a a xor ri - 123doc

Báo cáo y học: "A folate-rich diet is as effective as folic acid from supplements in decreasing plasma homocysteine concentrations"

Ngày tải lên : 02/11/2012, 11:12

... techniques Basal and follow-up values were measured at the beginning and at the end of each treatment phase, respectively Multivariate analysis of variance (MANOVA) was used for comparison of the ... concentrations in patients with coronary artery disease (CAD) and hyperhomocysteinemia MATERIALS AND METHODS Twenty-two male outpatients with a history of CAD (angina or myocardial infarction at least ... treatment (diet or supplement), and follow-up (basal or follow-up measures) and each dependent variable (tHcy, folic acid and cobalamin and lipid metabolism parameters) was analyzed separately...

6
418
0

TEMPORAL VARIATIONS OF POLLUTANT LOADS DURING STORM EVENTS IN A SMALL RIVER BASIN

Ngày tải lên : 05/09/2013, 09:08

... midstream area of Uji River and around the junction of Uji River and Niyodo River There are many pulp factories around the downstream area of Saina River, and the wastewater from the factories ... Takaaki Doi and Mr Daisuke Hagiwara for their support for this work We are also grateful to the financial support by Charitable trust wastewater management research promotion fund REFERENCES Ana ... from various land cover types J Water Pollut Control Fed., 252-264 Standard Methods for Examination of Water and Wastewater (1998) 20th edition, American Public Health Association / American Water...

8
374
0

Estimation of river discharge loadings of PAHs in a suburban river in Hiroshima Prefecture, Japan

Ngày tải lên : 05/09/2013, 09:38

... the yearly PAHs loadings were estimated using the meteorological data of 2006 The meteorological data was obtained from the Japan Meteorological Agency, and the data at Higashihiroshima was used ... loading was 66 µg m-2 year-1 For comparing the river discharge loading, the yearly loadings arisen from road traffic and atmospheric deposition were estimated in this river basin area The road traffic ... Kurose River, and loading on rainy days and that on non-rainy days was clarified to be in the same order The yearly PAHs loadings were compared to road traffic and atmospheric deposition in the river...

12
415
0

Development of a Regional Risk Management Framework for APEC Economies for use in the Control and Prevention of Introduced Marine Pests

Ngày tải lên : 28/10/2013, 11:15

... Framework - Introd uced Marine Pests Phase – Consultancy  Identified current management capabilities and approaches  Priorities and hazards for APEC Economies  Considerations for a Risk Management ... Priorities and hazards for Economies  Variable levels of activity and management capability  Ships’ ballast water and hull fouling are the most important vectors  International shipping, aquaculture ... managers and environmental interests Management Framework - Introd uced Marine Pests Workshop, November 2001… Elements for a Draft Risk Management Framework Risk Assessment and Cost Benefit Analysis...

10
583
0

A case-study in IVF - paternalism and autonomy in a ‘high-risk’ pregnancy

Ngày tải lên : 01/11/2013, 08:20

... remarkably stable The pregnancy was complicated at 20 weeks’ gestation by a right deep vein thrombosis, affecting the femoral and external iliac veins, and anti-coagulation with heparin and warfarin ... pregnancy There was a signiﬁcant further advance of her renal disease, necessitating the initiation of haemodialysis (a kidney machine) two years later, and a living, related donor renal transplant ... renal transplants, but specialists were becoming increasingly reluctant to advise women with transplants against trying for a baby, as medical care for ‘high risk’ pregnancies was improving dramatically...

6
512
0

Bài giảng Cách làm đồng hồ có ảnh riêng của mình

Ngày tải lên : 04/12/2013, 12:11

1
410
0

Tài liệu Cách làm đồng hồ có ảnh riêng của mình

Ngày tải lên : 04/12/2013, 12:11

1
384
0

Bài soạn Cách làm đồng hồ có ảnh riêng của mình

Ngày tải lên : 04/12/2013, 12:11

1
342
0

Nghiên cứu thành phần hóa học tinh dầu và dịch chiết của cây riềng mép ngắn (alpinia breviligulata) ở đà nẵng

