0

a 1 trigonometry and complex numbers

Báo cáo toán học:

Báo cáo toán học: "Minimum rank of matrices described by a graph or pattern over the rational, real and complex numbers" doc

Báo cáo khoa học

... graph is G2 Thus, A has the form (1) where D and E are diagonal matrices, and B has pattern CS2 We claim that if A is real (respectively rational), then rank A ≥ 16 (respectively, rank A ≥ 18 ) ... and E are diagonal matrices, and B has pattern CS1 We claim that if A is complex (respectively real), then rank (A) ≥ 12 (respectively, rank (A) ≥ 14 ) the electronic journal of combinatorics 15 ... [AHKLR] M Arav, F Hall, S Koyucu, Z Li and B Rao On Rational Realizations of the Minimums Rank of a Sign Pattern Matrix Linear Alg Appls., 2005, 409 :11 12 5 [BFH] F Barioli, S.M Fallat, and L Hogben...
  • 19
  • 238
  • 0
Báo cáo khoa học: The calpain 1–a-actinin interaction Resting complex between the calcium-dependant protease and its target in cytoskeleton doc

Báo cáo khoa học: The calpain 1–a-actinin interaction Resting complex between the calcium-dependant protease and its target in cytoskeleton doc

Báo cáo khoa học

... a- Actinin–Calp1 interactions (A) Solid phase immunoassay (ELISA) between coated Calp1 (j) or coated 10 min-autolysed Calp1 (h) and increasing ask concentrations or between coated ask and increasing Calp1 ... Anim Sci 73, 13 51 13 67 46 Sorimachi, H., Kinbara, K., Kimura, S., Takahashi, M., Ishiura, S., Sasagawa, N., Sorimachi, N., Shimada, H., Tagawa, K & Maruyama, K (19 95) Muscle-specific calpain, p94, ... proteinases (l-calpain and m-calpain) J Biol Chem 264, 10 096 10 103 34 Papa, I., Astier, C., Kwiatek, O., Raynaud, F., Bonnal, C., Lebart, M.C., Roustan, C & Benyamin, Y (19 99) a) Actinin-CapZ, an anchoring...
  • 9
  • 334
  • 0
Unit 8 Out and About A 1 -A 3

Unit 8 Out and About A 1 -A 3

Tiếng anh

... book Ask and answer What is she doing? She is driving her car Ask and answer What are they doing? They are driving a car Ask and answer What is he doing? He is riding his motorbike Ask and answer ... What are they doing? They are ing… What are you doing? I am ing… What is he doing? He is driving his car Thur.Dec 2nd, 2 010 Lesson 1: What are you doing? (A1 -3) Team A Team B start 10 What are ... S + am / is / are Note: play Ride/ Drive/ have + V _ing playing Riding/ Driving/ having Thur.Dec 2nd, 2 010 Lesson 1: What are you doing? (A1 -3) Listen and repeat 1 Listen and read I am playing...
  • 46
  • 477
  • 0
iec 60298 a.c. metal-enclosed switchgear and controlgear for rated voltages above 1 kv and up to

iec 60298 a.c. metal-enclosed switchgear and controlgear for rated voltages above 1 kv and up to

Điện - Điện tử

... table Annexes AA to GG are normative The following I E C ptrblications are qtroted in this standard: 50 (15 1) (19 78): International Electrotechnical Vocabulary (IEV), Chapter 15 1 : Electrical and ... switchgear and controlgear one or more non-metal1ic.partition.s); 3 .10 2 .1 Metal-clad switchgear and controlgear Metal-enclosed switchgear and controlgear inwhich components are arranged in separate ... metal-enclosed switchgear and controlgear and replaced, even though the main circuit is alive (IEV 4 41- 13-08) 3 .11 3 Withdrawable part A removable part of metal-enclosed switchgear and controlgear...
  • 139
  • 465
  • 0
Tài liệu GLOBAL PHYLOGEOGRAPHY OF A CRYPTIC COPEPOD SPECIES COMPLEX AND REPRODUCTIVE ISOLATION BETWEEN GENETICALLY PROXIMATE ‘‘POPULATIONS’’ ppt

