0

a and b indicators plot t

600 sentences of certificate A and B

600 sentences of certificate A and B

Cao đẳng - Đại học

... pupil a < /b> the b a < /b> c an d no article > b 55 That is a < /b> bag It is on table a < /b> the b a < /b> c an d no article > a < /b> 56 We are in same class a < /b> the b a < /b> c an d no article > a < /b> 57 Your book is the desk a < /b> at b ... father a < /b> than b as c but d and < /b> > a < /b> 48 I am teacher a < /b> the b a < /b> c an d no article > b 49 My uncle is good engineer a < /b> the b a < /b> c an d no article > b 50 That is eraser a < /b> the b a < /b> c an d no article ... eyes tightly and < /b> cover them with their hands a < /b> tells b close c tightly d with > b 37 They visited America about a < /b> thousand years ago, on the eleventh century AD a < /b> visited b thousand c ago d on...
  • 280
  • 884
  • 3
Tài liệu Báo cáo khoa học: The chitinolytic system of Lactococcus lactis ssp. lactis comprises a nonprocessive chitinase and a chitin-binding protein that promotes the degradation of a- and b-chitin doc

Tài liệu Báo cáo khoa học: The chitinolytic system of Lactococcus lactis ssp. lactis comprises a nonprocessive chitinase and a chitin-binding protein that promotes the degradation of a- and b-chitin doc

Báo cáo khoa học

... 5Â-GGTATTGAGGGTCGCCATGGTTATGTTC AATCACCA-3Â; reverse primer, 5Â-AGAGGAGAGTTAG AGCCTTACAAGAAGGGTCCAAAGA-3Â) The PCR product was puried, treated with T4 exonuclease to create vector-compatible overhangs ... 5Â-GGATGAGCTCTATACTCACATCTTGAGC3Â; reverse primer, 5Â-TTGTGGGCCCAACCAATCTATG AAGAATT-3Â) The PCR product was cloned using the zero blunt TOPO-cloning kit (Invitrogen, Carlsbad, CA, USA) The resulting ... machineries, such as in the lactic acid bacterium (LAB) Lactococcus lactis ssp lactis IL1403 LABs are Gram-positive, facultatively, anaerobic, fermentative bacteria that are of major importance...
  • 14
  • 683
  • 0
Báo cáo khoa học: Coordination of three and four Cu(I) to the a- and b-domain of vertebrate Zn-metallothionein-1, respectively, induces significant structural changes doc

Báo cáo khoa học: Coordination of three and four Cu(I) to the a- and b-domain of vertebrate Zn-metallothionein-1, respectively, induces significant structural changes doc

Báo cáo khoa học

... ordered to form a < /b> distorted chair The C-terminal a-< /b> domain is characterized by an adamantane-like four-metal cluster Solution structures of 113 Cd-substituted Cd7MT-2 from rabbit, rat and < /b> human are available ... data available on Cd(II)-substituted human MT-3 indicated the formation of two metal thiolate clusters, similar to those found in MT-1 and < /b> MT-2 Further investigation of that protein pointed towards ... vertebrate Zn(II )and < /b> Cd(II)-containing MTs, it was already known that the two domains form independently from each other and < /b> not interact with each other Therefore, it was suggested that the two...
  • 14
  • 485
  • 0
Báo cáo khoa học: Mutual effects of proton and sodium chloride on oxygenation of liganded human hemoglobin Oxygen affinities of the a and b subunits potx

Báo cáo khoa học: Mutual effects of proton and sodium chloride on oxygenation of liganded human hemoglobin Oxygen affinities of the a and b subunits potx

Báo cáo khoa học

... k, and < /b> the O2 affinity, K, can be derived for both the a < /b> and < /b> b subunits from the averaged parameters of HbA oxygenation (Table 1, Average) The association and < /b> dissociation rate constants for the ... between the T- and < /b> R-states Later modeling studies have argued that the R2-state was actually the endpoint of the transition from the T- state The crystallization, under different conditions, of liganded ... values of the association rate constant of BR (k¢) and < /b> the quantum yield of BR (c) The data for the a < /b> and < /b> b subunits within liganded tetrameric HbA are shown in (A)< /b> and < /b> (B) , respectively Conditions:...
  • 11
  • 577
  • 0
The a and b adapters are used as priming sites for both amplification

