a a and direct
Tài liệu Controlling the Playback Speed and Direction of a Timeline docx
... part of the statement handle this common functionality in either case Following that, the value of action is further evaluated If action has a value of "ff", an onEnterFrame event handler is attached ... function has been passed a value of "ff" or "rew" This part of the conditional statement has a nested if/else statement Because the task of fast-forwarding and rewinding have both common and unique ... be aware of is that both the ff_btn and rew_btn instances have an onPress and an onRelease event assigned This allows those buttons to fast-forward or rewind when pressed, but to automatically...
- 9
- 355
- 0
A Concise History and Directory of the City of Norwich for 1811 pptx
... men and 10 women, who have an allowance of three shillings and sixpence weekly; the coals as heretofore, and the coats and gowns changed to a pair of shoes, and a shirt or a shift each annually ... Waddy, Blanchard, &c The house when well filled, appears to the best advantage, and then any person who has a taste for theatrical amusements, neatness and elegance, cannot fail being agreeably ... persons Seven acres and a half of land was purchased for this purpose, in a healthy situation, near Chapel-field; but, after many meetings, and various plans and estimates offered, it was determined...
- 116
- 532
- 0
Proposal for a COUNCIL DIRECTIVE on a common system of financial transaction tax and amending Directive 2008/7/EC pot
... =1+ 1a +3 =2+ 2a Payments +3 TOTAL operational appropriations EN Commitments (4) N /A N /A N /A N /A N /A N /A N /A N /A Payments (5) N /A N /A N /A N /A N /A N /A N /A N /A Year N is the year in which implementation ... Member States shall apply the same rate to all financial transactions that fall under the same category pursuant to paragraph (a) and (b) Chapter III Payment of FTT, related obligations and prevention ... Commitments =4+ N /A N /A N /A N /A N /A N /A N /A N /A Payments =5+ N /A N /A N /A N /A N /A N /A N /A N /A If more than one heading is affected by the proposal / initiative: TOTAL operational appropriations Commitments...
- 31
- 569
- 0
System dynamics applied to project management: a survey, assessment, and directions for future research potx
... disputes and learning; (2) project estimating and risk assessment; (3) change management, risk management, and project control; and (4) management training and education We briefly describe the general ... actually happened on the project and removes direct impacts, while the Strathclyde group generally starts with a calibration to the plan and adds direct impacts Are both approaches acceptable? ... understand project behavior and improve management is limited Perhaps the biggest need is teaching materials that can be used by both system dynamicists and by others, at a range of depth and duration,...
- 33
- 719
- 0
Economic and social development towards a sustainable direction in Van Lam Embroidery village (Ninh Hai, Hoa Lu, Ninh Binh)
... chamois, and valuable birds (peafowl, parrots, hill minas, and cochins), and reptiles (pythons, snakes, varans, and tortoises) Beautiful and famous landscapes: The natural rocky mountain system in Van ... but also conserves national cultural and historical values Developing economy and society in a sustainable way in trade villages is a new direction and a major challenge for many trade villages ... mountains, there are many famous natural caves attracting thousands of visitors every year such as Cua Quan, Van, and Vo mountains, Tam Coc, Thien, and Mua caves Among them, the most famous is Tam Coc...
- 28
- 433
- 0
Báo cáo sinh học: " Research Article Estimation of Sound Source Number and Directions under a Multisource Reverberant Environment" doc
... emitter location and signal parameter estimation,” IEEE Transactions on Antennas and Propagation, vol 34, no 3, pp 276–280, 1986 [9] M Wax, T Shan, and T Kailath, “Spatio-Temporal spectral analysis ... constraint at the qth testing So far, we have G data and each data has two features (θg and φg ) Our goal is to divide these data into D clusters based on the two features A cluster is defined as a ... localization using microphone array Equation (26) can also be derived from a plane wave assumption Consider a single incident plane wave and a pair of microphones as shown in Figure and the relative...
