... Lemma 2.4, we have λ+ (ab) = [λ(ab)+ ]+ · ab = [λ(ab)+ ]+ · a+ · ab = [λ(ab)+ · a+ ]+ · ab = {λ[(ab)+ a+ ]}+ · ab = {λ [a+ (ab)+ ]}+ · ab = [( a+ ) · (ab)+ ]+ · ab = ( a+ )+ · (ab)+ · ab = ( a+ ... translational hull of a type -A semigroup, in particular, the result obtained by Ault [1] was substantially generalized and extended Thus, the translational hull of a semigroup plays an important ... that for any a ∈ S, there is an idempotent e such that a = ea Hence, we have λ1 a = λ1 ea = (λ1 e )a = (λ2 e )a = λ2 ea = λ2 a This implies that λ1 = λ2 Lemma 2.2 Let S be an idempotent balanced...
... concentrations in patients with coronary artery disease (CAD) and hyperhomocysteinemia MATERIALS AND METHODS Twenty-two male outpatients with a history of CAD (angina or myocardial infarction at least ... kidney beans or peas); fruits: 150 g kiwi or 200 g banana or tangerine, or 400 g apple or pear; and an average of 40 g regular Kellogg's Special K or All-Bran flakes Seven different food combinations, ... techniques Basal and follow-up values were measured at the beginning and at the end of each treatment phase, respectively Multivariate analysis of variance (MANOVA) was used for comparison of the...
... midstream area of Uji River and around the junction of Uji River and Niyodo River There are many pulp factories around the downstream area of Saina River, and the wastewater from the factories ... Takaaki Doi and Mr Daisuke Hagiwara for their support for this work We are also grateful to the financial support by Charitable trust wastewater management research promotion fund REFERENCES Ana ... during a storm event (5) Origins of various ions were deduced by examining the temporal variations of ion composition As a result, it was indicated that NO3-, SO42- and K+ were mainly originated...
... Japan Meteorological Agency, and the data at Higashihiroshima was used for this calculation The daily precipitation data was used for this calculation For the summation of PAHs loadings of rainfall, ... year-1 on rainy days, and 29 µg m-2 year-1 on non-rainy days The total loading was 66 µg m-2 year-1 For comparing the river discharge loading, the yearly loadings arisen from road traffic and atmospheric ... also calculated similarly because the road traffic was calculated was only for 10 PAHs) The load of the Kurose River was higher than that of the traffic loading, and comparable to that of the atmospheric...
... Framework - Introd uced Marine Pests Phase – Consultancy Identified current management capabilities and approaches Priorities and hazards for APEC Economies Considerations for a Risk Management ... Priorities and hazards for Economies Variable levels of activity and management capability Ships’ ballast water and hull fouling are the most important vectors International shipping, aquaculture ... managers and environmental interests Management Framework - Introd uced Marine Pests Workshop, November 2001… Elements for a Draft Risk Management Framework Risk Assessment and Cost Benefit Analysis...
... remarkably stable The pregnancy was complicated at 20 weeks’ gestation by a right deep vein thrombosis, affecting the femoral and external iliac veins, and anti-coagulation with heparin and warfarin ... pregnancy There was a significant further advance of her renal disease, necessitating the initiation of haemodialysis (a kidney machine) two years later, and a living, related donor renal transplant ... renal transplants, but specialists were becoming increasingly reluctant to advise women with transplants against trying for a baby, as medical care for ‘high risk’ pregnancies was improving dramatically...
... n h a h c c a tinh d u Alpinia breviligulata Gagnep 3.2.6.1 K t qu xác ñ nh thành ph n h a h c c a tinh d u Alpinia breviligulata Gagnep Hình 3.1 S c ký ñ GC c a TD Alpinia breviligulata Gagnep ... ph n h a h c c a tinh d u thân r Alpinia breviligulata Gagnep Hình 3.11 S c ký ñ GC c a TD thân r Alpinia breviligulata Gagnep B ng 3.10 TPHH c a TD thân r RMN (Alpinia breviligulata Gagnep.) ... tinh d u thân Alpinia breviligulata Gagnep Hình 3.8 S c ký ñ GC c a TD thân Alpinia breviligulata Gagnep 14 B ng 3.9 TPHH c a TD thân RMN (Alpinia breviligulata Gagnep.) Đà N ng T gian lưu 3,78...
... is again a Gorenstein ring for almost all α Proof We first will recall the definition about the Gorenstein ring A Noetherian ring is a Gorenstein ring if its localization at every maximal ideal ... Lα is also a Cohen-Macaulay Sα -module for almost all α Since Lα = (LT )piT , it follows that LT is a Cohen-Macaulay ST -module for almost all α (ii) Assume that L is a maximal Cohen-Macaulay S ... separable prime ideal if it’s ground-form is a separable polynomial We have the following lemma: Lemma 2.1.[1, Satz 14] A specialization of a prime separable ideal is an intersection of a finite prime...