The a and b adapters are used as priming sites for both amplification

Tin học

... these attach to DNA rich beads only • A < /b> magnetic field filters all DNA rich beads from empty beads, and < /b> then extracts the biotin beads from the DNA rich beads • The DNA in the beads are denatured ... priming sites for both amplification and < /b> sequencing since their composition is known • The B adapter contains a < /b> 5’ biotin tag used for mobilization • The beads are magnetized and < /b> attract the biotin ... ligated to the blunt ends using DNA ligase • The strands are denatured using sodium hydroxide to release the ssDNA template library (sstDNA) The Adapters • The A < /b> and < /b> B adapters are used as priming...
  • 19
  • 390
  • 0
Báo cáo khoa học: Unprecedented pathogen-inducible complex oxylipins from flax – linolipins A and B docx

Báo cáo khoa học: Unprecedented pathogen-inducible complex oxylipins from flax – linolipins A and B docx

Báo cáo khoa học

... (at h after inoculation with E carotovora atroseptica), (C) infected plants (at 24 h after inoculation with E carotovora atroseptica) (Fig 1C) At this time, flax leaves had depigmented spots ( ... extracted from flax leaves, separated and < /b> purified as described in Materials and < /b> methods UV chromatograms (267 nm) of galactolipids extracted from: (A)< /b> unstressed plants, (B) infected plants (at ... hydrogenated GC-MS analysis of hydrogenation products revealed the presence of methyl stearate and < /b> the methyl ester of 13-oxa-nonadecanoic acid The mass spectrum of the latter was identical to that...
  • 10
  • 387
  • 0
Báo cáo khoa học: Expressed as the sole Hsp90 of yeast, the a and b isoforms of human Hsp90 differ with regard to their capacities for activation of certain client proteins, whereas only Hsp90b generates sensitivity to the Hsp90 inhibitor radicicol pdf

Báo cáo khoa học: Expressed as the sole Hsp90 of yeast, the a and b isoforms of human Hsp90 differ with regard to their capacities for activation of certain client proteins, whereas only Hsp90b generates sensitivity to the Hsp90 inhibitor radicicol pdf

Báo cáo khoa học

... homologies to plasmid pBDC [34] (Hsp9 0a,< /b> forward primer GCTTGAAGCAAGCCTCGATGCCT GAGGAAACCCAGACCCAA, reverse primer CAGT AGCTTCATCTTTTCGGTCTACTTCTTCCATGCGTGA; Hsp9 0b, forward primer GCTTGAAGCAAGCCTCGAT ... Hsp9 0a < /b> start codon in bold) and < /b> the reverse primer CTTC ATCTGCAGTTAGTCTACTTCTTCCAT (PstI site underlined; stop codon position in bold) This PCR product was cleaved with SalI and < /b> PstI, and < /b> then ... GCCTGAGGAAGTGCACCATGGA, reverse primer CA GTAGCTTCATCTTTCGATCGACTTCTTCCATGCGA GA) The second PCR used a < /b> universal pair of primers [34,48] PJ69- 4a < /b> [48] was then transformed with the product of this...
  • 11
  • 427
  • 0
Báo cáo khoa học: Identification of the N-termini of NADPH : protochlorophyllide oxidoreductase A and B from barley etioplasts (Hordeum vulgare L.) ppt

Báo cáo khoa học: Identification of the N-termini of NADPH : protochlorophyllide oxidoreductase A and B from barley etioplasts (Hordeum vulgare L.) ppt