- 14
- 304
- 0
báo cáo khoa học: "A comparison of policy and direct practice stakeholder perceptions of factors affecting evidence-based practice implementation using concept mapping" doc
... contained only 47% females and had an average age of 49.60 years (SD = 8.60) The overall sample was 74.2% Caucasian, 9.7% Hispanic, 3.2% African American, 3.2% Asian American, and 9.7% ‘Other.’ A ... directors and program managers representing a broad range of children and family mental health agencies and programs, including Page of 12 outpatient, day treatment, case management, and residential ... implementation, such as having a staff ‘champion’ for EBP, having open and adaptable staff who have buy in and are committed to the implementation, and having support and supervision available to...
- 12
- 297
- 0
báo cáo khoa học: "A signal amplification assay for HSV type 1 viral DNA detection using nanoparticles and direct acoustic profiling" ppsx
... provides an easy and useful measure for assay quality and has been a widely accepted standard Z-factor reflects both the assay signal dynamic range and the data variation associated with the signal ... coupled mass of the particle, ii) the proximal contact area between the particle and the sensor surface and iii) the available capture area on the particle and binding dynamics to this capture area ... limit than a heterogeneous, two-step flow-based assay Completely homogeneous assays are advantageous in that they allow single step, rapid tests that require minimal amounts of sample and are easier...
- 12
- 394
- 0
Báo cáo y học: "Novel mutation in YMDD motif and direct neighbourhood in a child with chronic HBV-infection and clinical lamivudine and adefovir resistance - a scholarly case" docx
... the patient was positive for hepatitis B surface antigen (HBsAg) and had antibodies against hepatitis Bc antigen (anti-HBcAg) Because lymphocytes are essential inflammation markers in viral infections, ... experiments and wrote the manuscript All authors read and approved the final manuscript Acknowledgements This work was supported by a grant from the German Ministry for Education and Research (BMBF) and ... et al.: Antiviral drug-resistant HBV: standardization of nomenclature and assays and recommendations for management Hepatology 2007, 46:254-65 Hoofnagle JH, Doo E, Liang TJ, Fleischer R, Lok AS:...
- 6
- 336
- 0
Economic and social development towards a sustainable direction in Van Lam Embroidery village (Ninh Hai, Hoa Lu, Ninh Binh
... materials but also a range of natural landscapes that cannot compare with any place It has many overlapping mountains In large mountains, there are many famous natural caves attracting thousands ... area including the Vu and Do lineages; Cac area known as Hai area including the Le and Dai Cac; Trung area known as Ba area including one branch of Do linage and Dinh linage in Trung Hoa area; ... features that are traditional techniques and technologies, and skilled artisans and artisans 18 Handicraft products have been made to be both goods and artistic objects, bearing national characteristics...
- 105
- 604
- 0
2012THE SURGICAL APPROACH TO TOTAL HIP ARTHROPLASTY COMPLICATIONS AND UTILITY OF a MODIFIED DIRECT LATERAL APPROACH
... primarily for the treatment of congenital dysplasia of the hip and to approach the iliopsoas tendon and lesser trochanter It has no role in THA The direct lateral or transgluteal approach was apparently ... duration of surgery, including patient transfers and prepping and draping, has averaged one hour and thirty-eight minutes for primary THA using this approach Acetabular and femoral component placement ... posteriorly at the vastus ridge and taken in line with the fibers The Surgical Approach to Total Hip Arthroplasty: Complications and Utility of a Modified Direct Lateral Approach TENSOR FASCIAE LATAE...
- 14
- 423
- 0
600 sentences of certificate A and B
... desk a the b a c an d some > c 134 What is color of your pen? a the b a c an d any > a 135 Kate and Mary are going to cinema a the b a c an d no article > a 136 My parents are always at ... countries a Sun b always c on d in > a 52 The man that wife and family are away seems very lonely a that b and c are d seems > a 53 Each year more and more people try setting new and unusual records ... has been demand for computers this year than last year a few b little c fewer d more > d 290 Always make sure your luggage has on it when you travel a a card b a cartel c a label d a traveling-bag...