Tài liệu GLOBAL PHYLOGEOGRAPHY OF A CRYPTIC COPEPOD SPECIES COMPLEX AND REPRODUCTIVE ISOLATION BETWEEN GENETICALLY PROXIMATE ‘‘POPULATIONS’’ ppt

Sức khỏe phụ nữ

... TAAACTTCAGGGTGACCAAAAAATCA 3Ј) and COIL 14 90 (5Ј GGTCAACAAATCATAAAGATATTGG 3Ј; Folmer et al 19 94) were used to obtain sequences from COI Primer pairs 16 SA2 (5Ј CCGGGT C/T TCGCTAAGGTAG) and 16 SB2 (5Ј CAACATCGAGGTCGCAGTAA) ... proteinase K (Hoelzel and Green 19 92) Polymerase chain reaction (PCR) primers 16 Sar 2 510 and 16 Sbr 3080 were used to amplify sequences from 16 S rRNA, and primers COIH 219 8 (5Ј TAAACTTCAGGGTGACCAAAAAATCA ... BC, Canada; (27) Ishikari River, Japan; (28) Lake Baratoka, Japan; (29) Lake Ohnuma, Japan; (30) Lake Akanko, Japan; ( 31) Caspian Sea; (32) Gulf of Bothnia; (33) Gulf of Finland; (34) Sallvik...
  • 14
  • 491
  • 0
Tài liệu Báo cáo khoa học: Mutational analysis of plasminogen activator inhibitor-1 Interactions of a-helix F and its neighbouring structural elements regulates the activity and the rate of latency transition pdf

Tài liệu Báo cáo khoa học: Mutational analysis of plasminogen activator inhibitor-1 Interactions of a-helix F and its neighbouring structural elements regulates the activity and the rate of latency transition pdf

Báo cáo khoa học

... indistinguishable results: wild-type, PAI -1( T9 6A) , PAI1(F10 0A) , PAI -1( V12 6A) , PAI -1( F12 8A) , PAI -1( I13 7A) , PAI -1( I13 8A) , PAI -1( N13 9A) , PAI -1( W14 1A) , PAI1(T14 6A) and PAI -1( M149K) Structural analysis ... least three independent measurements are given for each variant PAI -1 variant Activity (%) t½ (min) Wild-type T9 6A F10 0A V12 6A F12 8A S12 9A E13 0A V13 1A E13 2A R13 3A R13 5A F13 6A I13 7A I13 8A N13 9A ... I13 8A N13 9A D14 0A W14 1A V14 2A K14 3A T14 4A H14 5A T14 6A K14 7A M14 9A N15 2A E28 3A E28 5A K32 5A K32 7A PAI-1stab PAI-1stab(E28 5A) 74 91 80 59 74 51 90 57 88 18 52 63 32 88 77 75 87 10 13 33 97 82 69...
  • 9
  • 605
  • 0
Tài liệu Báo cáo khoa học: Purification and characterization of a membrane-bound enzyme complex from the sulfate-reducing archaeon Archaeoglobus fulgidus related to heterodisulfide reductase from methanogenic archaea pdf

Tài liệu Báo cáo khoa học: Purification and characterization of a membrane-bound enzyme complex from the sulfate-reducing archaeon Archaeoglobus fulgidus related to heterodisulfide reductase from methanogenic archaea pdf