Báo cáo khoa học

... this binding site could be important for transient stabilization of the PORA protein in the plastid stroma after import and < /b> before the protein is assembled into an enzymatically active form As a < /b> ... potassium alkali metal and < /b> various di- and < /b> tri-alkali metal adducts if standard solvents with 0.1% formic acid were used for the UPLC separation (Fig 2A)< /b> In addition, the alkali metal adducts ... from barley etioplasts and < /b> separated by UPLC using neutral solvents containing 10 mM ammonium formate One half of each sample was separated by UPLC after in-gel acetylation and < /b> digestion without...
  • 8
  • 362
  • 0
Báo cáo khoa học: Cloning of a rat gene encoding the histo-blood group A enzyme Tissue expression of the gene and of the A and B antigens potx

Báo cáo khoa học: Cloning of a rat gene encoding the histo-blood group A enzyme Tissue expression of the gene and of the A and B antigens potx

Báo cáo khoa học

... stomach, the colon, the Table Tissue distribution of the Abo mRNA and < /b> of the A < /b> and < /b> B antigens in the BDIX rat Transcripts were detected by RT-PCR from total RNA extracts of various rat tissues using ... the A < /b> and < /b> B antigens is that in man A < /b> and < /b> B epitopes are expressed in the same cell types whereas in the rat they are not It had been observed earlier that B, but not A,< /b> antigen is developmentally ... codistributed at the cellular level It is unlikely that mAb ED3, the anti -B that we used, detected the related pseudo -B or Gala1,3Gal epitope as the antibody did not react with the synthetic disaccharide...
  • 8
  • 499
  • 0
Báo cáo khoa học: Characterization of the 5¢ untranslated region of a and b isoforms of the human thromboxane A2 receptor (TP) Differential promoter utilization by the TP isoforms doc

Báo cáo khoa học: Characterization of the 5¢ untranslated region of a and b isoforms of the human thromboxane A2 receptor (TP) Differential promoter utilization by the TP isoforms doc

Báo cáo khoa học

... implies that the TPa and < /b> TPb are under the transcriptional control of distinct promoters EXPERIMENTAL PROCEDURES Materials UltraspecTM total RNA isolation system was obtained from Biotecx Laboratories, ... ProfessionalTM program [23] available at http://genomatix.gsf.de/cgi-bin/matinspector/ matinspector.pl All programs were used at the default settings Statistical analysis The organization and < /b> the exon-intron ... of the RT-PCR product generated with Kin2 terminates appears that the TPa, but not the TPb, mRNA contains E1 and < /b> E 1b sequences To further characterize the 5¢ UTR of the TP mRNA transcripts, RT-PCR...
  • 16
  • 321
  • 0
Báo cáo sinh học:

Báo cáo sinh học: " Open Access Cloning of the canine RNA polymerase I promoter and establishment of reverse genetics for influenza A and B in MDCK cells" docx

Hóa học - Dầu khí

... Xenopus Rat TATTGGACCTGGAGATAGGTACTGACACGC Mouse TTTGGGCCGCCGGGTTATATGCTGACACGC 216 bases TGCCTTATATGTTCGTCTGTAGGAGCGAGT GCATGTGCGGGCAGGAAGGTAGGGGAAGAC GATC Drosophila TATTGTACCTGGAGATATATGCTGACACGC ... GGACGGC-TCCGCACGGTGCCTGC-TCCGGAGAACTTTGATGATTTTTCAAAGTC CTCCCGGAGATCACTGGCTTGGCGGCGTGGCGGCGTGGCGGCGTGGCGGCGTGGCGGCGTGGCGGCGTGGC Consensus (1467) GGACGGC TCCGCACGGTGCCTGC TCCGGAGAACTTTGATGATTTTTCAAAGTC CTCCCGGAGATCACTGGC ... GGGGACAGTTGGCCGTGTCACGGTCCCGGGAGGTCGCGGTGACCTGTGGCTGGTCCCCGCCGGCAGGCGCGGTTATTTTCTTGCCCGAGATGAACATTTTTTGTTGCCAGGTAGGTGCTGACACGTTG Consensus (1723) GGG ACAGTTGGCCGTGTCACGGTCCCGGGAGGTCGCGGTGACCTGTGGCTGGTCCCCGCCGGCAGGCGCGGTTATTTTCTTGCCCGA...
  • 12
  • 567
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Cloning of the canine RNA polymerase I promoter and establishment of reverse genetics for influenza A and B in MDCK cells" pdf