- 280
- 884
- 3
Test yourself A and Test 1(Kiều Tính)
... climbing, backpacking, and adventure tourism Some recreational activities are made illegal such as gambling and drug use Research has shown that recreation contributes to life satisfaction, quality ... life, health and wellness, and that the use of recreation as a diversion may have clinical applications to individuals with chronic pain and other health impairments In some cultures and religions, ... Holiday is also a common time for recreation Traditionally, music and dance serve as recreation in many cultures Playing sports, hobbies, games and tourism are popular forms of recreation Watching...
- 5
- 719
- 1
Tài liệu Báo cáo khoa học: Expression and secretion of interleukin-1b, tumour necrosis factor-a and interleukin-10 by hypoxia- and serum-deprivation-stimulated mesenchymal stem cells Implications for their paracrine roles ppt
... TCCTGGCAATCGTGGTT CAA and ACCAGCTGGGCCAACATTTC; collagen III: TGGACAGATGCTGGTGCTGAG and GAAGGCCAG 3696 CTGTACATCAAGGA; alpha smooth muscle actin (a- SMA): AGCCAGTCGCCATCAGGAAC and CCGG AGCCATTGTCACACAC; ... 5¢-GCTGTGGCAGCTACCTATGTCTTG-3¢ and 5¢-AGGTCGTCATCATCCCACGAG-3¢; TNF -a: 5¢-AACTCGAGTGACAAGCCCGTAG-3¢ and 5¢-GTAC CACCAGTTGGTTGTCTTTGA-3¢; IL-10: 5¢-CAGACCC ACATGCTCCGAGA-3¢ and 5¢-CAAGGCTTGGCAA CCCAAGTA-3¢; collagen I: ... AGCCATTGTCACACAC; and glyceraldehyde-3-phosphate dehydrogenase: 5¢-GGCACAGTCAAGGCTGAGAATG-3¢ and 5¢-ATGGTGGTGAAGACGCCAGTA-3¢ Immunocytochemical staining for NF-jBp65 MSCs in IMDM supplemented with 10% fetal...
- 11
- 653
- 0
Tài liệu Báo cáo khoa học: The chitinolytic system of Lactococcus lactis ssp. lactis comprises a nonprocessive chitinase and a chitin-binding protein that promotes the degradation of a- and b-chitin doc
... FEBS G Vaaje-Kolstad et al L lactis chitinase and chitin-binding protein A B Fig Sequence alignments for LlChi1 8A and LlCBP3 3A (A) Catalytic domains of LlChi1 8A (chitinase of L lactis ssp lactis), ... initial phase was maintained longer than in the absence of LlCBP3 3A, indicating that LlCBP3 3A acts synergistically with LlChi1 8A However, the effect of LlCBP3 3A was small and ceased after approximately ... containing a putative transcription regulator (GenBank ID: AAK06047.1), chitinase gene (GenBank ID: AAK06048.1) and gene encoding a family 33 CBP (GenBank ID: AAK06049.1) was amplied FEBS Journal...
- 14
- 683
- 0
Tài liệu Báo cáo khóa học: Suppression of b1,3galactosyltransferase b3Gal-T5 in cancer cells reduces sialyl-Lewis a and enhances poly N-acetyllactosamines and sialyl-Lewis x on O-glycans Lydia Mare and Marco Trinchera pdf
... b1,3galactosidases, giving rise to a disaccharide and a monosaccharide, and was thus identified as a mixture of Galb1-4[Fuca1-3]GlcNAcb1-3Gal and Galb1-3[Fuca1-4]GlcNAcb1-3Gal The calculated amounts ... b1,4galactosidases, giving rise to a disaccharide and a monosaccharide, and is thus identified as a mixture of Galb1-3GlcNAcb1-3Gal and Galb1-4GlcNAcb1-3Gal The tetrasaccharide is sensitive to a1 ,3/4 ... large O-glycans contain a minimal amount of radioactivity and were not analysed further, whereas those released from T5AS clone mostly show a disaccharide peak and a smaller trisaccharide peak...