Báo cáo khoa học

... enzyme At potentials higher than mV, an unusual paramagnetic species was detected with g values at 2.0 31, 1. 994, and 1. 9 51 The resonance started to develop at potentials ‡ mV and was stable at potentials ... arrow indicates the absorption maximum of the a band at 557 nm absorption maxima at 420 nm (c band), 530 nm (b band) and 557 nm (a band) are characteristic of cytochrome b Heme was extracted from ... content) Gene AF502 AF5 01 AF499 AF503 AF500 Apparent/calculated molecular mass Transmembrane helices Cofactor binding sites 53/64.4 kDa 34/38 kDa 31/ 30.5 kDa 16 /16 .7 kDa – /43 kDa None 2[4Fe-4S],...
  • 10
  • 564
  • 0
Tài liệu Báo cáo Y học: Use of site-specific recombination as a probe of nucleoprotein complex formation in chromatin Micha Schwikardi and Peter Droge ¨ potx

Tài liệu Báo cáo Y học: Use of site-specific recombination as a probe of nucleoprotein complex formation in chromatin Micha Schwikardi and Peter Droge ¨ potx

Báo cáo khoa học

... for a phage l integrase mutant was set as 10 0% In each case, data were collected from six separate transfection assays, each employing two wells containing about  10 5 cells (C) Normalized b-Gal ... ng:mL 21) was added weeks prior to electroporation b-Galactosidase (b-gal) assays, Southern blotting and PCR b-Gal assays and Southern blotting were performed as described previously [10 ,17 ] The ... interaction between dimers bound at accessory sites II and III, and the catalytically active ones at paired sites I that is required to trigger strand exchange is indicated by arrows Recombination...
  • 7
  • 472
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "A Uniform Treatment of Pragmatic Inferences in Simple and Complex Utterances and Sequences of Utterances" pot

Báo cáo khoa học

... a logical framework that handles defaults (Reiter, 19 80), but this approach is not tractable and it treats natural disjunction as an exclusiveor and implication as logical equivalence Computational ... be cancelled We are not aware of any formalism or computational approach that offers a unified explanation for the cancellability of pragmatic inferences in general, and of no approach that handles ... C.K and Dinneen D .A, editors, Synta~ and Semantics, Presupposition, volume 11 , pages 15 5 -18 2 Academic Press H Zeevat 19 92 Presupposition and accommodation in update semantics Journal of Semantics,...
  • 7
  • 418
  • 1
Báo cáo khoa học: a-1 Antitrypsin binds preprohepcidin intracellularly and prohepcidin in the serum pdf

Báo cáo khoa học: a-1 Antitrypsin binds preprohepcidin intracellularly and prohepcidin in the serum pdf

Báo cáo khoa học

... were as follows: b-actin sense, 5¢-AG AAAATCTGGCACCACACC-3¢; antisense, 5¢-GGGGTG TTGAAGGTCTCAAA-3¢; preprohepcidin sense, 5¢-CAG CTGGATGCCCATGTT-3¢; antisense, 5¢-TGCAGCACAT CCCACACT-3¢; A1 AT ... were carried out with anti -A1 AT IgG (A) A1 AT expressing BL 21 total lysate was used as positive control (a) Interaction of A1 AT expressing BL 21 lysate and GST-coated Glutathione– Sepharose beads ... the latter case, two major peaks appeared in the spectrum, at m ⁄ z 14 10.96 and 6349 .12 The peak at m ⁄ z 14 10.96 corresponds to a fragment of 6· His and 2 016 B C Fig Identification of A1 AT–prohepcidin...
  • 10
  • 678
  • 0
Báo cáo khoa học: The twin-arginine translocation (Tat) systems from Bacillus subtilis display a conserved mode of complex organization and similar substrate recognition requirements doc

Báo cáo khoa học: The twin-arginine translocation (Tat) systems from Bacillus subtilis display a conserved mode of complex organization and similar substrate recognition requirements doc