... Your friend who tells you corny jokes— e can b fav rite un your o folks no AA collar, a scholar, a handful of sand, Saxes and faxes, the brass in the band, A cat, a bat, your grandma’s hat— Nou ... Cataloging-in-Publication Data Cleary, Brian P., 1959– A mink, a fink, a skating rink : what is a noun? / by Brian P Cleary ; illustrated by Jenya Prosmitsky p cm — (Words are categorical) Summary: Rhyming text and ... part of this book may be reproduced, stored in a retrieval system, or transmitted in any form or by any means—electronic, mechanical, photocopying, recording, or otherwise—without the prior written...
... Germany Mr Laurent Le Marchand First Secretary Embassy of the French Republic Ms Donica Pottie Ambassador Canada Mr David Reader Ambassador British Embassy Civil society Mr An Nan Investigator for ... Economic and Social Rights in Cambodia A High-Risk Activity b) The Appeal trial On April 2007, Born Samnang and Sok Sam Oeung appeals against their convictions were heard by the Court of Appeal The ... and to freedom of assembly are guaranteed under Cambodian law, as well as under various international instruments that impose formal legal obligations on Cambodia as a State Party to the treaties...
... Default Rates 38 A5 Application to Multi-Year Losses 39 A6 Default Rate Uncertainty 41 A7 Sector Analysis 41 A8 Default Events with Variable Default Rates 44 A9 Default Losses with Variable Default ... default rate outcomes Default rate Possible path of default rate Default rate as a discrete random variable B BB BBB A AA AAA Time horizon The discrete approach with rating migrations and the ... with variable default rates A8 Default losses with variable default rates A9 Calculation procedure for loss distribution with variable default rates Risk contributions and pairwise correlations...
... primer) is 5¢-TAATA CGACTCACTATAGGGTACGCTGAAACAGA-3¢, and that of primer P2 (reverse primer) is 5¢-CCTCCGAA ACAGGACTGTCAGGGGGTACCAG-3¢ The 85-nucleotide template used as the minus strand in the synthesis ... cleavage rate constant Keq was taken as the cleaved ⁄ uncleaved RNA concentration ratio The error bars applied to the rate constant values were calculated on the basis of three quantitative scans ... hairpin ribozyme in which the essential adenine 38 was deleted or replaced by an abasic analog [27] It was observed that 2,6-diaminopurine was significantly more efficient than adenine in restoring...
... AAUAAA [20] This canonical nuclear polyadenylation signal is believed to have a role in the 3¢ end formation of nuclear RNA polymerase II transcripts and also yeast mt mRNAs [21,22] Similar A/ T-rich ... yielded a major termination downstream of AAUAAA signal at the end of CAA*, A being the terminal nucleotide 16 295 of the mouse mt genome (189 nt transcript; Fig 7A and C, lane 4) An additional major ... in a unidirectional manner Materials and methods Preparation of mt extract capable of transcription initiation Mt extract from HeLa cells rich in RNA polymerase activity was prepared as described...
... to adopt under somewhat singular circumstances I was seated at my favorite table against the wall on the right-hand side in Stephano’s restaurant, with a newspaper propped up before me, a glass ... on Earth again Travelling at speeds close to that of light, spacemen lived at an accelerated pace A nine-year trip to Alpha Centauri and back seemed to take only six weeks to men on a spaceship ... after I pass forever So I am setting down my record on the mentatype Robert Silverberg Starman's Quest The Lexman Spacedrive gave man the stars—but at a fantastic price Interstellar exploration,...
... position was unfortunate owing to a weak salient We had already heard guns, but on my way back I heard a distant crash, and looked round to find that a shell had burst half a mile away on a slag-heap, ... surface of a narrow garden path That night a 2nd Corps despatch rider called in half an hour before his death We have heard many explanations of how he died He crashed into a German barricade, and ... minutes and I was on the road again It was an easy run, something of a joy-ride until, nearing Ham, I ran into a train of motor-lorries, which of all the parasites that infest the road are the...
... to Whatman paper, dried and autoradiographed RAMY G.max LEAS N.tabacum LEA5 G.hirsutum LEA5 V.radiata ARG2 A. thaliana ARG21 H.vulgare G3 60 59 51 49 52 53 59 Results Screening for rice cDNA encoding ... Amy2 mRNA reached a maximum at 14 h after the GA treatment (Fig 6B) These data suggest that RAMY could act as a regulatory or transcription factor for the expression of a- amylase genes fragment ... buffer, appropriate CGGTATCGATAAGCTTGATTGACTTGACCGTCA amounts of GA were added to a final concentration of TCGGATTGACTTGACCGTCATCG-3¢, Amyb2: 5¢-CA 10 lM Isolated aleurone tissues were incubated...