0

a a direct c

Consolidation Chareteristics based on a direct analytical solution of the Terzaghi Theory

Consolidation Chareteristics based on a direct analytical solution of the Terzaghi Theory

Khoa học tự nhiên

... AGC - AGC - 0.01 Data for Chicago Blue Clay (CBC) (Taylor 1948) and Azraq Green Clay (Al-Zoubi 1993) (AGC- & 8) and Madaba Clay (MAD - T1) cv / H m (Proposed) , / (a) 0.01 cv / H m 0.1 (Casagrande) ... (%) Particle size Plastic Limit (%) Specific Gravity Soil Sand (%) Silt (%) Clay (%) Azraq Green Clay (AGC) 23 69 108 42 2.76 Chicago Blue Clay (CBC)* 64 32 29 17 2.73 Madaba Clay (MDC) 14 41 ... Consolidation Characteristics… Mohammed Shukri Al-Zoubi 0.1 (b) Data points were selected such that the coefficient of consolidation is constat conforming to the Terzaghi theory CBC MAD -T1 AGC...
  • 9
  • 402
  • 0
Effect of injection timing on combustion and performance of a direct injection diesel engine running on Jatropha methyl ester

Effect of injection timing on combustion and performance of a direct injection diesel engine running on Jatropha methyl ester

Môi trường

... pp 343-350 D Agarwal and A. K Agarwal Performance and emissions characteristics of Jatropha oil (preheated and blends) in a direct injection compression ignition engine Applied Thermal Eng 27 (2007) ... (Pensky-Marten closed cup apparatus), cloud and pour points, free fatty acid (FFA) contents (chemical titration method) and Iodine value (using Wij's solution) Table Evaluated properties of Jatropha ... kW and 4.80 kW; and mean effective pressure changes to 6.30 bar and 5.84 bar at 6o retard and 3o advance respectively Similar increase in brake mean effective pressure on retarding the injection...
  • 10
  • 828
  • 1
Báo cáo khoa học: Slc12a2 is a direct target of two closely related homeobox proteins, Six1 and Six4 docx

Báo cáo khoa học: Slc12a2 is a direct target of two closely related homeobox proteins, Six1 and Six4 docx

Báo cáo khoa học

... 5¢-ATCTTCACAAGAAAAAT CACCTGGTACCAAGGATGT; Slc1 2a2 sense, 5¢-ACAT CCTTGGTACCAGGTGATTTTTCTTGTGAAGAT All experimental protocols described in this study were approved by the Ethics Review Committee for Animal ... microarray was carried out at 65 C for 17 h according to the instructions provided by the manufacturer The arrays were washed, dried and scanned using ScanArray 5000 (GSI Lumonics Inc., ON, Canada) ... multiple cycle numbers, separated on a 5% acrylamide gel, stained with the fluorescent dye, scanned and quantitated Linearity of PCR amplification was maintained over several cycles, and the amount...
  • 16
  • 476
  • 0
Báo cáo khoa học: Structure–activity relation for synthetic phenoxazone drugs Evidence for a direct correlation between DNA binding and pro-apoptotic activity pdf

Báo cáo khoa học: Structure–activity relation for synthetic phenoxazone drugs Evidence for a direct correlation between DNA binding and pro-apoptotic activity pdf

Báo cáo khoa học

... that the apoptotic effects of the biologically active compounds Act–ActV are associated with cell cycle perturbations, in which similar cell cycle changes, characterized by accumulation of cells ... Thermo¨ dynamic and spectroscopic characterization of the berenil and pentamidine complexes with the dodecanucleotide d(CGCGA TATCGCG) Z Naturforsch 5 0c, 263–274 28 Krivtsova, M .A. , Moroshkina, E.B., ... helix to coil transition of calf thymus DNA and its complexes with ActII/ActV determined from DSC measurements All thermodynamic parameters are calculated per mol of DNA base pairs DH and DS, as well...
  • 8
  • 331
  • 0
báo cáo sinh học:

báo cáo sinh học:" Is satisfaction a direct predictor of nursing turnover? Modelling the relationship between satisfaction, expressed intention and behaviour in a longitudinal cohort study" pdf

