... father a < /b> than b as c but d and < /b> > a < /b> 48 I am teacher a < /b> the ba < /b> c an d no article > b 49 My uncle is good engineer a < /b> the ba < /b> c an d no article > b 50 That is eraser a < /b> the ba < /b> c an d no article ... the ba < /b> c an d no article > b 55 That is a < /b> bag It is on table a < /b> the ba < /b> c an d no article > a < /b> 56 We are in same class a < /b> the ba < /b> c an d no article > a < /b> 57 Your book is the desk a < /b> at b over ... pounds from a < /b> bank a < /b> crime b criminal c criminally d criminality > b 178 your own business can cause a < /b> lot of financial worries a < /b> Manage b Managing c Manager d Manageable > b 179 The surgeons...
... catalysed by a-< /b> amino -b- carboxymuconate-e-semialdehyde decarboxylase J Am Chem Soc 129, 9278–9279 Fukuoka SI, Ishiguro K, Yanagihara K, Tanabe A,< /b> Egashira Y, Sanada H & Shibata K (2002) Identification and < /b> ... a < /b> key precursor of NAD, but also a < /b> potent neurotoxin that acts by activating the N-methyl-d-aspartate subtype receptor for glutamate [4] QA imbalance was reported to be associated with a < /b> number ... the enzyme plays a < /b> key role in both the tryptophan to QA transformation and < /b> catabolism of 2-nitrobenzoic acid [14,15] Extensive biochemical and < /b> structural characterizations have been carried out...
... 5Â-GGTATTGAGGGTCGCCATGGTTATGTTC AATCACCA-3Â; reverse primer, 5Â-AGAGGAGAGTTAG AGCCTTACAAGAAGGGTCCAAAGA-3Â) The PCR product was puried, treated with T4 exonuclease to create vector-compatible overhangs and < /b> annealed to a < /b> prepared ... for LlCBP3 3A < /b> at pH 6.0 (A,< /b> B) Binding of LlCBP3 3A < /b> visualized by SDS-PAGE (A)< /b> LlCBP3 3A < /b> present in the supernatant after 24 h of incubation with a-< /b> chitin (lane 2), b- chitin (lane 3), Avicel (lane ... incubation FEBS Journal 276 (2009) 24022415 ê 2009 The Authors Journal compilation ê 2009 FEBS G Vaaje-Kolstad et al Degradation of a-< /b> and < /b> b- chitin The degradation rates of a-< /b> and < /b> b- chitin were assayed...
... distorted chair The C-terminal a-< /b> domain is characterized by an adamantane-like four-metal cluster Solution structures of 113 Cd-substituted Cd7MT-2 from rabbit, rat and < /b> human are available and < /b> revealed ... (Tubingen, Germany), and < /b> all ¨ other chemicals were from Merck (Darmstadt, Germany) Synthesis of the individual a-< /b> and < /b> b- domains The individual a-< /b> and < /b> b- domains (KSCCSCCPVGCSKCA QGCVCKGAADKCTCCA ... Zn4aMT and < /b> Zn3bMT with those observed for Cd7MT [20] Presence (+) or absence (–) of NOEs is indicated b- Domain Proton Asn (a)< /b> Asn (a)< /b> Asn (b) Cys (a)< /b> Cys (b) Asn 23 (b) a-< /b> Domain Lys (NH) Lys (a)< /b> ...
... binding and < /b> effects on serum albumin and < /b> myoglobin Biophys J 75, 477–483 38 Bhattacharya AA, Curry S & Franks NP (2000) Binding of the general anesthetics propofol and < /b> halothane to human serum albumin ... internal cavity [1] The b- barrel cavity ˚ has a < /b> volume of 515 ± 30 A3< /b> , and < /b> is lined predominantly by aromatic and < /b> aliphatic residues The ability of this cavity to bind anesthetic molecules was explored ... serum albumin using differential scanning calorimetry and < /b> hydrogen exchange [37] Furthermore, both halothane and < /b> isoflurane stabilize the native folded state of albumin to thermal denaturation as...