Báo cáo khoa học

... GTGAGTCGCAAAGGTTTGGTAAAAACG) and RKDmsAR (CGTTTTTACCAAACCTTTGCGACTCACCTC AGCAGC) for RK mutation; and KRtoKKDmsAF (GCTGAGGTGAGTAAAAAGGGTTTGGTAAAAACG ACAGCG) and KRtoKKDmsAR (CGCTGTCGTTT TTACCAAACCCTTTTTACTCACCTCAGC) ... GAATTCACCATTATGAGCACTTTTA) and PCR_AmiA_EcoRI_rev (GGCCGAATTCGCTGTGTCCGTTGCTG GTT) for AmiA, and PCR_MdoD_EcoRI_for (GGCCGA ATTCACCATTATGGATCGTAGAC) and PCR_MdoD_EcoRI rev (GGCCCAATTCGTCAAAACGCTGGGTT ... bacteria Table Bacterial strains and plasmids used in this study Plasmids pBAD-ABC pBAdCd pBAyCy pBAD–DmsA–GFP pBAD–DmsA–GFP L1 9A pBAD–DmsA–GFP L19D pBAD–DmsA–GFP L19F pBAD–DmsA–GFP S1 5A pBAD–DmsA–GFP...
  • 12
  • 445
  • 0
Báo cáo khoa học: Complexes of Thermoactinomyces vulgaris R-47 a-amylase 1 and pullulan model oligossacharides provide new insight into the mechanism for recognizing substrates with a-(1,6) glycosidic linkages docx

Báo cáo khoa học: Complexes of Thermoactinomyces vulgaris R-47 a-amylase 1 and pullulan model oligossacharides provide new insight into the mechanism for recognizing substrates with a-(1,6) glycosidic linkages docx

Báo cáo khoa học

... Minamiura N & Imanaka T (19 92) Action of neopullulanase Neopullulanase catalyzes both hydrolysis and transglycosylation at a- (1 fi 4)- and a- (1 fi 6)-glucosidic linkages J Biol Chem 267, 18 447 18 452 11 ... 12 3, 275–282 Kamitori S, Abe A, Ohtaki A, Kaji A, Tonozuka T & Sakano Y (2002) Crystal structures of Thermoactino˚ myces vulgaris R-47 a- amylase (TVA I) at 1. 6 A reso˚ resolution lution and a- amylase ... vulgaris R-47 Biochem Biophys Acta 12 52, 35–42 Ibuka A, Tonozuka T, Matsuzawa H & Sakai H (19 98) Conversion of neopullulanase -a- amylase from Thermoactinomyces vulgaris R-47 into an amylopullulanase-type...
  • 9
  • 342
  • 0
Báo cáo khoa học: A (1fi3)-b-D-glucan recognition protein from the sponge Suberites domuncula Mediated activation of fibrinogen-like protein and epidermal growth factor gene expression pot

Báo cáo khoa học: A (1fi3)-b-D-glucan recognition protein from the sponge Suberites domuncula Mediated activation of fibrinogen-like protein and epidermal growth factor gene expression pot

Báo cáo khoa học

... (TENA_HUMAN; P248 21 – and – TENAl_HUMAN; dJ 114 1O19 .1) , fish Danio rerio (TENAC_DARE; CAA 614 89 .1) , and pig (TENA_PIG; Q2 911 6 – and – TENAX_PIG; CAA60686 .1) , as well as the the microfibril-associated glycoprotein ... Litopenaeus stylirostris (GLUBP_LITSTY, AF473579 -1) , the putative Gram-negative bacteria-binding proteins from the Diptera Anopheles gambiae (ENSAN1_ANGA, XP_ 312 118 .1) , (ENSAN5_ANGA, XP_ 312 116 .1) and ... (19 97) Molecular immune responses of the mosquito Anopheles gambiae to bacteria and malaria parasites Proc Natl Acad Sci USA 94, 11 508 11 513 19 Bachman, E.S & McClay, D.R (19 96) Molecular cloning...
  • 14
  • 299
  • 0
Complex Numbers from A to Z - BÀI TẬP SỐ PHỨC(98 VÍ DỤ VÀ BÀI TẬP CÓ LỜI GIẢI) ppt

