a 3d oral cavity model and its use in haptics based virtual reality cavity preparation in endodontics
Báo cáo y học: " A multiscale mathematical model of cancer, and its use in analyzing irradiation therapies" ppt
... irradiation depends on cell cycle phase and that DNA damage is proportional to the radiation dose Anti-growth regulation signals such as hypoxia and overpopulation activate the SMAD/RAS and APC ... overpopulation and reproduce exponentially until late regulation because of hypoxia, through SMAD gene activation Finally, according to the model parameters, APC and SMAD/RAS Page of 19 (page number ... of S phase) DNA damage can also activate the p53 pathway, which leads cells to the apoptotic phase Cells at the end of the apoptotic phase die and disappear from the computational domain where...
- 19
- 315
- 0
A word image coding technique and its applications in information retrieval from imaged documents
... words than in normal ones Chaudhuri and Garain conducted a statistical study on the relative abundance and importance of italic, bold and all-capital words in 6,000 document pages ranging from ... understand the relationships among these text areas, and then convert them to a machine-readable format using OCR, in which each character object is assigned to a certain class The main question that ... diverse application areas In an attempt to move towards a more paperless office, large quantities of printed documents are digitized and stored as images in databases [D98] As a matter of fact, many...
- 98
- 363
- 0
Just noticeable distortion model and its application in image processing
... luminance adaptation and contrast masking In [46], the maximum effect between luminance adaptation and contrast masking is used for JND estimation, while in [37], luminance adaptation is regarded ... regarded as the major factor affecting JND The contributions of luminance adaptation and contrast masking are accumulated in [47] for a more general pixel -based JND model In a subband domain, 22 spatial ... models are of particular interest because CSF can be more easily incorporated in subband and more images are coded in a subband scenario A typical subband -based JND model consists of a base threshold...
- 111
- 311
- 0
EVALUATION OF THE LEAN APPROACH TO BUSINESS MANAGEMENT AND ITS USE IN THE PUBLIC SECTOR
... across an organisation of a few hundred people mainly in one physical location and trying to the same in an organisation with thousands of staff spread across a wide geographical area One case study ... of organization and predominantly based in Scotland1 (see table 1.1) This achieved a suitable mix of: A key observation at this stage was that many improvement initiatives had not used Lean concepts, ... that led to failed implementation of changes as well as factors that support sustainability • Chapter 6, Contextual Factors and Organisational Strategy, evaluates both the internal and external...
- 145
- 567
- 0
Báo cáo sinh học: "The use of retroviral vectors for gene therapy-what are the risks? A review of retroviral pathogenesis and its relevance to retroviral vector-mediated gene delivery" pptx
... pathogenic and have been shown to be the causative agent of several slow progressive diseases in animals including arthritis and encephalitis in goats, leukemia in cattle, anaemia in horses, and immunodeficiency ... and BLV and related viruses form a separate class of complex retroviruses that cause leukemia in a small percentage of infected individuals after very long latency periods Retroviruses have also ... equine infectious anemia virus (EIAV) [58] and maedi/visna virus (MVV) [59] For CAEV and MMV viral infection of macrophages seems to induce an inflammatory response involving macrophages and...
- 13
- 498
- 0
A study on group discussion and its impacts on speaking ability of the non major students at the post elementary level in military science academy
... that using tasks in teaching is a popular method and using a variety of tasks in class gives teachers and learners positive results 2.2.2 Classification of task -based planning In the literature ... and within/online planning (during task performance) Pre-task planning is further categorized into rehearsal (learners repeat exactly what they planned) and strategic planning (learners prepare ... planning and its impact on task performance Much of the research in group work leading to oral presentation has come from research on task -based instruction and the use of strategic task planning...
- 77
- 890
- 5
A study of the vietnamese translation of english non finite clauses and its application in vietnamese and english translation
... more information to the main clauses - A non – finite clause may function as a separate subordinate Non – finite extending clauses cover both addition and variation clause, as in the examples: ... textual material in one language (Source language) by equivalent an infinitive, a present participle or a past participle and gerund material in another language (Target Language)” According to ... What are the implications on teaching, learning and – finite Clauses and Its Application in Vietnamese English translating non – finite clauses? Translation” 1.5 ORGANIZATION OF THE STUDY 1.2 AIMS...
- 13
- 1,030
- 3
Slide a study on group discussion and its impacts on speaking ability of the non major students at the post elementary level in military science academy
... presentations is really useful Group planning should be applied and encouraged in the classroom Further study: - Investigate in three areas: fluency, complexity and accuracy - Find out other factors ... Records: All the group discussions and the individual presentations from No planning group & Pre-planning group Group Data Analysis Language Related Episodes Form -based LREs (F - LREs) Lexis -based ... Mechanics -based LREs (M - LREs) Leadership move Individual Data Analysis Error - Free - Verb Forms (EFVF) - The percentage of accurately used verbs in terms of tense and subject-verb agreement...
