7 1 result of primenumbers html used as a front end to the primenumbers servlet

Báo cáo khoa học: The modulation of metal bio-availability as a therapeutic strategy for the treatment of Alzheimer’s disease pptx

Báo cáo khoa học: The modulation of metal bio-availability as a therapeutic strategy for the treatment of Alzheimer’s disease pptx

Ngày tải lên : 07/03/2014, 10:20
... 277 , 44 670 –44 676 14 Morita A, Kimura M & Itokawa Y (19 94) The effect of aging on the mineral status of female mice Biol Trace Elem Res 42, 16 5– 17 7 15 Takahashi S, Takahashi I, Sato H, Kubota ... normal tau into tangles of filaments and disassembles microtubules Nat Med 2, 78 3 78 7 Alonso AD, Grundke-Iqbal I, Barra HS & Iqbal K (19 97) Abnormal phosphorylation of tau and the mechanism of Alzheimer ... kDa Ab peptide was identified as a major component of the amyloid plaques in AD brain [42,43], global AD research focused on this peptide as a causative agent in the disease The 39–43 amino acid...
  • 9
  • 634
  • 0
Báo cáo hóa học: " Could sound be used as a strategy for reducing symptoms of perceived motion sickness?" docx

Báo cáo hóa học: " Could sound be used as a strategy for reducing symptoms of perceived motion sickness?" docx

Ngày tải lên : 19/06/2014, 08:20
... 1. 14 to 2.46 0. 27 -0 .11 to 0.65 Horizon 1 .77 1. 07 to 2. 47 Non-pos 0 .79 0. 41 to 1. 17 0.00 -0.44 to 0.45 Horizon 0 .74 0.33 to 1. 15 Non-pos 0 .76 0.46 to 1. 07 0. 17 -0.09 to 0.43 Horizon 0. 57 0.33 to ... questions to obtain a valid measurement of the perceived state The NoFix slope increased as Mal slope increased, a finding that was expected [16 , 17 ] As mentioned, fixation time and NoFix are related ... JD also participated in the analysis of the results and preparation of the manuscript AS participated in the experimental trials, were responsible for the statistical analysis and participated...
  • 9
  • 609
  • 0
Báo cáo khoa học: "Alteration of nitrergic neuromuscular transmission as a result of acute experimental colitis in rat" pot

Báo cáo khoa học: "Alteration of nitrergic neuromuscular transmission as a result of acute experimental colitis in rat" pot

Ngày tải lên : 07/08/2014, 18:21
... :2 esahP gnilpmas fo yad emas eht no deyassa dna ,C°02− ni derots erew selpmas amsalp ehT amsalp eht etarapes ot g × 005 ,1 yletamixorppa ta nim 51 rof degufirtnec saw elpmas hcae ,noitcelloc ... ± naem ,6 = n( stibbar elirbef dna yhtlaeh ot noitartsinimda ralucsumartni retfa emipefec fo sretemarap citenikocamrahP elbaT la te haduoG namyA 4 51 .15 2-642 , 912 , 079 1 loisyhP J mA stibbar dezitehtsenanu ... esnefed ralullec non dna esnopser esahp etucA MAPJSA treiM nav 72 612 -002 ,7 ,58 91 Q teV seiceps lamina rehto dna taog eht ni segnahc lacimehcoib doolb dna lacigolotameh ,lacinilc detaicossa dna reveF...
  • 5
  • 205
  • 0
Báo cáo y học: "Can HRCT be used as a marker of airway remodelling in children with difficult asthma?" docx

Báo cáo y học: "Can HRCT be used as a marker of airway remodelling in children with difficult asthma?" docx

Ngày tải lên : 12/08/2014, 16:20
... bronchoalveolar lavage and EB as part of their clinical assessment in order to help confirm the diagnosis of asthma and to exclude any other associated abnormalities such as structural airway abnormalities ... sub-segmental airways A separate score was given to each lobe Scores ranged from to was normal wall thickness, was minimal wall thickening, was bronchial wall thickness half of the diameter of the adjacent ... a quantitative score findings are in contrast to those of Kasahara and colleagues in adults [7] and de Blic and colleagues [15 ] in children A limitation of this study compared to that by Kasahara...
  • 9
  • 390
  • 0
Ảnh hưởng của D  psicose sử dụng như là chất thay thế đường mía vào đặc điểm của bánh trứng đường .Effect of d psicose used as sucrose replacer on the characteristics of meringue