Ngày tải lên : 23/12/2013, 16:46

... n h a h c c a tinh d u Alpinia breviligulata Gagnep 3.2.6.1 K t qu xác ñ nh thành ph n h a h c c a tinh d u Alpinia breviligulata Gagnep Hình 3.1 S c ký ñ GC c a TD Alpinia breviligulata Gagnep ... ph n h a h c c a tinh d u thân r Alpinia breviligulata Gagnep Hình 3.11 S c ký ñ GC c a TD thân r Alpinia breviligulata Gagnep B ng 3.10 TPHH c a TD thân r RMN (Alpinia breviligulata Gagnep.) ... tinh d u thân Alpinia breviligulata Gagnep Hình 3.8 S c ký ñ GC c a TD thân Alpinia breviligulata Gagnep 14 B ng 3.9 TPHH c a TD thân RMN (Alpinia breviligulata Gagnep.) Đà N ng T gian lưu 3,78...

26
557
0

Tài liệu Báo cáo " The total specialization of modules over a local ring" ppt

Ngày tải lên : 13/02/2014, 03:20

... a Cohen-Macaulay S -module (ii) LT is a maximal Cohen-Macaulay ST -module if L is a maximal Cohen-Macaulay S -module Proof We need only show that (LT )piT is a (maximal) Cohen-Macaulay (ST )piT ... Lα is also a Cohen-Macaulay Sα -module for almost all α Since Lα = (LT )piT , it follows that LT is a Cohen-Macaulay ST -module for almost all α (ii) Assume that L is a maximal Cohen-Macaulay S ... separable prime ideal if it’s ground-form is a separable polynomial We have the following lemma: Lemma 2.1.[1, Satz 14] A specialization of a prime separable ideal is an intersection of a finite prime...

7
500
1

a mink, a fink, a skating rink

Ngày tải lên : 15/02/2014, 11:00

... Your friend who tells you corny jokes— e can b fav rite un your o folks no A A collar, a scholar, a handful of sand, Saxes and faxes, the brass in the band, A cat, a bat, your grandma’s hat— Nou ... Cataloging-in-Publication Data Cleary, Brian P., 1959– A mink, a fink, a skating rink : what is a noun? / by Brian P Cleary ; illustrated by Jenya Prosmitsky p cm — (Words are categorical) Summary: Rhyming text and ... who has always been crazy about cats, and my dad, who surprised me by bringing home a kitten when I was 10 —J.P Copyright © 1999 by Carolrhoda Books, Inc All rights reserved International copyright...

33
416
0

Tài liệu Defending Economic and Social Rights in Cambodia A High-Risk Activity pdf

Ngày tải lên : 20/02/2014, 19:20

... Justice and the Minister of the Interior were contacted in particular FIDH-OMCT / PAGE Defending Economic and Social Rights in Cambodia A High-Risk Activity A Cambodia - A Snapshot Cambodia has made ... party has effectively collapsed The 2006 law on adultery promulgated by the National Assembly, which made adultery a criminal offence, is also seen as politically motivated Prince Ranariddh was ... concessions are defined as a mechanism to grant state private land for agricultural and industrial-agricultural exploitation The purposes for which they may be granted include investment in agriculture,...

32
431
0

CREDITRISK+ A CREDIT RISK MANAGEMENT FRAMEWORK pptx

Ngày tải lên : 06/03/2014, 08:20

... default rates A4 Convergence of variable default rate case to fixed default rate case Default rate uncertainty A1 1 Sector analysis A7 A6 Default events with variable default rates A8 Default losses ... with variable default rates A9 Calculation procedure for loss distribution with variable default rates Risk contributions and pairwise correlations General sector analysis A1 2 A2 A1 0 A1 3 Default ... Default Rates 38 A5 Application to Multi-Year Losses 39 A6 Default Rate Uncertainty 41 A7 Sector Analysis 41 A8 Default Events with Variable Default Rates 44 A9 Default Losses with Variable Default...

72
803
1

Báo cáo khoa học: Adenine, a hairpin ribozyme cofactor – high-pressure and competition studies potx

Ngày tải lên : 07/03/2014, 00:20

... 5¢-CCTCCGAAACAGGACTGTCAGGGGG TACCAGGTAATGCATCACAACGTTTTCACGGTTGA TTCTCTGTTTCAGCGTACCC-3¢ The two primer binding regions are located in the 5¢-terminus and 3¢-terminus A mL PCR reaction with each primer ... polymerase, rNTPs and transcription buffer were obtained from Fermentas (St Leon-Rot, Germany) RNA preparation The sequence of primer P1 (promoter primer) is 5¢-TAATA CGACTCACTATAGGGTACGCTGAAACAGA-3¢, ... 3-methyladenine and 2,6diaminopurine, which share the amidine group of adenine, restore the activity to abasic ribozyme variants lacking A3 8 Detailed analysis of the pH dependence of hairpin ribozymes variants...