... DNA clone 293T A < /b> bp 293 linTTV pTTV pSTBlue-1 day1 day3 day1 day3 day3 Mw B B/D B B/D B B/D B B/D B B/D 4899 3639 2799 bp linTTV pTTV pSTBlue-1 day1 day3 day1 day3 day3 Mw B B/D B B/D B B/D B B/D ... B/ D B B/D Mw bp 4899 3639 2799 Cos-1 Huh7 linTTV pTTV linTTV pTTV pSTBlue-1 pSTBlue-1 day1 day3 day1 day3 day3 day1 day3 day1 day3 day3 Mw B B/D B B/D B B/D B B/D B B/D Mw B B/D B B/D B B/D B B/D ... experiments The viral genome is represented by an empty bar and < /b> the backbone plasmid by a < /b> thin black line The DIG- and < /b> the 32P-labelled probes are indicated BamHI (vertical bars) and < /b> DpnI (r) restriction...
... (3) and < /b> (4), the dissociation rate constant, k, and < /b> the O2 affinity, K, can be derived for both the a < /b> and < /b> b subunits from the averaged parameters of HbA oxygenation (Table 1, Average) The association ... oxygenation parameters in the salt-free buffers (Table 1, Average) can be considered as follows The BR rate constant for the a < /b> subunits within triliganded HbA and < /b> the BR quantum yield for the a < /b> subunits ... ! ðaO2 ; bO2 ÞðaO2 ; bO2 Þ À a;< /b> bO2 ÞðaO2 ; bO2 Þ þ O2 ka À ðaO2 ; bO2 ÞðaO2 ; bO2 Þ ! hv ð1Þ ðaO2 ; bO2 ÞðaO2 ; bO2 Þ À ðaO2 ; b ðaO2 ; bO2 Þ þ O2 ! kb À ðaO2 ; bO2 ÞðaO2 ; bO2 Þ ! where (aO2,...
... the wells not allow more than one ssDNA bead to be loaded into a < /b> well • Enzyme beads and < /b> packing beads are added Enzyme beads containing sulfurase and < /b> luciferase, and < /b> packing beads used only ... are broken, and < /b> the beads are released • Enrichment beads are added (containing biotin); these attach to DNA rich beads only • A < /b> magnetic field filters all DNA rich beads from empty beads, and < /b> ... The B adapter contains a < /b> 5’ biotin tag used for mobilization • The beads are magnetized and < /b> attract the biotin in the B adaptors Filtering the Mess • There are four adaptor combinations that are...
... flax leaves Galactolipids were separated and < /b> purified as described in Materials and < /b> methods EDE content was measured by UV absorbance of MGDG and < /b> DGDG fractions at 267 nm Average values and < /b> standard ... diglyceride, from Arabidopsis thaliana J Biol Chem 276, 12832–12838 42 Hisamatsu Y, Goto N, Hasegawa K & Shigemori H (2003) Arabidopsides A < /b> and < /b> B, two new oxylipins from Arabidopsis thaliana Tetrahedron ... mass spectral data This work was supported in part by Grant 09-04-01023 -a < /b> from the Russian Foundation for Basic Research and < /b> a < /b> grant from the Russian Academy of Sciences (program ‘Molecular and...
... (Hsp9 0a,< /b> forward primer GCTTGAAGCAAGCCTCGATGCCT GAGGAAACCCAGACCCAA, reverse primer CAGT AGCTTCATCTTTTCGGTCTACTTCTTCCATGCGTGA; Hsp9 0b, forward primer GCTTGAAGCAAGCCTCGAT GCCTGAGGAAGTGCACCATGGA, reverse ... Hsp90 clients and < /b> Hsp90 inhibitor sensitivity in such strains; analysis that showed that many mammalian clients are able to be activated by both Hsp9 0a < /b> and < /b> Hsp9 0b Whether Hsp9 0a < /b> or Hsp9 0b is expressed ... staining revealed almost instant loss of any actin organization following Hsp90 inhibitor treatment; data not shown) After h, many of these cells displayed an apparent arrest of DNA and < /b> vacuolar...
... recombinant CnAa and < /b> CnAb baculoviruses (Fig 1B, C) Kinetic assays of CaNa and < /b> CaNb phosphatase activity Fig SDS/PAGE and < /b> Western blot analysis of baculovirus expressed CaN composed of CnAa or CnAb ... described [10] The coinfection, expression and < /b> purification of baculovirus-expressed CaN containing the rat brain CnAa subunit and < /b> rat brain CnB, or the human CnAb subunit and < /b> rat brain CnB was carried ... is a < /b> more potent inhibitor of both CaNa and < /b> CaNb than CyPA/CsA Activation of CaNa and < /b> CaNb phosphatase activity by FKBP12/FK506 toward pNPP In contrast to the inhibition of CaN phosphatase activity...