Ảnh hưởng của D psicose sử dụng như là chất thay thế đường mía vào đặc điểm của bánh trứng đường .Effect of d psicose used as sucrose replacer on the characteristics of meringue

Ngày tải lên : 24/08/2015, 20:41
... Ogawa M, Hayakawa S, Nakajima D, O’Charoen S, Ooshima H, Sun Y 2 013 Transepithelial transports of rare sugar d-psicose in human intestine J Agric Food Chem 61 :73 81 86 Hodge JE, Osman EM 1 976 Carbohydrates ... ethanol extract from baked meringue Ethanol extract of baked Analysis of variance (ANOVA) was performed using the SPSS meringue was prepared according to the method described by 15 .0 statistical ... denaturation, leading to the formation of rigid structure of ovalbumin, respectively The results imply that each sugar increased baked meringue Additionally, baking of meringue causes a gas the heat stability...
  • 7
  • 400
  • 0
A study of using english songs as a type of supplementary material in teaching listening for first year non major students of english at phuong dong university

A study of using english songs as a type of supplementary material in teaching listening for first year non major students of english at phuong dong university

Ngày tải lên : 29/01/2014, 10:33
... During the test, the teacher worked as a cassette player and examiner The marking was done with the same way of assessment and then was analyzed in turn The class with English songs in teaching ... Mean 5.36 67 5 .16 67 Std Deviation 1. 56433 1. 599 21 Median 5 The mean of 5.36 67 says that class A is a little bit better than class B whose mean is 5 .16 67 The means also show that in general the ... When asked for the reason, they all argued that because they were always curious about the content of the songs, this task is really helpful as it enables them to have a full understanding of the...
  • 39
  • 1.1K
  • 3
Tài liệu Interest on Excess Reserves as a Monetary Policy Instrument: The Experience of Foreign Central Banks ppt

Tài liệu Interest on Excess Reserves as a Monetary Policy Instrument: The Experience of Foreign Central Banks ppt

Ngày tải lên : 17/02/2014, 03:20
... described as a “floor system.” These are the ECB, the Bank of Japan, the Bank of England, the Bank of Canada, and Norges Bank The remaining central banks— the Reserve Bank of Australia, the Reserve Bank ... for the cash rate a total of 15 0 basis points Aside from a temporary jump associated with the passage to the year 2000, aggregate balances declined moderately over that period, possibly as participating ... Monetary Affairs) and Spence Hilton (Federal Reserve Bank of New York), as well as from central bank colleagues at the Reserve Bank of Australia, the Bank of Canada, the Bank of England, the European...
  • 49
  • 653
  • 0
Báo cáo khoa học: Identification of carbonic anhydrase 9 as a contributor to pingyangmycin-induced drug resistance in human tongue cancer cells ppt

Báo cáo khoa học: Identification of carbonic anhydrase 9 as a contributor to pingyangmycin-induced drug resistance in human tongue cancer cells ppt

Ngày tải lên : 06/03/2014, 22:21
... CTGCGGTGCTGTTGTGG CACCATCATAAGGGTAAACAT ACAGCAAAAAGGAGGCCAAA GCCACAATCCAGTCATTCCA GATAAGCTTGTGGAAGTCGCGT TCTCACTGGCCCTAAACTGG CTGATAGGGGTTGGGTGATG GCATTTCCATTTCCCTAAGCAC CAACACAATCCTGAGGCACA TCCCTTTGCCTCCTGTTGTT ... CGGAAACGCCTTAAGTCCAG AATAAGCTTCCGACTCTAGCCGC AGCTGGTGCAGGAGGAAGTA CCGAGAACCGAACTTACCAA AGGAAGCACCCAGCAATACCA CACCTTGGATGGGTATTCCA CACAGCTCCCATTCATTCCA TCCTCCCTGGAGAAGAGCTA CTCCTGGGACACGATGC CTGCGGTGCTGTTGTGG ... (5¢- to 3¢) Size (bp) MDR1 MRP1 BCRP CA9 BMP2 MT 2A CD2 379 04 AL7 070 95 AK09 573 1 DKK1 BC0 378 51 b-Actin GAAGAAGGGCCAGACGC CCTTCGCTGAGTTCCTGC ACATCAGCGGATACTACAGAG TTTGAATGGGCGAGTGATTG CGGAAACGCCTTAAGTCCAG...
  • 13
  • 563
  • 0
Báo cáo khoa học: Post-ischemic brain damage: targeting PARP-1 within the ischemic neurovascular units as a realistic avenue to stroke treatment pptx