- 9
- 460
- 0
Tài liệu Báo cáo khoa học: "Discriminative Lexicon Adaptation for Improved Character Accuracy – A New Direction in Chinese Language Modeling" pptx
... relative increased character accuracy to the relative increased MAP for the three lexicon adaptation approaches are different A key factor making the proposed LAICA approach advantageous is that ... Oriental Languages, 12(1):99–121 Jianfeng Gao, Joshua Goodman, Mingjing Li, and KaiFu Lee 2002 Toward a unified approach to statistical language modeling for Chinese ACM Transaction on Asian Language ... chart in Figure At the beginning we are given an adaptation spoken corpus and manual transcriptions Based on a baseline lexicon (Lex0 ) and a language model (LM0 ) we perform ASR on the adaptation...
- 9
- 466
- 0
Báo cáo khoa học: Estrogen-related receptor a and PGC-1-related coactivator constitute a novel complex mediating the biogenesis of functional mitochondria potx
... synthase subunit b: 5¢-CCTTCTGCTGTGGGCTATCA-3¢ and 5¢TCAAGTCATCAGCAGGCACA-3¢; ND5: 5¢-TAACCCC ACCCTACTAAACC-3¢ and 5¢-GATTATGGGCGTTGA TTAGTAG-3¢; b-globin: 5¢-CAACTTCATCCACGTTCA CC-3¢ and 5¢-ACACAACTGTGTTCACTAGC-3¢ ... 5¢-AAGACAGCAGCCCCAGTGAA-3¢ and 5¢-ACACCCAGCACCAGCACCT-3¢; PRC: 5¢-CACTGG TTGACCCTGTTCCT-3¢ and 5¢-GTGTTTCAGGGCTTC TCTGC-3¢; Cyt c: 5¢-CCAGTGCCACACCGTTGAA-3¢ and 5¢-TCCCCAGATGATGCCTTTGTT-3¢; ATP ... quantification was performed by nonsaturating picture scanning by a gel Doc 1000 Molecular Analyst apparatus (Biorad) Respiratory parameters and respiratory ratio in intact cells Respiratory parameters and...
- 13
- 503
- 0
Báo cáo khoa học: Functional analysis of a murine monoclonal antibody against the repetitive region of the fibronectin-binding adhesins fibronectin-binding protein A and fibronectin-binding protein B from Staphylococcus aureus pot
... FITC was measured in the FL1 channel (510–535 nm bandpass filter) Data were recorded and analyzed with flowmax software from Partec Statistical analysis of ELISA experiments Each experiment was repeated ... FnBRA lacking FnBPA-9 and FnBPA-10 (A, C) Recombinant, His-tagged full-length FnBRA and FnBRA lacking FnBPA-9 and FnBPA-10 (FnBRAD9,10) were immobilized on microtiter wells (1 lg in 100 lL) and ... Injection began at s and ended at 180 s Table Affinity parameters for NTD–FnBR interactions The parameters were determined by SPR measurements, with immobilized FnBRs of FnBPA and FnBPB as ligands and...
- 16
- 560
- 0
Báo cáo khoa học: Coordination of three and four Cu(I) to the a- and b-domain of vertebrate Zn-metallothionein-1, respectively, induces significant structural changes doc
... distorted chair The C-terminal a- domain is characterized by an adamantane-like four-metal cluster Solution structures of 113 Cd-substituted Cd7MT-2 from rabbit, rat and human are available and revealed ... (Tubingen, Germany), and all ¨ other chemicals were from Merck (Darmstadt, Germany) Synthesis of the individual a- and b- domains The individual a- and b-domains (KSCCSCCPVGCSKCA QGCVCKGAADKCTCCA and MDPNCSCSTGGSCTCT ... a high-resolution solution structure of the C-terminal a- domain has become available The data revealed a tertiary fold very similar to that of MT-1 and MT-2, except for a loop that contains an...
- 14
- 485
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