... http://www.jneuroinflammation.com/content /1/ 1 /15 Iwatsubo T, Odaka , Suzuki N, Mizusawa H, Nukina N, Ihara Y: Visualization of A 42 (43 ) andA 40 in senile plaques with endspecific Af3 monoclonals: Evidence that ... promote aggregation of physiological concentration of β-amyloid peptide J Neurochem 19 93, 61: 117 1 -11 74 Page of (page number not for citation purposes) Journal of Neuroinflammation 20 04, 1: 15 13 14 ... Neuroinflammation 20 04, 1: 15 http://www.jneuroinflammation.com/content /1/ 1 /15 Table 1: Effects of native apolipoprotein E isoforms on fibrillogenesis of A 1- 40 andA 1- 42 Fold-effects represent means...
... hay người khác từ đâu đến John Marie USA France Yoko Japan Lee China Minh Vietnam Name Country Nationality Language Minh Viet Nam Vietnamese Vietnamese Yoko Japan Japanese Japanese Lee China ... Chinese Bruce Australia Australian English Susan Laura Great Britain British Canadian Canada English English & French My name’s Minh Minh is from Viet Nam I’m from Viet Nam I speak Vietnamese Bruce ... Vietnam Viet nam Australia Úc France Pháp China Trung Quốc USA Mỹ Japan Nhật Britain Canada Anh Where is Laura from? are you She’s from Canada Laura Vietnam I’m Form: Where + be...
... Geography - Physical Education Unit : At school Lesson : A Schedules ( 1, 2,3) 3, Listen and write Complete the schedule Friday 8 .40 7.00 Geography 10 .30 Physics Saturday 2 .40 Physical Education 4. 30 ... five past nine Unit : At school Lesson : A Schedules ( 1, 2,3) Listen and repeat: Unit : At school Lesson : A Schedules ( 1, 2,3) Listen and repeat: Unit : At school Lesson : A Schedules ( 1, 2,3) ... At school Lesson : A Schedules ( 1, 2,3) 3, Listen and write Complete the schedule 7.00 English 7.50 Geography Friday 8 .40 Music 9 .40 10 .30 Physics History Saturday 1. 00 Physical Education 2 .40 ...
... UNIT4: BIG OR SMALL? Lesson1: A1 ,2- Where is your school? This is Hoa This is her living room This is Hoa’s living room UNIT4: BIG OR SMALL? Lesson1: A1 ,2- Where is your school? III- grammar ... Unit 4: Lesson 1: A1 -2 Matching: A. Phong’s school B.Thu’s school 1. small 2.big 3.in the country 4. in the city A2 Answer Then write the answers in your exercise book a) Is Phong’s school small? ... S C H O O L Unit 4: Big or small? Lesson A1 -2- Where is your school? UNIT4: BIG OR SMALL? Lesson1: A1 ,2- Where is your school? I- New words - Small (adj): -> nhỏ, bé - Country (n):...
... SECTION; A1 ,2,3 *UNIT : MY SCHOOL SUBJECTS – SECTION Answer Keys: 1) I 2) I 3) I What subjects you have? have English and Vietnamese What subjects you have today? have Maths and Science What subjects ... you have? have Informatics and Art 3 * UNIT : MY SCHOOL SUBJECTS - SECTION; A1 ,2,3 *UNIT : MY SCHOOL SUBJECTS – SECTION Let’ s talk What subjects you have today? What subjects you have today? ... SUBJECTS - SECTION; A1 ,2,3 *UNIT : MY SCHOOL SUBJECTS – SECTION Look and say What subjects you have today? I have Maths Science Informatics Art * UNIT : MY SCHOOL SUBJECTS - SECTION; A1 ,2,3 *UNIT :...
... Warm Up:Noughts and crosses 1 13 15 16 2+7 9:3 8x2 20 4x2 3+8 9 0 0 0 0 X X X X X X X X X Friday,November12 th 2 010 UNIT : MY SCHOOL SUBJECTS SECTION A1 ,2,3 1 Listen and repeat 1. Look,listen and ... Vietnames e Maths Science Informatics 1. Look, listen and repeat Nam: Do you have Maths today? Mai: No, I dont Nam: What subjects you have? Mai: I have Vietnamese and English Model sentences: What subjects ... repeat Listen and repeat Let s talk 2.Look and say Lets talk Listen and repeat Let s talk Friday,November12 th 2 010 UNIT : MY SCHOOL SUBJECTS NEWWORDS SECTION A 1, 2,3 -subject :mụn hc -have :hc...