Hóa học - Dầu khí

... Xenopus Rat TATTGGACCTGGAGATAGGTACTGACACGC Mouse TTTGGGCCGCCGGGTTATATGCTGACACGC 216 bases TGCCTTATATGTTCGTCTGTAGGAGCGAGT GCATGTGCGGGCAGGAAGGTAGGGGAAGAC GATC Drosophila TATTGTACCTGGAGATATATGCTGACACGC ... GGACGGC-TCCGCACGGTGCCTGC-TCCGGAGAACTTTGATGATTTTTCAAAGTC CTCCCGGAGATCACTGGCTTGGCGGCGTGGCGGCGTGGCGGCGTGGCGGCGTGGCGGCGTGGCGGCGTGGC Consensus (1467) GGACGGC TCCGCACGGTGCCTGC TCCGGAGAACTTTGATGATTTTTCAAAGTC CTCCCGGAGATCACTGGC ... GGGGACAGTTGGCCGTGTCACGGTCCCGGGAGGTCGCGGTGACCTGTGGCTGGTCCCCGCCGGCAGGCGCGGTTATTTTCTTGCCCGAGATGAACATTTTTTGTTGCCAGGTAGGTGCTGACACGTTG Consensus (1723) GGG ACAGTTGGCCGTGTCACGGTCCCGGGAGGTCGCGGTGACCTGTGGCTGGTCCCCGCCGGCAGGCGCGGTTATTTTCTTGCCCGA...
  • 12
  • 627
  • 0
2000 Test exam with A and B docx

2000 Test exam with A and B docx

Chứng chỉ A, B, C

... pupil a < /b> the b a < /b> c an d no article > b 55 That is a < /b> bag It is on table a < /b> the b a < /b> c an d no article > a < /b> 56 We are in same class a < /b> the b a < /b> c an d no article > a < /b> 57 Your book is the desk a < /b> at b ... father a < /b> than b as c but d and < /b> > a < /b> 48 I am teacher a < /b> the b a < /b> c an d no article > b 49 My uncle is good engineer a < /b> the b a < /b> c an d no article > b 50 That is eraser a < /b> the b a < /b> c an d no article ... eyes tightly and < /b> cover them with their hands a < /b> tells b close c tightly d with > b 37 They visited America about a < /b> thousand years ago, on the eleventh century AD a < /b> visited b thousand c ago d on...
  • 281
  • 349
  • 0
Báo cáo toán học:

Báo cáo toán học: "Parking functions of types A and B" ppsx

Báo cáo khoa học

... proof below gives an algorithm for associating a < /b> factorization to any parking function In particular we not use the fact that these two sets have the same number of elements First we remark that there ... since the type B case will be very similar The map from factorizations to parking functions is straightforward, but given a < /b> parking function, finding the associate factorization is not obvious The ... map we are looking at is obviously covariant with respect to these actions, therefore in order to prove the theorem it is enough to prove that the restriction of the map to factorizations with...
  • 5
  • 367
  • 0
Báo cáo y học:

Báo cáo y học: " Hemoglobin a and b are ubiquitous in the human lung, decline in idiopathic pulmonary fibrosis but not in COPD" potx

Báo cáo khoa học

... indicate that the major Hb forms detectable by the commercial antibodies differ between the lung tissue and < /b> BALF or sputum, the major band in the lung tissue being the Hba and < /b> Hbb (not shown in this ... Further information about the proteins was obtained from the SwissProt/TrEMBL database (http://au.expasy.org/sprot/) and < /b> NCBI database (http://www.ncbi.nlm.nih.gov/) Western Blot Analysis Western ... collection of patient material, analyzing the Western analysis results and < /b> performed part of the statistical analysis and < /b> participated in creating the figures VLK conceived the study, and < /b> participated...
  • 13
  • 349
  • 0
Synthetic progress toward parvistemonine, spiroxins a and b, and generation of palmarumycin analogues