Điện - Điện tử

... Resources and Pay) loaded on one or more second-order or higher level factors In both cases two factors were identified Analysis of Variance (ANOVA) and Multivariate Analysis of Variance (MANOVA) ... [7] Job satisfaction was found to have only an indirect effect on turnover in a model exploring the causal pathways between pay satisfaction, job satisfaction, organizational commitment and turnover ... significant associations for Staffing and Pay The global effect of Care, Staffing, Work-Life Interface, Resources and Pay however falls short of statistical significance (p = 059) An odds Table...
  • 12
  • 530
  • 0
Báo cáo sinh học:

Báo cáo sinh học: "Generalized immune activation as a direct result of activated CD4+ T cell killing" doc

Báo cáo khoa học

... non-parametric comparison of P murina-infected and non-infected mice Additional data files The following additional data files are available Additional data file 1: Strategy for targeting of an activatable ... 8, Article 93 Marques et al for erythrocyte lysis Lymph node cellularity was calculated as the sum of the cellular contents of inguinal, axillary, brachial, mesenteric and superficial cervical ... MIP-1α and IL-1β factors may influence its severity A limitation of the current approach is that CD4+ T cell killing by CD134-driven DTA activation starts as soon as activated T cells are generated...
  • 18
  • 244
  • 0
development of a direct test method for dynamically assessing the liquefaction resistance of soils in situ

development of a direct test method for dynamically assessing the liquefaction resistance of soils in situ

Tiến sĩ

... www.eerc.berkeley.edu/turkey/adapazari) 19 Figure 2-3 Liquefaction-induced lateral spreading and settlement, coupled with tectonic subsidence, carried Hotel Sapanca partially into Lake Sapanca following the 1999 Kocaeli, ... the liquefaction sensor array at Test Location A and the area where a separate crosshole P-wave velocity survey was conducted; Wildlife Liquefaction Array (WLA) (after http://nees ucsb.edu) ... Series at Test Location C, Wildlife Liquefaction Array 283 Figure 8-47 Shear modulus values (G) calculated from the data collected during staged dynamic loading Series at Test Location C, ...
  • 542
  • 309
  • 0
Nucleophosmin as a direct inhibitor of caspase 6 and  8

Nucleophosmin as a direct inhibitor of caspase 6 and 8

Kỹ thuật - Công nghệ

... abundance of NPMc inhibited cytochrome cinduced caspase activation cascade in the HeLa cells and halted cleaving of downstream procaspase-3 by active caspase-8 in the AML-relevant OCI/AML3 cell ... activation cascade 149 5.3.4 OCI/AML3 cell line manifested exclusive cytoplasmic NPM localisation 150 5.3.5 Caspase-8 and -3 activation was significantly halted in TRAIL-treated OCI/AML3 ... 3501.0 Mass (m/z) maarvlvigs ggrehtlawk laqspqvkqv lvapgnagta gagkisnaav svndhsalaq 61 fckdekielv vvgpeaplaa givgdltsag vrcfgptaqa aqlesskkfa kefmdrheip 121 taqwraftnp edacsfitsa nfpalvvkas glaagkgviv...
  • 240
  • 412
  • 0
Adaptive multi mode power control of a direct drive PM wind generation

Adaptive multi mode power control of a direct drive PM wind generation

Điều khiển và tự động hóa

... Electronics Society, and a Vice Chairman of the Electrical Automation Committee of China Automation Association Ronald G Harley (M’77–SM’86–F’92) received the M.Sc.Eng degree (cum laude) in electrical ... have significant advantages over traditional controllers; they are more adaptive, robust, and accurate, especially during unexpected changes of wind speed and power command; the two modes can ... conversion in 2005 and the IEEE Richard H Kaufmann Field Award with a citation For contributions to monitoring, control and optimization of electrical processes including electrical machines and power...
  • 9
  • 957
  • 0
Exergoeconomic optimization and improvement of a cogeneration system modeled in a process simulator using direct search and evolutionary methods

Exergoeconomic optimization and improvement of a cogeneration system modeled in a process simulator using direct search and evolutionary methods

