7role of c src her family in resistance to hormone cytotoxic or targeted therapies in breast cancerbreast cancer

Tài liệu Báo cáo Y học: Analyses of the CYP11B gene family in the guinea pig suggest the existence of a primordial CYP11B gene with aldosterone synthase activity docx

Ngày tải lên : 22/02/2014, 07:20

... to be of signiﬁcance to the electrostatic interaction of bovine CYP11A1 (cytochrome P450SCC), a closely related mitochondrial protein with adrenodoxin [30] Accordingly, the 11b-hydroxylase activity ... ligated to both ends of the cDNA pool Using a combination of a primer complementary to the adapter (adapter primer: 5¢-CCATCCTAATACGACTCACTA TAGGGC-3¢) and a gene-speci c sense primer (5¢-GCCG CTCGAGTTTGAGTTAGCCAGAAACTCC-3¢, ... sequencing of these cDNA fragments the complete sequence of the cDNA of CYP11B2 could be deduced It comprised 2611 bp and an ORF of 1503 bp coding for a putative mitochondrial preprotein of 501 amino...

9
671
0

Báo cáo khoa học: Ionizing radiation utilizes c-Jun N-terminal kinase for ampliﬁcation of mitochondrial apoptotic cell death in human cervical cancer cells pptx

Ngày tải lên : 07/03/2014, 05:20

... determine whether death receptors are involved in radiation-induced apoptosis, we examined expression changes in death receptors such as the tumor necrosis factor receptor (TNFR), death receptor ... release of apoptogenic factors from the mitochondria into the cytosol [6,7] In contrast, anti-apoptotic members of the Bcl-2 family, such as Bcl-2, Bcl-xL, Bcl-w and Mcl–1 act primarily to preserve ... pro-apoptotic kinase in response to a variety of different stimuli, including tumor necrosis factor, UV irradiation, cytokine, Role of JNK in radiation-induced mitochondrial cell death ceramide,...

13
370
0

Báo cáo khoa học: Reduced FAS transcription in clones of U937 cells that have acquired resistance to Fas-induced apoptosis ppt

Ngày tải lên : 23/03/2014, 06:20

... pre-mRNA, 5¢-GGACC CAGAATACCAAGTG-3¢ and 5¢-GTCAGTGTTACTTC CCTAGG-3¢; TNFR1, 5¢-GTGCTGTTGCCCCTGGT CAT-3¢ and 5¢-GCTTAGTAGTAGTTCCTTCA-3¢; TNFR2, 5¢-AAACTCAAGCCTGCACTC-3¢ and 5¢-GGA TGAAGTCGTGTTGGAGA-3¢; ... for min; 72 C for min; for 35 cycles The PCRs were run in a MastercyclerNN (Eppendorf) The PCR products were cloned into the pCR 4-TOPO vector with the TOPO TA Cloning Kit (Invitrogen Life Technologies) ... Epigenetics of cancer progression Pharmacogenomics 9, 215–234 Chin L & Gray JW (2008) Translating insights from the cancer genome into clinical practice Nature 452, 553– 563 Cascino I, Papoff G,...

12
411
0

Báo cáo khoa học: Targeted disruption of one of the importin a family members leads to female functional incompetence in delivery docx

Ngày tải lên : 28/03/2014, 23:20

... of granulosa cells: a coordinated balance of the cell cycle regulators cyclin D2 and p27Kip1 Mol Endocrinol 12, 924–940 29 Leo C & Chen JD (2000) The SRC family of nuclear receptor coactivators ... isoform may compensate for the lack of a single isoform in vivo in mammals [21] Therefore, to determine whether the lack of importin a5 affects the expression of other importin a isoforms in ... p27kip1, and cyclin D2 [30] Accordingly, the defects observed in the reproductive organs of impa5) ⁄ ) mice could result from the combined effects of the inefﬁcient nuclear import of such factors The...