Báo cáo khoa học: Post-ischemic brain damage: targeting PARP-1 within the ischemic neurovascular units as a realistic avenue to stroke treatment pptx

Ngày tải lên : 07/03/2014, 03:20
... expression of pro-inflammatory mediators is probably a result of the fact that inflammatory transcription factors such as nuclear factor-kappaB, activator protein -1 and nuclear factor of activated T-cells ... neurovascular unit Astrocyte PARP -1 Neuron Inflammatory mediators AIF PARP -1 M ina am ll asa P M PARP -1 B HM G B1 M P M HM GB M P M X Endothelium X PM TR Ca2+ Inflammatory mediators X AIF Inflammatory ... point to basal PARP -1 activity as central to homeostatic regulation of endothelial function, whereas its hyperactivation appears causal to BBB damage and immune cell infiltration during ischemia PARP -1, ...
  • 10
  • 417
  • 0
Báo cáo khoa học: A kinetic approach to the dependence of dissimilatory metal reduction by Shewanella oneidensis MR-1 on the outer membrane cytochromes c OmcA and OmcB potx

Báo cáo khoa học: A kinetic approach to the dependence of dissimilatory metal reduction by Shewanella oneidensis MR-1 on the outer membrane cytochromes c OmcA and OmcB potx

Ngày tải lên : 07/03/2014, 09:20
... GTGTGATCTGCAACTGTT CACCGAGGAATAATAAATGATG AAACGGTTCAATTTC TTAGTTACCGTGTGCTTC CACCGAGGAATAATAAATGATG AACGCACAAAAATCA TTACATTTTCACTTTAGT OMCA-PBAD-R OMCB-PBAD-F OMCB-PBAD-R 373 6 controlled by an arabinose promoter ... OMCA-F OMCA-R OMCB-F OMCB-R OMCA-PBAD-F CACACTGCAACCTCTGGT ACTGTCAATAGTGAAGGT CCCCATGTCGCCTTTAGT TCGCTAGAACACATTGAC ATGATGAAACGGTTCAAT TTAGTTACCGTGTGCTTC CTGCTGCTCGCAGCAAGT GTGTGATCTGCAACTGTT CACCGAGGAATAATAAATGATG ... omcA– mutant, and omcA (lane 7) , omcB (lane 8), mtrA (lane 9) and mtrB (lane 10 ) in the omcB– mutant MR-1R was used as a positive control to display omcA (lane 1) and omcB (lane 6) DNA standards...
  • 11
  • 731
  • 0
a study on impacts and effectiveness of abc costing method as a cost effective measurement in coal industry

a study on impacts and effectiveness of abc costing method as a cost effective measurement in coal industry

Ngày tải lên : 13/03/2014, 14:19
... 60 10 71 .428 57 Process 40 28. 5 71 43 20 10 0 14 10 0 Downsize Sample % ABC % No change 25 28. 57 Increase 1- 10% 30 35 . 71 Increase 11 -20% 7. 14 3 Increase 21- 50% 7. 14 3 Increase 51 -75 % 20 14 .29 Increase ... 1. 49032 0.8 870 41 Sample Variance 0.2 210 53 0.252632 3. 673 684 2.36 578 9 1. 1684 21 0 .1 973 68 0.239 474 2.2 210 53 0 .78 6842 Kurtosis -1. 2 418 3 -2.0 17 9 7 -1. 553 41 -1. 372 47 -0. 974 23 -0.49 673 -1 . 71 946 -0. 410 2 ... 13 65 13 92.86 Low volume 50 7. 14 3 20 11 5 14 10 0 ∆Cost Sample % ABC % Increased more than 20% 0 0 Increased 11 -20% 10 0 Increased 1- 10% 10 0 No change 20 14 .28 5 71 Decreased 1- 10% 35 50 Decreased...
  • 64
  • 512
  • 0
Báo cáo khoa học: Distribution of the extrinsic proteins as a potential marker for the evolution of photosynthetic oxygen-evolving photosystem II ppt