Complex Numbers from A to Z - BÀI TẬP SỐ PHỨC(98 VÍ DỤ VÀ BÀI TẬP CÓ LỜI GIẢI) ppt

Cao đẳng - Đại học

... chất (4), Lê Lễ Page 11 Bài tập số phức z1 z1 z1 | z1 |2 1, z1 Tương tự, z2 , đặt số A, z2 z1 z2 1 z1 z2 z1 z2 z1 z2 A z1 z2 z1 z2 A Vậy A số thực Bài tập Cho a số thực dương đặt | a z Tìm giá ... [cos(t1 t2 ) i sin(t1 t2 )] a) b) c) d) Lưu ý Một lần ta lại | z1 z2 | | z1 || z2 | arg( z1 z2 ) argz1 argz2 2k , 0, argz1 argz2 k 1, argz1 argz2 Có thể viết A rg( z1 z2 ) {argz1 argz2 2k , k Z ... tập 11 Viết số phức sau dạng cực z cos a i sin a, a (0,2 ) Lời giải a a | z | (1 cos a) 2 sin a 2 (1 cos a) 4cos 2 | cos | 2 a (0, ) , P nằm góc phần tư thứ Do a) Nếu a (0, ) 2 sin a a a arctan...
  • 54
  • 923
  • 1
Báo cáo khoa học: C-terminal truncated cannabinoid receptor 1 coexpressed with G protein trimer in Sf9 cells exists in a precoupled state and shows constitutive activity ppt

Báo cáo khoa học: C-terminal truncated cannabinoid receptor 1 coexpressed with G protein trimer in Sf9 cells exists in a precoupled state and shows constitutive activity ppt

Báo cáo khoa học

... 20 15 10 30 20 10 0 0.5x104 1x104 1. 5x104 2.0x104 2.5x104 [SR 14 1 71 6A] 0.2x104 0.6x104 1. 0x104 1. 4x104 [SR 14 1 71 6A] Fig Saturation binding curves of full-length and truncated CB1 One microgram ... 17 –22 Rinaldi-Carmona M, Barth F, Heaulme M, Shire D, Calandra B, Congy C, Martinez S, Maruani J, Neliat G & Caput D (19 94) SR1 417 1 6A, a potent and selective antagonist of the brain cannabinoid ... receptor-mediated signal transduction Nature 14 2, 12 09 12 18 18 Bouaboula M, Perrachon S, Milligan L, Canat X, Rinaldi-Carmona M, Portier M, Barth F, Calandra B, Pecceu F, Lupker J, et al (19 97) A selective...
  • 10
  • 313
  • 0
Báo cáo khoa học: Peroxin Pex21p interacts with the C-terminal noncatalytic domain of yeast seryl-tRNA synthetase and forms a specific ternary complex with tRNASer potx

Báo cáo khoa học: Peroxin Pex21p interacts with the C-terminal noncatalytic domain of yeast seryl-tRNA synthetase and forms a specific ternary complex with tRNASer potx

Báo cáo khoa học

... domain appended to plant methionyl-tRNA synthetase acts as a cis-acting cofactor for aminoacylation EMBO J 19 , 6908–6 917 38 Kaminska M, Shalak V & Mirande M (20 01) The appended C-domain of human ... and Pex21p with total yeast tRNA, as indicated by the occurrence of a supershifted band of the same intensity and mobility (Fig 1, lane 6) A supershifted band denoting a ternary complex was also ... were scanned using a phosphorimager and analyzed by IMAGEQUANT software The data were fitted to a single-site binding equation Interaction between SerRS and Pex21p available SerRS proteins, and on...
  • 12
  • 406
  • 0
Báo cáo khoa học: HIV-1 gp41 and gp160 are hyperthermostable proteins in a mesophilic environment ppt