12
346
0

Báo cáo khoa học: Extrinsic proteins of photosystem II An intermediate member of the PsbQ protein family in red algal PS II ppt

Ngày tải lên : 31/03/2014, 07:20

... protein was neither able to bind to CaCl2washed spinach PS II in the presence of the spinach extrinsic 33-kDa and 23-kDa proteins nor contributed to increase of the Cl– binding afﬁnity for oxygen ... as electron acceptor Results Cloning and sequence analysis of the 20-kDa protein Cloning and sequence analysis of the extrinsic 20-kDa protein The N-terminal sequence of the 20-kDa protein was ... and 18 kDa in the photosystem II complex of spinach Biochem Biophys Acta 977, 315–321 26 Shen, J.-R., Ikeuchi, I & Inoue, Y (1992) Stoichiometric association of extrinsic cytochrome c5 50 and 12...

8
349
0

guardians of republicanism the valori family in the florentine renaissance may 2008

Ngày tải lên : 10/06/2014, 22:02

... larger historical question of the degree of elite support for Medici rule Bartolomeo’s family history was inextricably connected to the history of Medici power in Florence: his ancestors had played ... works—but also brought Ficino more formally into the Valori family network In 1496, Ficino became a godfather to Niccolò’s son; three years later, Ficino acted as an agent for Niccolò Valori in ... directly assisted Ficino by copying Platonic texts for him Filippo also came to Ficino’s aid during Innocent VIII’s investigation of Ficino on charges of magic and necromancy in 1489 and in 1493.³⁰ The...

214
191
0

báo cáo khoa học: "Clinical significance of preoperative serum interleukin-6 and C-reactive protein level in breast cancer patients" pot

Ngày tải lên : 09/08/2014, 01:24

... Page of Figure CRP and the characteristics of breast tumour (A) CRP levels according to tumor depth (B) CRP levels according to LN metastasis (C) CRP levels according to distant metastasis (D) CRP ... Figure shows (A) CRP levels according to tumor depth (B) CRP levels according to LN metastasis (C) CRP levels according to distant metastasis (D) CRP levels according to TNM staging 15.5 mg/dl ... levels according to tumor depth (B) IL-6 levels according to LN metastasis (C) IL-6 levels according to the metastasis (D) IL-6 levels according to TNM staging The patients were divided into two...

6
279
0

báo cáo khoa học: " Unexpected complexity of the Aquaporin gene family in the moss Physcomitrella patens" pdf

Ngày tải lên : 12/08/2014, 05:20

... intrinsic proteins (PIPs), the tonoplast intrinsic proteins (TIPs), the nodulin-26 like intrinsic proteins (NIPs), the small basic intrinsic proteins (SIPs) and the GlpF-like intrinsic protein ... leading to mosses and higher plants An intron loss in PpSIP1s or an intron gain in a common ancestor to SIP1s and SIP2s in higher plant is equally likely in this scenario In most SIP1s the corresponding ... the donor-acceptor interchanged, in EcGlpF ([PDB:1FX8];D207 - T137) This stabilisation is probably directly affecting the permeability of the pore since the orientation of the arginine of the...

15
292
0

Báo cáo sinh học: "Quantitative estimation of genetic risk for atypical scrapie in French sheep and potential consequences of the current breeding programme for resistance to scrapie on the risk of atypical scrapie" pptx

Ngày tải lên : 14/08/2014, 13:21

... resistance are encouraged to join in a voluntary scrapie certification scheme, for which it is also compulsory to send animals to breed selection centres (Internal circular from French Ministry of ... not to present genotype specific prevalence for CS Matching Figure Probability for a 100% ALRR-ALRR flock to have at least one AS case detected according to the number of animals tested Plain line: ... unbiased but much smaller sample for the codon 141 We took into account that difference of accuracy and the resulting uncertainty by bootstrapping the control dataset, which eventually increased the...

7
300
0

Crossculture in international business negotiation the case study of C food international group in Vietnam

Ngày tải lên : 25/11/2014, 00:40

... Uncertainty avoidance involves the ways in which human societies have learned to cope with uncertainty In low uncertainty cultures people are more of accepting innovative ideas and eccentric or deviant ... products in each container By this way, C- Food’s products will occupy more space in the super markets Hence the level of exposure of C- Food’s products to consumers will be higher The other factor ... successful in another culture if it lacks understanding of and or disregard the cultural variables.27 According to Czinkota & Ronkainen (1998), culture is one of the most challenging elements of...