... theo mẫu x 12 5 + x 12 12 5 + 12 = 13 7 30 12 5 + 30 = 15 5 10 0 12 5 + 10 0 = 225 -HS đọc yêu cầu làm vào nháp - GV nhận xét ch a *Bài 3: Tính giá trị biểu thức a) Tính giá trị biểu thức 14 0 + p với: ... m = 19 0; m = 10 ; m = 70; m = - HS đọc yêu cầu vào - Đại diện nhóm trình bày, nhận xét - GV nhận xét chốt lời giải Kết quả: a) Nếu p = 14 0 + p = 14 0 + = 14 0 Nếu p = 20 14 0 + p = 14 0 + 20 = 16 0 ... 14 0 + p = 14 0 + 20 = 16 0 Nếu p = 50 14 0 + p = 14 0 + 50 = 19 0 Nếu p = 80 14 0 + p = 14 0 + 80 = 220 b) Nếu m = 19 0 673 m = 673 19 0 = 583 Nếu m= 10 673 m = 673 10 = 663 Nếu m= 70 673 m = 673 70...
... ? - 'd like Nam Lan Hoa Tuan Unit 10 : Lesson 1: A1 -4/ p .10 4 -10 6 *Practice: Ask and answer about Nam, Lan, Ba: S1: How does Lan feel? S2: She feels hot and thirsty S1: What would she like? ... A1 -4/ p .10 4 -10 6 Listen and repeat What would you like ? Unit 10 : Lesson 1: A1 -4/ p .10 4 -10 6 Listen and repeat What would you like ? Nam: How you feel? Lan: I’m …… and ……… thirsty hot Nam: What would ... 1: A1 -4/ p .10 4 -10 6 Free talk Eg: S1: Are you thirsty? S2: No, I am not S3: Are you cold? S2: No, I am not S4: How you feel? S2: I’ m hungry Unit 10 : Lesson 1: A1 -4/ p .10 4 -10 6 Listen and repeat...
... (to) want: muèn Wednesday, January 19 th 2 011 Unit 10 : A. 1- 4 (P .10 4 -10 6) Listen and repeat What would you like ? Wednesday, January 19 th 2 011 Unit 10 : A. 1- 4 (P .10 4 -10 6) Listen and repeat What would ... like Nam Lan Hoa Ba Tuan Wednesday, January 19 th 2 011 Unit 10 : A. 1- 4 (P .10 4 -10 6) Ask and answer about Nam, Lan, Ba: S1: How does Lan feel? S2: She feels hot and thirsty S1: What would she like? ... Lesson 1: A1 -4/ p .10 4 -10 6 Unit 10 : *Practice: A. 1- 4 (P .10 4 -10 6) Wednesday, January 19 th 2 011 Make dialogues, using pictures - How does feel ? - is - What would like ? - 'd like Nam Lan Hoa...
... õua I/Vocabulary: Win the prize(v): oaỷt giaới I/Vocabulary: -Take part in(v): Tham gia -Surprising(Adj): a ng ngaỷc nhión Vocabulary: - Skate boarding(n) : - Roller- Mọn trổồỹt vaùn Trổồỹt patin ... a/ What is the most popular sport in the USA? - Baseball b/ Which sport in at 11 th position? - Table tennis SPORT (Sport Baseball Skateboarding Roller-skating Rollerblading Basketball Football ... boarding(n) : Mọn trổồỹt vaùn I/Vocabulary: Roller skating(n) : Mọn trổồỹt patin I/Vocabulary: Baseball(n): Boùng chaỡy I/Vocabulary: Table tennis(n): Boùng baỡn START I/Vocabulary: Competition(n):...
... NL4-3 vpu TM region, NL-TM-F, CATGGAGATGCAACCTATAATAGTAGCAATAGTAGCATT AGTAGTAGCAATAATAATAGCAATAGCTGTGTGGTCCATAGTAATCATAGAATAGG and NL-TM-R, AATTCCTATTCTATGATTACTATGGACCACACAGCTATT GCTATTATTATTGCTACTACTAATGCTACTATTGCTACTATTATAGGTTGCATCTC; ... GCTATTATTATTGCTACTACTAATGCTACTATTGCTACTATTATAGGTTGCATCTC; for the R5 vpu TM region, R5TM-F, CATGGAGATGTTAAATTTAGATTATAAATTAGGAGTAGG AGCATTGATAGTAGCACTAATCATAGCAATAGTCGTGTGGACCATAGTATATATAGAATAGG and R5-TM-R, ... GAATTCACTACAGATCATCAATATCCCAAG; for the R5 vpu gene, Vpu-R5-F, GGATCCATGTTAAATTTAGATTATAAATTAGGAGTA GG and Vpu-R5-R, GAATTCATTACAAATCATTAACATCCAAAAGCC The amplified fragments designated as NL vpu and R5...