... water for each Partial acetylation of serines and < /b> threonines was avoided by adding 12 lL of a < /b> solution containing 0.5 mm hydroxylamine and < /b> 100 mm NaOH to the reaction chamber and < /b> incubating at ... [28,29] Although a < /b> general stromal processing peptidase (SPP) has been characterized, and < /b> a < /b> preferred consensus sequence for cleavage between a < /b> basic amino acid (arginine or lysine) and < /b> a < /b> C-terminal ... and < /b> potassium alkali metal and < /b> various di- and < /b> tri-alkali metal adducts if standard solvents with 0.1% formic acid were used for the UPLC separation (Fig 2A)< /b> In addition, the alkali metal adducts...
... phylogenetic analysis Enzyme Species GenBank/EBI A < /b> transferase A < /b> transferase A < /b> transferase A < /b> (cis A/< /b> B) transferase A-< /b> likea Gal transferase Gal transferase Gal transferase Gal transferase Gal transferase ... Ó FEBS 2002 kidney, the urinary bladder, the uterus and < /b> the thymus A < /b> weaker signal was obtained from the pancreas and < /b> very weak, barely detectable, signals were visible from a < /b> salivary gland, ... intestine Caecum Large intestine Pancreas Parotid gland Submaxillary gland Liver Trachea Lung Kidney Urinary bladder Ovary Uterus Testis Seminal vesicle Thyroid gland Parathyroid gland Brain Muscle...
... antagonism on prostaglandin and < /b> leukotriene synthesis in glomerular immune injury J Laboratory Clin Med 134, 478–482 Ushikubi, F., Aiba, Y., Nakamura, K., Namba, T., Hirata, M., Mazda, O., Katsura, ... 45 by up-regulating the synthesis and < /b> release of endogenous basic fibroblast growth factor J Biol Chem 268, 17397–17403 Lianos, E .A < /b> & Bresnahan, B .A < /b> (1999) Effect of thromboxane A2< /b> inhibition and < /b> ... DNA polymerase, T4 DNA ligase and < /b> calf intestinal alkaline phosphatase were obtained from Roche Molecular Biochemicals, Sussex, UK Nytran supercharge membrane (0.45 lm) was from Schleicher and...
... direction Breathing As seen in Figure 3a,< /b> deep breathing resulted in a < /b> sinusoidal resistance curve, varying between approximately kΩ and < /b> kΩ These are absolute values and < /b> a < /b> low total change compared ... foam sensor was plotted as in Figure 3b This was calculated by dividing the absolute resistance at a < /b> given time t, Rt, by the initial baseline resistance, R0 It can be seen in Figure 3b that ... in wearable and < /b> ubiquitous computing applications for a < /b> system to make decisions based on its perception of the needs and < /b> wants of the user A < /b> subtle, comfortable sensor that demands no attention...
... of Alabama at Birmingham, Birmingham, Alabama, USA 5St Markus Hospital, AIDS ALLY, Kumasi, Ghana 6Department of Nutrition Sciences - Nutritional Biochemistry and < /b> Genomics, University of Alabama ... Alabama at Birmingham, Birmingham, Alabama, USA Conclusions Micronutrient deficiency and < /b> HIV infection are both major and < /b> increasingly important problems in subSaharan Africa Our multivariate analysis ... exposure was associated with lower Table Univariate statistics and < /b> distributions of vitamins A < /b> and < /b> E and < /b> plasma aflatoxin by HIV status HIV negative Variables Mean ± SD HIV positive Median Mean ±...
... appearance of full-blown AIDS, which is accompanied again by an increase The T-cell count after an initial fast decrease stabilizes at levels which are lower than those of healthy individuals but ... finite-precision arithmetic are, in fact, based on generalized cellular automata The advantage of the ultradiscretization procedure is that it is a < /b> systematic, algorithmic approach which, moreover, generates ... (2.1), and < /b> mutatis mutandis also from (2.2), if we start, as is reasonable, with A < /b> = 0, we have A < /b> > 0, and < /b> thus A < /b> grows as long as A < /b> < µI/λ The only fixed point of (2.1) is A < /b> = I = 0, that is,...