63
1.1K
1

Investigation of relative expression level of SLC4 bicarbonate transporter family in mouse and human corneal endothelial cells

Ngày tải lên : 13/10/2015, 15:54

... Sequence Forward CTCCTTCCTCATCTCCCTCA Reverse TCATCACAACAGGGGCATAA Forward ATGTGGCCTCACTGTCCTTC Slc4a2 Reverse ATCTGCTCGACCACCTGATG Forward ATTCCCATCTCCATCCTGGT Slc4a3 Reverse CGCTTATGAGGGGAAGTCAC ... Forward TCCCTTCATTGCCTTTGTTC Slc4a4 Reverse CAAGGTGGCGATAGCTCTTC Forward TGAACACAACCACGGTCAAT Slc4a5 Reverse CGTAGCTCAGGCACTCCTTC Forward CGCATAGAGCCTCCAAAAAG Slc4a7 Reverse GCATGGTGATCATCCTCCTT ... Sequence Forward GTCCCCATCTCCATCCTGA Reverse GGAGCCCTTGACCATCTTG Forward GAAGAATGCCAAAGGTTCCA SLC4A2 Reverse GCAACTCATTCAGCTCCACA Forward ACTGCTCTGGGTGGTCAAGT SLC4A3 Reverse GTTCAGCATCTTCCGAGTCC Forward...

103
244
0

Rise and fall of chinese medieval aristocracy a case study of the hongnong yang family in han, wei, and jin period

Ngày tải lên : 16/10/2015, 12:00

... an indicative representation of Chinese medieval aristocracy during the early Medieval China To explore the three historic periods of Yangs’ rising, flourishing and declining, this paper elaborates ... medieval China? The whole historical process of Chinese medieval aristocracy from rise to collapse lasted nearly a thousand years, therefore the properties of aristocratic families is impossible to ... tracing the Hongnong Yangs’ origins by analyzing the annals including the Chinese official historiography, historical literature, and the records on tablets Meanwhile, the third and fourth iv chapters...

155
1.2K
0

báo cáo hóa học:" Gene Expression and Pathway Analysis of Ovarian Cancer Cells Selected for Resistance to Cisplatin, Paclitaxel, or Doxorubicin" docx

Ngày tải lên : 20/06/2014, 08:20

... analysis of ovarian cancer cells selected for resistance to cisplatin, paclitaxel, or doxorubicin Cheryl A Sherman-Baust1, Kevin G Becker2, William H.Wood, III2, Yongqing Zhang2, and Patrice J Morin1,3* ... D: Enhancing tumorspecific uptake of the anticancer drug cisplatin with a copper chelator Cancer Cell 2010, 17:574-583 Garcia-Echeverria C, Sellers WR: Drug discovery approaches targeting the ... for reversing or circumventing drug resistance [4, 11] In this manuscript, we generate novel drug resistant ovarian cancer cell lines independently selected for resistance to cisplatin, doxorubicin...

28
384
0

Association analysis of genetic variation of estrogen related candidate genes in breast and endometrial cancers

Ngày tải lên : 09/09/2015, 17:58

... 7.1.1 Breast cancer incidence Breast cancer is the most common cancer in women(1) and the incidence is increasing Globally, new cases of breast cancer accounted for 23% (1.38 million) of the total ... steroid receptor family is one of the most widely-studied classical coactivators in AF-2 group, including nuclear coactivators (NCOA1), nuclear coactivators (NCOA2) and nuclear coactivators (NCOA3) ... Age-specific incidence rate of breast cancer in Sweden, Finland and Nordic countries (2008) Source: (34) 7.1.2 Endometrial cancer incidence Endometrial cancer is the seventh most common cancer worldwide,...