Môi trường

... exergoeconomic analysis of the system at each iteration and on several qualitative and quantitative objective criteria, a hierarchical classification of the system components, and the associated ... Valero A Exergy accounting: Capabilities and drawbacks Energy 2006, 31(1), 164-180 Giannantoni C. , Lazzaretto A. , Macor A. , Mirandola A. , Stoppato A. , Tonon S., Ulgiati S Multicriteria approach ... optimization Table Results obtained with the genetic algorithm Decision variable Case Case EIS EIS Alternative Alternative Mathematical EIS optimization Alternative EIS Alternative Mathematical optimization...
  • 14
  • 593
  • 0
Tài liệu ECTS Users’ Guide: Europe Direct is a service to help you find answers to your questions about the European Union doc

Tài liệu ECTS Users’ Guide: Europe Direct is a service to help you find answers to your questions about the European Union doc

Ngân hàng - Tín dụng

... institutional Transcript of Record, so that learners can have a record/ proof or confirmation of what they have achieved at each stage of their educational pathway “Credits may be accumulated with a view ... typical achievement of learners who have been awarded a qualification at a certain level in a qualifications framework Module A course unit in a system in which each course unit carries the same ... from traditional teacher-centered approaches to approaches that accommodate for learners’ needs and expectations In traditional teacher-centred approaches, subject requirements, knowledge and the...
  • 64
  • 423
  • 0
Tài liệu A RESOURCE GUIDE TO DIRECT MARKETING LIVETOCK AND POULTRY ppt

Tài liệu A RESOURCE GUIDE TO DIRECT MARKETING LIVETOCK AND POULTRY ppt

Nông nghiệp

... inspected and slaughtered at a “USDA Equivalent” state facility and the state inspected carcass (or meat from it) can be sold within that particular state In Delaware, Maryland and Virginia an animal ... example, from an on-farm farm stand) Direct sales to consumers can also take place from the farm’s produce or food stall at a public farmers’ market A commercial kitchen can also further process ... Accurate birth records are essential for age verification of slaughter animals and have a direct impact on product testing, quality assurance and on legal requirements for discarding specific...
  • 164
  • 1,424
  • 0
Tài liệu Does Foreign Direct Investment Work For Sustainable Development? A case study of the Brazilian pulp and paper industry potx

Tài liệu Does Foreign Direct Investment Work For Sustainable Development? A case study of the Brazilian pulp and paper industry potx

Tự động hóa

... present data for years 2003, 2004 and 2005 and Cenibra which data are available only for 2005 ** The companies not have this value calculated All plants, excepting Aracruz and Cenibra, are integrated, ... Política Científica e Tecnológica, Instituto de Geociências da Universidade Estadual de Campinas, Campinas Romer, P (1990) Endogenous technical change Journal of Political Economy Chicago, Illinois, ... than Klabin and Ripasa R&D expenditure which are local firms that have a productive capacity higher than Norske Skog According to UNCTAD (2005), among TNCs, the European companies have the greatest...
  • 23
  • 894
  • 0
Báo cáo

Báo cáo " Modeling Foreign direct investment by a Prisoner’s dilemma: Greenfield investment (cooperation) or Mergers and Acquisitions (defection) " pptx

Báo cáo khoa học

... Player So that joint cooperation is more profitable than alternating C and D Player has an action and a strategy He (and hence the strategy) plays PD with opponent, and changes his action according ... cooperation (C) and M &A count as defection (D), respectively Because M &A allows a firm to get costly access to the country-specific capabilities of the acquired firm, and the price of such an M &A ... therefore should take into account for features which nowadays characterize the internationalization process, capturing the technological implications of M &A At first, we consider a situation with two...
  • 9
  • 460
  • 0
INFLUENTIAL MARKETING: A NEW DIRECT MARKETING STRATEGY ADDRESSING THE EXISTENCE OF VOLUNTARY BUYERS doc

INFLUENTIAL MARKETING: A NEW DIRECT MARKETING STRATEGY ADDRESSING THE EXISTENCE OF VOLUNTARY BUYERS doc

Tiếp thị - Bán hàng

... on a real data set provided by the Canadian Imperial Bank of Canada (CIBC) In addition, a third model based on the same data set was constructed “in-house” by CIBC Recall that a traditional direct ... discusses classification in data mining Chapter 2.2 looks at the class imbalance problem An overview on the standard campaign practice is given in Chapter 2.3 In Chapter 2.4, the two classification algorithms ... from a previous campaign Each historical customer sample is associated with a number of individual characteristics (e.g age, income, marital status) and a response variable The response variable...
  • 67
  • 600
  • 0
advances in thermal design of heat exchangers a numerical approach direct-sizing, step-wise rating, and transients

advances in thermal design of heat exchangers a numerical approach direct-sizing, step-wise rating, and transients