Báo cáo khoa học: HIV-1 gp41 and gp160 are hyperthermostable proteins in a mesophilic environment ppt

Báo cáo khoa học

... DHvH/DHcal Reversibility (%) NC1 NC2 CN1 CN2 CN3 A3 0-D78_N 113 -K154 A3 0-K77_W 117 -K154 W 117 -K154 _A3 0-K77 W 117 -A1 56 _A3 0-K77 W 117 -W159 _A3 0-K77 91. 0 86.5 10 1.9 10 6.8 11 2.5 10 3 84 59 81 140 17 6 234 14 0 ... N-g/N -a/ N-d N-d/N-d/C -a L/L/L N-f/C -a/ C -a/ C-e 11 0.4 11 2.6 97.8 92.8 96.0 10 5.3 10 5.5 10 8 .1 106.6 10 5.6 11 9 .1 106.2 10 8.0 71. 7 61 40 36 36 33 69 90 56 61 55 77 91 13 228 215 15 9 36 15 9 12 7 17 2 300 ... (kcalÆmol )1) DHvH/DHcal Reversibility (%) Native T58I I124S I124Da – N-d C -a C -a Q64E/Q66E C87S/C93S E14 3A/ K14 4A K14 4A/ E14 8A Q4 0A/ Q4 1A/ Q5 1A Q51I/T58I/I124D L91K/I92K/W103D W6OA/I124D/I131D/Q142N N-c/N-e...
  • 14
  • 375
  • 0
Complex numbers from A to Z

Complex numbers from A to Z

Toán học

... 89 89 96 10 0 10 3 10 6 11 0 11 0 11 2 11 3 11 4 11 5 11 5 11 7 11 9 12 5 12 5 13 2 13 6 14 0 14 8 15 1 15 1 15 2 15 2 15 3 15 3 15 5 15 8 16 0 16 1 16 1 17 7 18 1 19 0 214 220 viii Contents 5.7 5.8 ... Titu is past chairman of the USA Mathematical Olympiad, served as director of the MAA American Mathematics Competitions (19 98–2003), coach of the USA International Mathematical Olympiad Team (IMO) ... Romanian Committee for the Mathematics Olympiad and member of editorial boards of several international journals Dorin has been a regular faculty member at the Canada–USA Mathcamps since 2001...
  • 336
  • 389
  • 3
Báo cáo sinh học:

Báo cáo sinh học: " Oligomerization of the human immunodeficiency virus type 1 (HIV-1) Vpu protein – a genetic, biochemical and biophysical analysis" ppt

Hóa học - Dầu khí

... CATGGAGATGCAACCTATAATAGTAGCAATAGTAGCATT AGTAGTAGCAATAATAATAGCAATAGCTGTGTGGTCCATAGTAATCATAGAATAGG and NL-TM-R, AATTCCTATTCTATGATTACTATGGACCACACAGCTATT GCTATTATTATTGCTACTACTAATGCTACTATTGCTACTATTATAGGTTGCATCTC; ... GAATTCATGCAACCTATAATAGTAGCAATA and NL-R-GFP, GGATCCGCG CAGATCATCAATATCC; for R5 vpu, R5-X-F, GAATTCATGTTAAATTTAG ATTATAAATTAGGAGTAGG and R5-R-GFP, GGATCCTGCCAAATCATT AACATCCAAAA For colocalization ... GCTATTATTATTGCTACTACTAATGCTACTATTGCTACTATTATAGGTTGCATCTC; for the R5 vpu TM region, R5TM-F, CATGGAGATGTTAAATTTAGATTATAAATTAGGAGTAGG AGCATTGATAGTAGCACTAATCATAGCAATAGTCGTGTGGACCATAGTATATATAGAATAGG and R5-TM-R, AATT CCTATTCTATATATACTATGGTCCACACGACTATTGCTATGATTAGTGCTA...
  • 11
  • 436
  • 0

Xem thêm