158
422
0

Analysis of p13k independent survival pathways in the prostate cancer cell line LN cap 1

Ngày tải lên : 12/09/2015, 08:18

... DMQD/DEVD Short VEID/VEHD Short Apoptosis initiator Apoptosis initiator Apoptosis initiator Apoptosis initiator Apoptosis effector Apoptosis effector Apoptosis effector Caspase-7 Mch3/ICELAP3/CMH-1 ... inactive state Activation of PI3K occurs as a result of growth factor binding to their cognate receptors which leads to activation of the receptors’ intrinsic kinase activity and transphosphorylation ... and the intrinsic pathway Apoptosis induced by aggregation of cell surface death receptors (extrinsic pathway) like the CD95/Fas, tumor necrosis factor receptor-1 (TNFR1) and TRAIL receptors DR4...

140
283
0

Analysis of p13k independent survival pathways in the prostate cancer cell line LN cap 2

Ngày tải lên : 12/09/2015, 08:18

... the concentration of specific growth factors or other factors required for induction of ROS production is too low in serum Moreover various factors in serum such as ascorbate, α-tocopherol, caeruloplasmin ... bombesin and lysophosphotidic acid have been shown to be able to transactivate the ErbB receptors when they bind to their cognate receptors Cytokine receptors can transactivate the ErbB receptor ... hepatocellular carcinoma cells, 175 MCF-7 breast cancer cells and also LNCaP prostate cancer cells, insulin-mediated activation of ERK1/2 was sensitive to inhibition by two structurally distinct...

117
325
0

In vivo and in vitro study on potential combination therapy of COL 3 and tamoxifen in breast cancer a pilot study

Ngày tải lên : 09/10/2015, 11:24

... fluid in intravenous infusions Newer work has concentrated on interactions between specific drugs, notably chloroquine, cyclosporin insulin and vasodilator nitrates, and pharmaceutical packaging ... growing class of compounds called selective estrogen receptor- modulators (SERMs) SERMs chemically resemble estrogen and trick the breast cancer cells into accepting it in place of estrogen Unlike ... estrogen receptor-positive breast cancer cells seems to include mainly the inhibition of estrogen binding to its receptor[155] However, recent data point out that tamoxifen may also inhibit cell proliferation...

134
360
0

Tài liệu Báo cáo khoa học: Insulin-dependent phosphorylation of DPP IV in liver Evidence for a role of compartmentalized c-Src ppt

Ngày tải lên : 19/02/2014, 07:20

... restructuring enzymes [56] in protein targeting is beginning to be perceived For instance, one striking example of c- Src location inside one organelle has been reported for the inner membrane of mitochondria ... and c- Src are present mainly in the same fractions (Lh and Gh) This therefore points to the importance of subjecting these fractions to further puriﬁcation and biochemical characterization in order ... from cells transfected with wild type Flag-E4orf4 as compared to mutant Flag-E4orf4 (Y42F) alone, or together with c- Src or v -Src to induce maximum tyrosine phosphorylation of Ad2 E4orf4 and of Src...

12
738
0

Cambridge.University.Press.Allegories.of.Union.in.Irish.and.English.Writing.1790-1870.Politics.History.and.the.Family.from.Edgeworth.to.Arnold.Oct.2000.pdf

Ngày tải lên : 21/09/2012, 10:39

... historical change as Eagleton’s work in particular may make it seem By paying close attention to rhetorical matters, and especially to the concrete workings of plot in both fictional and non-fictional ... effort has been to specify as carefully as I can the historical coordinates of the representations I examine, informed at all points by the recognition that developing theoretical frameworks for ... implication of ‘‘race’’ in ‘‘class’’ enables us to think about these categories together in new ways I attempt here to rewrite the class/race relations of Victorian culture as a similarly miscegenous...

240
1.2K
5

Anchorage and resistance to uprooting forces of eelgrass (Zostera marina L.) shoots planted in slag substrates

Ngày tải lên : 05/09/2013, 09:38

... site where eelgrass plants were collected, the Yoshina Tidal Flat in Seto Inland Sea, which has well-established eelgrass beds Resistance to uprooting forces The resistance to uprooting forces of ... the combined effects of the high density of ACS and closeness of packing in DS However, since ACS data for the 20% silt-clay mixture were not significantly different from that of the pure ACS ... discrepancy Eelgrass plants used for the experiment of effect of particle size were collected in December, 2005 while plants used for the effect of DS addition were collected in February In an...

11
295
0