15
318
0

Báo cáo khoa học: Transcription termination at the mouse mitochondrial H-strand promoter distal site requires an A/T rich sequence motif and sequence speciﬁc DNA binding proteins pptx

Ngày tải lên : 08/03/2014, 08:20

... AAUAAA [20] This canonical nuclear polyadenylation signal is believed to have a role in the 3¢ end formation of nuclear RNA polymerase II transcripts and also yeast mt mRNAs [21,22] Similar A/ T-rich ... in a unidirectional manner Materials and methods Preparation of mt extract capable of transcription initiation Mt extract from HeLa cells rich in RNA polymerase activity was prepared as described ... 274-5¢-ATTACGCAATAAAC ATTAACAA-3¢-16 295) containing the mouse mt H strand transcription start site and also the putative termination site will be referred to as promoter distal transcription...

13
415
0

A Scientist Rises ppt

Ngày tải lên : 15/03/2014, 19:20

... spacemen lived at an accelerated pace A nine-year trip to Alpha Centauri and back seemed to take only six weeks to men on a spaceship When they returned, their friends and relatives had aged enormously ... the mentatype Robert Silverberg Starman's Quest The Lexman Spacedrive gave man the stars—but at a fantastic price Interstellar exploration, colonization, and trade became things of reality The ... Oppenheim An Amiable Charlatan "The thing happened so suddenly that I really had very little time to make up my mind what course to adopt under somewhat singular circumstances I was seated at my favorite...

15
107
0

Adventures of a Despatch Rider pptx

Ngày tải lên : 16/03/2014, 01:20

... position was unfortunate owing to a weak salient We had already heard guns, but on my way back I heard a distant crash, and looked round to find that a shell had burst half a mile away on a slag-heap, ... uncomfortably on straw in a back yard, and rose again just before dawn We breakfasted hastily at a café, and were off just as the sun had risen Our day's march was to Dour, in Belgium, and for us a bad ... situation I proposed breakfast King and I had half a loaf of Saacy bread and half a pot of jam I always carried about with me The rest went to the men Our breakfast was nearly spoilt by the Manchesters,...

91
160
0

Báo cáo khoa học: A new rice zinc-ﬁnger protein binds to the O2S box of the a-amylase gene promoter pptx

Ngày tải lên : 16/03/2014, 18:20

... buffer, appropriate CGGTATCGATAAGCTTGATTGACTTGACCGTCA amounts of GA were added to a ﬁnal concentration of TCGGATTGACTTGACCGTCATCG-3¢, Amyb2: 5¢-CA 10 lM Isolated aleurone tissues were incubated ... treatment and returned to its basal value within 14 h In contrast, Amy2 mRNA reached a maximum at 14 h after the GA treatment (Fig 6B) These data suggest that RAMY could act as a regulatory or transcription ... Fig RAMY transcript levels in a rice plant subjected to GA treatment (A) GA induced RAMY mRNA accumulation in leaves and roots L, leaves; L + GA, leaves treated with GA; R, roots; R + GA, roots...

7
359
0

pisa are students ready for a technology rich world pptx

Ngày tải lên : 18/03/2014, 11:20

141
248
0

Báo cáo khoa học: "A Feature-Rich Constituent Context Model for Grammar Induction" doc

Ngày tải lên : 23/03/2014, 14:20

... Penn Treebank Computational Linguistics, 19(2):313–330 Tahira Naseem and Regina Barzilay 2011 Using semantic cues to learn syntax In AAAI Tahira Naseem, Harr Chen, Regina Barzilay, and Mark Johnson ... Computational Linguistics, pages 128– 135, Newark, Delaware, USA, June Association for Computational Linguistics Elias Ponvert, Jason Baldridge, and Katrin Erk 2011 Simple unsupervised grammar induction ... parsing no supervisado In 2do Workshop Argentino en Procesamiento de Lenguaje Natural Mitchell P Marcus, Beatrice Santorini, and Mary A Marcinkiewicz 1993 Building a Large Annotated Corpus of English:...

6
308
0