Synthetic progress toward parvistemonine, spiroxins a and b, and generation of palmarumycin analogues

Hóa học

... Stemona alkaloids all show insecticidal activity against larvae.10 In another study, tuberostemonine was shown to act as a < /b> glutamate inhibitor at the neuromuscular junction of crayfish with a < /b> potency ... Mingay I think that I found the best travel companions ever and < /b> am already looking forward to our next destination, wherever that might be Last, but certainly not least, I need to thank Zeeshan Ahmed ... They are found in South Asia, Malaysia and < /b> North Australia and < /b> are classified as subshrubs, or twining herbs, with thick and < /b> tuberous roots.5 This family can be divided into three genera: Stemona,...
  • 289
  • 518
  • 0
A STUDY IN THE SELECTIVE POLYMORPHISM OF a  AND b GLYCINE IN PURE AND MIXED SOLVENT

A STUDY IN THE SELECTIVE POLYMORPHISM OF a AND b GLYCINE IN PURE AND MIXED SOLVENT

Cao đẳng - Đại học

... in bulk solution and < /b> at the crystal-solution interface These include algorithms that can directly and < /b> indirectly search for aggregates in solution, and < /b> a < /b> technique that uses mathematical ‘strings’ ... solution and < /b> at the crystal-solution interface  Create algorithms that make use of mathematical ‘strings’ [22] to calculate the energy barrier for crystallization in n-dimensional space  Create ... nucleation and < /b> crystal growth The nucleation hypothesis posits that mature crystals grow from crystal nuclei, and < /b> that these nuclei already have the structures which resemble the mature crystalline...
  • 170
  • 358
  • 0
Electrical, dielectric and magnetocaloric properties of selected a  and b site substituted manganites

Electrical, dielectric and magnetocaloric properties of selected a and b site substituted manganites

Thạc sĩ - Cao học

... Saran Kumar to make the days enjoyable I am also thankful to Mr Prasanta Sahani, Mr Sashi Bhusan Rout, Mr Satyananda Kar, Mr Satyananda Barik, Mr Rajeeb kumar Jena, Mr Narahari Mahanta, Mr Bijay ... (Mrs Saroj Bala Barik, Mrs i ACKNOWLEDGEMENTS Bandana Mahakud and < /b> Mrs Sujata Biswal), Brother-in-laws (Mr Dibakar Barik, Mr Manoranjan Mahakud, Dr Ramesh Biswal and < /b> Mr Kharabela Behera), sister ... Janaki Barik), Grandmother (Late Pagili Barik), Father-in-law (Dr Dasarathi Behera), Mother- in-law (Mrs Golap Manjari Behera), Brothers (Dr Subrat Kumar Barik and < /b> Mr Ratikanta Barik), Sisters (Mrs...
  • 242
  • 417
  • 0
Palladium (II) catalyzed 5 endo epoxynitrile cyclizations   total syntheses of enokipodins a and b

Palladium (II) catalyzed 5 endo epoxynitrile cyclizations total syntheses of enokipodins a and b

Kỹ năng đọc tiếng Anh

... and < /b> usage of DIPEA or absence of base afforded no cyclization products (Table 1, entries 13 and < /b> 14) This way, it was established that both base nature and < /b> metallic counter-ion are essential to ... Duarte for all their valuable assistance at acquiring spectral data Supplementary data Scheme Preparation of precursor Supplementary data (experimental procedures and < /b> spectral data for compounds ... specie At this point, once activated the oxiranyl function and < /b> promoting the C–O bond weakening of the more substituted carbon, 5-endo pathway would be accessible Alternatively, regiospecific formation...
  • 5
  • 485
  • 0

Xem thêm