Hóa học - Dầu khí

... L.4 Appendix M Notation Commentary Chapter Chapter Chapter Chapter Chapter Chapter Chapter Chapter Chapter 10 Chapter 11 Chapter 12 Appendix A Appendix I Index xiii Header design Transients in contraflow ... LMTD AND MEAN TEMPERATURES AT EACH SECTION thermophysical properties for each section using spline-fitted data CALCULATE SURFACE AREA AND LENGTH for each section CALCULATE PRESSURE LOSS FOR EACH ... Wiley also publishes its books in a variety of electronic formats Some content that appears in print may not be available in electronic books British Library Cataloguing in Publication Data A catalogue...
  • 530
  • 569
  • 0
conte r., magri f., musette m., satsuma j, and winternitz p. direct and inverse methods in nonlinear evolution equations, greco a. m.

conte r., magri f., musette m., satsuma j, and winternitz p. direct and inverse methods in nonlinear evolution equations, greco a. m.

Vật lý

... di Matematica Via Archirafi 34, 90123 Palermo, Italy Editor C. I.M.E activity is supported by: Ministero dell’Universit` Ricerca Scientifica e Tecnologica, Consiglio Nazionale delle a Ricerche and ... must satisfy the Tzitz´ica PDE, and f0 is an arbitrary e nonzero complex constant λ Accordingly, one has obtained a Lax pair and a singular part transformation The equivalent projective Riccati ... Particle, Nuclear and Astrophysics Vol.592: S Cotsakis, L Papantonopoulos (Eds.), Cosmological Crossroads An Advanced Course in Mathematical, Physical and String Cosmology Vol.593: D Shi, B Aktas, L Pust,...
  • 287
  • 805
  • 0
báo cáo hóa học:

báo cáo hóa học:" The experiences of people living with HIV/AIDS and of their direct informal caregivers in a resource-poor setting" doc

Hóa học - Dầu khí

... Demographic Impact of HIV/AIDS in South Africa, National and Provincial Indicators for 2006 Cape Town: Centre for Actuarial Research South African Medical Research Council and Actuarial Society of ... participants named the local health centre as their primary source of medical assistance, participants also described a shortage of staff within the centre and an occasional shortage of medications ... Rasmeni, and Lulama Zonke and to the Canadian team: Carolyn Byrne, Tracey Chambers, Kevin Chan, Stuart MacLeod, Victor Neufeld, Jacqueline Roberts, Eli Tshibwabwa, and to the Canadian International...
  • 9
  • 425
  • 0
Báo cáo hóa học:

Báo cáo hóa học: "A new time-hopping/direct-sequence biorthogonal PPM UWB communication system" docx

Hóa học - Dầu khí

... GA Hence, using GA leads to inaccurate error probability analysis and also leads to optimistically overestimate the system performance By deriving the characteristic functions (CF) of the MAI, ... multiple-access communications IEEE Trans Commun 48(4), 679–689 (2000) doi:10.1109/26.843135 L Zhao, AM Haimovich, The capacity of an UWB multiple-access communications system, in Proc IEEE ICC 2002, ... ChungYuan Christian University, Chung Li, Taiwan Page 11 of 11 11 AR Forouzan, M Nasiri-Kenari, JA Salehi, Performance analysis of timehopping spread-spectrum multiple-access systems: uncoded and coded...
  • 11
  • 307
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Enabling direct connectivity between heterogeneous objects in the internet of things through a network-service-oriented architecture" docx

Hóa học - Dầu khí

... or received packets, network services interact with packets through a ‘packet facade’ (Figure 2b, interaction 2) Through this packet facade, standardized packet attributes (metadata) can be added, ... the packet facade b Only the packet facade requires knowledge about the packet format As long as the correct packet descriptor is available, the packet facade knows how and where metadata is stored ... for packet creation, packet storing and packet interactions b Interactions between the network services and IDRA are mainly descriptive in nature c Network services can be added dynamically according...
  • 14
  • 660
  • 3

Xem thêm