- 15
- 798
- 0
Tài liệu The NULL Encryption Algorithm and Its Use With IPsec ppt
... document and the information contained herein is provided on an "AS IS" basis and THE INTERNET SOCIETY AND THE INTERNET ENGINEERING TASK FORCE DISCLAIMS ALL WARRANTIES, EXPRESS OR IMPLIED, INCLUDING ... TO ANY WARRANTY THAT THE USE OF THE INFORMATION HEREIN WILL NOT INFRINGE ANY RIGHTS OR ANY IMPLIED WARRANTIES OF MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE Glenn & Kent Standards Track ... algorithm) As stated in [ESP], while the use of encryption algorithms and authentication algorithms are optional in ESP, it is imperative that an ESP SA specifies the use of at least one cryptographically...
- 7
- 425
- 0
Tài liệu Báo cáo khoa học: A novel splice variant of occludin deleted in exon 9 and its role in cell apoptosis and invasion docx
... methylated DNA were: 5¢-AAGTAGGCGGAGTATCGAAC-3¢ (sense) and 5¢-GAAAAAACGCGATCCTACTT-3¢ (antisense) Primers for unmethylated DNA were: 5¢-GAAGTAGGTGGAGT ATTGAAT-3¢ (sense) and 5¢-CAAAAAAACACAATCCT ACTT-3¢ ... used were: 5¢-CAGCAATTGTCACACATCAAGAA-3¢ (sense) and 5¢-T-ACATGTAGGTATGAAGACATCGTC T-3¢ (antisense) for exon 9; 5¢-TCCCTGCTTCCTCTGGC GGA-3¢ (sense) and 5¢-AGCCATAGCCATAGCCACTTC C-3¢ (antisense) for ... 5¢-CGGTTCAGGTACTCAGT CATCCA-3¢ (antisense) for Bcl-2; and 5¢-ACGGGAGAT GACAATGGAGAAAT-3¢ (sense) and 5¢-CATGGGTAG CAGCTCCTTCTTC-3¢ (antisense) for Apaf-1 Total RNA was extracted from cultured cells using...
- 12
- 613
- 0
Báo cáo khoa học: Induction of raft-like domains by a myristoylated NAP-22 peptide and its Tyr mutant potx
... Cafiso DS (1999) Interactions controlling the membrane binding of basic protein domains: phenylalanine and the attachment of the myristoylated alanine-rich C-kinase substrate protein to interfaces ... (2003) Binding of NAP-22, a calmodulin-binding neuronal protein, to raft-like domains in model membranes Biochemistry 42, 4780– 4786 Maekawa S, Sato C, Kitajima K, Funatsu N, Kumanogoh H & Sokawa Y ... that there are N-terminal fragments of NAP-22 present in cells [2] Furthermore, a construct composed of the N-terminal segment of CAP-23 and containing 40 amino acids arranges in a punctate pattern...
- 12
- 369
- 0
Báo cáo khoa học: Molecular and functional characterization of a novel splice variant of ANKHD1 that lacks the KH domain and its role in cell survival and apoptosis docx
... sequence VBARP-L 1.9 VBARP-S 1.3 AACAATGCTGACTGATAGCGGAGGA (Forward) TAAGCTACTACGTAAAGAATATATC (Reverse) GATAAGGTACCTGCACTGACACGGATGAAAGC (Forward) CATATATTCTTTACGTAGTAGCTTA (Reverse) FEBS Journal 272 ... 5¢-GATAAGGTACCTGCACTGACACGGATG AAAGC-3¢ and reverse 5¢-CTAGACTCGAGCCTAAT TTATATTTGCTCCTTGTGC-3¢ b-Actin primers were designed as follows: forward 5¢-CTACAATGAGCTGCG TGT-3¢ and reverse 5¢-AAGGAAGGCTGGAAGAGT-3¢ ... National Laboratory for Oncogenes and Related Genes Shanghai Cancer Institute, Shanghai, China Smith RK, Carroll PM, Allard JD & Simon MA (2000) MASK, a large ankyrin repeat and KH domain-containing...
- 12
- 561
- 0
Báo cáo khoa học: The calpain 1–a-actinin interaction Resting complex between the calcium-dependant protease and its target in cytoskeleton doc
... fashion, and the C-terminal part (domains III–IV) of the 80 kDa subunit, are implicated in the interface linking calpain to skeletal muscle a- actinin Colocalization of microcalpain and a- actinin ... chosen as targets and their binding with calpain analysed by independent in vitro and in vivo approaches According to the presented results, Calp1 a- actinin interaction is independent of the cleavage ... a calpain binding site in the C-terminal domain of smooth muscle a- actinin Involvement of the C-terminal domain of ask in Calp1 binding In order to locate the region responsible for the binding...