... ba bánh, máy kéo có trọng tải đến 10 00 kg tập lái phải gắn 02 biển xe "TẬP LÁI" làm kim loại xanh, chữ màu trắng ph a trước ph a sau với kích thước: 15 cm x 20cm mô tô, 20cm x 25cm máy kéo 14 ... tạo hạng A1 , A2 , A3 A4 : 1. 000m2 Quyết định số 55/2007/QĐBGTV Nội dung c) Mặt sân có cao độ hệ thống thoát nước bảo đảm không bị ngập nước; đường hình tập lái sân phải có mặt trải nh a bê tông, ... loại xanh, chữ màu trắng gắn chắn cản ph a trước ph a sau bên trái Biển có kích thước chung 10 cm x 25cm hạng xe, riêng biển sau kích thước 35cm x 35cm xe hạng C, D, E, F gắn vị trí thành sau không...
... ba bánh, máy kéo có trọng tải đến 10 00 kg tập lái phải gắn 02 biển xe "TẬP LÁI" làm kim loại xanh, chữ màu trắng ph a trước ph a sau với kích thước: 15 cm x 20cm mô tô, 20cm x 25cm máy kéo 14 ... thiểu: - Đào tạo hạng A1 , A2 , A3 A4 : 1. 000m2 c) Mặt sân có cao độ hệ thống thoát nước bảo đảm BGTV Nội dung không bị ngập nước; đường hình tập lái sân phải có mặt trải nh a bê tông, có đầy đủ ... sơn hai bên cánh c a hai bên thành xe; g) Có giấy phép xe tập lái Sở Giao thông vận tải, Sở Giao thông công cấp có đủ điều kiện theo quy định (trừ điểm a, k), thời hạn tương ứng với thời gian phép...
... f-What’s mother wants her not to her notmuch candy, stay up late Tuesday, January 27, 2 010 Lesson 1: A1 ,4: Personal hygiene Vocabulary: Activities to take care of personal - harvest (n): m a vô ... received a letter from your aunt last week lµ, ñi I miss you a lot hi väng Don’t forget to write Your Grand dad talks about you a lot Answer: 1- 6- 3- 2- 4- Tuesday, January 27, 2 010 Lesson 1: A1 ,4: ... January 27, 2 010 Lesson 1: A1 ,4: Personal hygiene Vocabulary: Did Hoa Answer: got a letter her Mom? - harvest (n): m a vô get eating - receive (v): nhËn - hard (v): - iron (v): - hope (v): A1 : A4 :...
... Geography (Ba) P.Education (Hoa) Technology (Ba) Class activities (Ba & Hoa) What Ba and Hoa have on Friday morning ? A- Ba has Technology at seven B- At that time Hoa has Computer Science class ... 2 -1- In grade at does she go to ? What school Quang Trung school 2-She goes to school days a week 3- What time her classes start and finish ? 3- Her Classes start at 7: 00 and finish at 11 :15 4- What ... Computer Science class C- At 8 :40 , Ba has Geography but Hoa dosen’t D- She has Physical Education instead E- Hoa and Ba have Class Activities at the last period C - Match each subject to the correct...
... Some pairs practice to talk Call some Ss read again Two or four Ss read in front of t class Other listen carefully and remar Look and say Activity3 (10 ’) - read follow teacher (2-3 times) Look and ... reading a book -Guide new phrases: Some pairs practice in front of th Reading a book writing a letter Drawing a picture class singing aOther listen and remark song Activity 4 (10 ’) 3.Let’s talk ... 3.Let’s talk - Guide Ss to talk Talk about them - Call some pairs talk in front of the Work in pair: one asks – one class answers Other listen and remark IV Other activity: -Play game Play game:...
... neoplasia types and Nat Rev Cancer 2005, 5:367-375 Page of 10 Doherty GM: Multiple endocrine neoplasia type J Surg Oncol 2005, 89 : 14 3 -15 0 11 Carrasco CA, González AA, Carvajal CA, Campusano C, ... Parisi MJ, Santa Anna-AS, Oliver B, Chandrasekharappa SC, Collins FS, Spiegel AM, Marx SJ: Molecular pathology of the MEN1 gene Ann NY Acad Sci 20 04, 10 14 :18 9 -19 8 Marx SJ: Molecular genetics ... of the head disclosing a1.4 × 1. 3 cm pituitary adenoma, Page of cervical ultrasound and Tc99 m Sestamibi-scans both disclosing hyperplasia of the parathyroid glands, abdominal MRI scan and endoscopic...