTTCC Statistical analysis Group mean values were compared using the two-tailed Student's t-test A p value of ... graft-versus-host disease in mice J Immunol 2000, 164:6067-6074 Kuroiwa T, Kakishita E, Hamano T, Kataoka Y, Seto Y, Iwata N, Kaneda Y, Matsumoto K, Nakamura T, Ueki T, et al.: Hepatocyte growth ... calculated as the mean percent lysis ± standard deviation at a given effector:target ratio for each treatment group Reverse transcribed PCR RNA was extracted using an ISOGEN (Nippongene, Toyama, Japan)...
... often a score, which includes a class of healthy animals, and one or more classes of affected animals In the case of endemic diseases the vast majority of animals at any one time may be classified ... pathogen burden Anderson and May [5] describe the spread of a microparasitic (viral or bacterial) infection through a population of animals using a so-called SIR model, based on the rates at which susceptible ... at which diseased animals no longer show clinical signs and move to the carrier state, and is the rate at which carrier state animals cease to be infectious The total time an animal is infectious...
... production and consumption activities are in a specific form of Cobb-Douglas This specific formulation has the advantageous to analyze analytically the local non-traded capitals and natural amenity’s ... compensating price with both non-traded capitals and local amenities Our model built upon Glaeser and Gottlieb’s has the above advantages as Chapter Literature Review Glaeser and Gottlieb’s that ... Gottlieb (2009) as our point of departure The city in that model has a traded sector and a non-traded sector, each employing labor, private capital and public capital as factor inputs Local consumers...
... equation for the order parameter at that point At later times in the simulations when the grain boundary area is a small fraction relative to the overall domain, an additional computational savings ... the grain boundaries using minimal data storage As the grain boundary moves away from a given lattice point, the phase field variable representing that grain is automatically not tracked any more, ... 66 Abstract Computational Materials science is fast catching up as an attractive and complementary approach to designing novel materials An apriori understanding of micro structures and its...
... exergoeconomic analysis of the system at each iteration and on several qualitative and quantitative objective criteria, a hierarchical classification of the system components, and the associated subsets ... Exergy accounting: Capabilities and drawbacks Energy 2006, 31(1), 164-180 Giannantoni C., Lazzaretto A. , Macor A. , Mirandola A. , Stoppato A. , Tonon S., Ulgiati S Multicriteria approach for the improvement ... 1972 Holland J.H Adaptation in Natural and Artificial Systems The University of Michigan Press: Ann Arbor, 1975 Okamoto M., Nonaka T., Ochiai S., Tominaga D Nonlinear numerical optimization with...
... behavioral and attitudinal aspects of individuals An in-depth analysis in each of the broad parameters revealed the following: Educational Facet Education plays a vital role in shaping up a personality ... support to MFIs amongst lower income populations The data was tabulated and analyzed through qualitative analysis of the gathered data, which reveal the behaviors and decision making patterns in lower ... including educational, communal, cultural, political and economic facets The questionnaire also evaluated the level of awareness about MFIs, availability and accessibility to MFIs, and impact of Government...
... CHAPTER 32 A two-factor model (Duffie & Kan) 323 We first solve (1) and (2) simultaneously numerically, and then integrate (3) to obtain the function A 32.3 Calibration Let 0 be given The value ... X1t and X2 t, which implies that C1 0 = 0; C2 0 = 0; A = 0: We must choose the parameters a1 1; a1 2; b1; a2 1 ; a2 2; b2; so that these three equations are satisfied ; 2; ; 1; ; 2; 324 ... we have set up the model so that X2t is the yield at time t of a bond maturing at time t + Thus X2t = X1tC1 + X2tC2 0 + A 0 : This equation must hold for every value of X1t and...
... implementing HR portals It is essentially the organizational culture and employee attitudes toward change that matter Organizational Factors Organizational factors include organizational culture, opportunities ... Research on the effects of such organizational factors may also have practical implications since managers tend to control more organizational factors than individual attributes For instance, managers ... recruiting area, an organization may create a database of prospective employees Such a database may contain the names of employees from competitors, former employees who have left the company, job applicants...
... density may attain values that are substantially higher than random close packing, and quite close to the crystalline limit [131, 132] An analogous transition has also been observed experimentally ... use as an order parameter The vertical orientation of a grain thus wastes space proportional to − a, relative to the horizontal one We examine the response of the packing fraction for typical parameter ... granular dynamics will carry all the usual characteristics of ageing ξdyn so that ω 1; from Eq (7.14), this Now recall that that in Regime II, ξeq implies that the grain is nearly square (a ∼...
... ideas in a variety of ways 10 Having a range of vocabulary As can be seen from the diagram above, ideas and a range of vocabulary are always demonstrated by writers If writers have poor ideas and ... students at elementary level had writing lesson, they would need the teachers assistance at early stages Using a text as amodel has both sides, advantages and disadvantages To begin with its advantages, ... the activities Teachers feed back about classs discussion on choosing ideas, students reading amodel and vocabulary and organization Actual writing task analyzing the model Actual writing task...
... actions that define the relationship between each pair of entities, and label the line with the relationship verb This is the initial ER diagram for the logical data model Answer in v04_160 9a_ act42-1.bmp ... cardinality and existence characteristics of each of the relationships defined in Exercise ! Identify cardinality For each relationship on your ER diagram, ask the question “How many of the parent ... the cardinality of each relationship and denote the entities as parent or child ! Identify existence ! For each relationship on your ER diagram, ask the question “Can the child exist if the parent...