- 9
- 334
- 0
Báo cáo Y học: Fluorescent analogs of UDP-glucose and their use in characterizing substrate binding by toxin A from Clostridium difficile pdf
... K & Acharya, K.R (2001) Structure of UDP complex of UDP-galactose: beta-galactoside-alpha-1,3-galactosyltransferase ˚ at 1.53 -A resolution reveals a conformational change in the catalytically ... particular These substrate analogs are related to the commercially available methylanthraniloyl (mant) derivatives of ATP and GTP commonly used in mechanistic studies of ATPases and GTPases Here, we report ... separate the substrate and products [11] This assay has been instrumental in studying the mechanism of glucosylhydrolase activity, but has several disadvantages, including the discontinuous nature...
- 8
- 516
- 0
A study on rhyming slang in English and its equivalents in Vietnamese.
... accepted as a standard language; for example, in English : Adam and Eve :Believe, Alligator :Later ,Andy Cain :Rain ,Apple pie: Sky, Auntie Nellie :Belly, in Vietnamese : xù : don't pay after eating ... Londoners having a "butcher's hook" at this site, but you might find a few having a "butcher's" Example: Adam and Eve :Believe Apples and pears :Stairs Barclays Bank : Wank (to masturbate) Barnet Fair ... arena, and some may even lose their slang status and become accepted as a standard language Often, the widespread adoption of a slang term by mainstream culture will cause the subculture it originated...
- 51
- 906
- 5
Báo cáo khoa học: Characterization of surface n -alkanes and fatty acids of the epiphytic lichen Xanthoria parietina, its photobiont a green alga Trebouxia sp., and its mycobiont, from the Jerusalem hills pot
... a very active lichen substance, is used in pharmaceutical preparations [48] The leaves of higher plants contain waxy alkanes and have been shown to be useful for protection against UV-B radiation, ... resins and is highly reactive, participating in the protection of wounded trees against microbial attacks [39] Dehydroabietic acid has been found in traditional Chinese medicines, and is used in ... hydrocarbons and fatty acids of X parietina, its photobiont and mycobiont collected from four different locations indicated the presence of 27 n-alkanes and six major fatty acids Quantitative data...
- 6
- 613
- 0
Báo cáo khoa học: "METONYMY: REASSESSMENT, SURVEY OF ACCEPTABILITY, AND ITS TREATMENT IN A MACHINE TRANSLATION SYSTEM S" ppt
... Metonymic interpretation and associative processes in natural language In Exxon has raised its price again Washington is insensitive to the needs of the people Language and Artificial Intelligence, Makoto ... Shin-ichiro and Wakao, Takahiro (1992) Metonymy: reassessment, survey of acceptability, and its treatment in a machine translation system Locating 1.1 Container for Content Dave drank the glasses The ... details, Kamei and Wakao 1992) Based on both intuitive analyses and the result of the survey, we have esta, blished four major patterns, and several sub-groups for the first pattern (Locating) as...
- 3
- 453
- 0
Astrology, Psychology, and The Four Elements An Energy Approach to Astrology & Its Use in the Counseling Arts_1 pptx
... logical result) of the analytical approach,which may be said to be aiming at a maximum of abstraction with a minimum of meaning And it is meaning that man needs; and an understanding of man's ... understanding and the significance of individual human values and goals is outside its domain astrology's gift to mankind is its capacity to solve and explain that which science cannot and does ... is in fact an accurate way of categorizing people and of gaining perspectiue on inter-personal relationships), they naturally fall back on other, less-accurateways ofcategorizing and evaluating...
- 40
- 539
- 1
Astrology, Psychology, and The Four Elements An Energy Approach to Astrology & Its Use in the Counseling Arts_2 pdf
... Mars in fire uses power and initiative, Mars in earth uses patience and efficiency, and Mars in water use slyness,intuition, and a rather unconquerable persistence A brother of mine, for example, ... things as they are or as they appear to be This can lead to a narrowness ofoutlook, an addiction to routine and order, and a total lack ofability to deal with the abstract and theoretical realms ... combine intellectual and conceptual awareness with a practical attunement to concrete objectives He can therefore have a practical grounding upon which his ideas are based and a particularly innovative...
- 59
- 521
- 2
A BRIEF REVIEW OF CREATIVE ACCOUNTING LITERATURE AND ITS CONSEQUENCES IN PRACTICE pptx
... Great Britain has initially led to enterprise collapses and financial scandals As a result of these (Coloroll and Polly Peak, etc ) and of the lack of trust in the financial reporting of several ... a relevant value (according to the same authors) The reporting based on FVA draw the shareholders’ attention on the capital value and streamline the administrative function The managers are asked ... (1988) A practical guide to creative accounting, Kogan Page 21 MacBarnet, D and C Whelan (1997) Regulatory Arbitrage through Financial Innovation, Accounting, Auditing & Accountability Journal 10.1:...
- 14
- 693
- 1
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25