Báo cáo khoa học: Distribution of the extrinsic proteins as a potential marker for the evolution of photosynthetic oxygen-evolving photosystem II ppt

Ngày tải lên : 23/03/2014, 15:21
... Chloroplast DNA Cyanidium caldarium Chloroplast DNA Bacillariophyceae (diatoms) Thalassiosira pseudonana Nuclear DNA Chloroplast DNA Odontella sinensis Chloroplast DNA Prasinophyceae Mesostigma viride ... Chloroplast DNA Euglenophyceae Euglena gracilis Chloroplast DNA Chlorophyceae (green algae) Chlamydomonas reinhardtii Nuclear DNA Chloroplast DNA Higher plant Oryza sativa Nuclear DNA Chloroplast DNA ... membranes of the cyanelles of Cyanophora paradoxa Plant Physiol 71 , 409– 419 21 Shibata M, Kashino Y, Satoh K & Koike H (20 01) Isolation and characterization of oxygen-evolving thylakoid membranes...
  • 11
  • 501
  • 0
The Case for Controlled-Atmosphere Killing of Poultry in Transport Containers Prior to Shackling as a Humane Alternative to Electrical Stunning doc

The Case for Controlled-Atmosphere Killing of Poultry in Transport Containers Prior to Shackling as a Humane Alternative to Electrical Stunning doc

Ngày tải lên : 31/03/2014, 08:20
... are at least companies in the UK using a predominantly nitrogen based gas mixture for killing chickens and turkeys.” In Canada, the Canadian Food Inspection Agency has also approved the use of ... grounds” (Raj and others 19 97) The European Commission’s Scientific Committee on Animal Health and Animal Welfare (19 98) agrees, writing that “ [a] nother advantage of gas stunning or gas killing ... refrigeration and energy costs: Raj and others (19 97) found that controlledatmosphere killing causes a more rapid pH fall in the carcasses than electrical stunning, resulting in faster carcass-maturation...
  • 16
  • 504
  • 0
Báo cáo hóa học: "IL-2 as a therapeutic target for the restoration of Foxp3+ regulatory T cell function in organ-specific autoimmunity: implications in pathophysiology and translation to human disease" doc

Báo cáo hóa học: "IL-2 as a therapeutic target for the restoration of Foxp3+ regulatory T cell function in organ-specific autoimmunity: implications in pathophysiology and translation to human disease" doc

Ngày tải lên : 18/06/2014, 16:20
... 2 010 , 62 :10 1 -1 07 36 Kawasaki E, Awata T, Ikegami H, Kobayashi T, Maruyama T, Nakanishi K, Shimada A, Uga M, Kurihara S, Kawabata Y, et al: Genetic association between the interleukin-2 receptor-alpha ... translating these therapies to humans remains to be assessed One potential limitation of the process is the identification of those antigens that are the most relevant as targets, as the human auto-antigen-specific ... receptor alpha chain deficiency Pediatr Res 2000, 48:6 -11 19 Bernasconi A, Marino R, Ribas A, Rossi J, Ciaccio M, Oleastro M, Ornani A, Paz R, Rivarola MA, Zelazko M, Belgorosky A: Characterization of...
  • 12
  • 573
  • 0
báo cáo hóa học:" The validity of self-rated health as a measure of health status among young military personnel: evidence from a cross-sectional survey" pot

báo cáo hóa học:" The validity of self-rated health as a measure of health status among young military personnel: evidence from a cross-sectional survey" pot

Ngày tải lên : 20/06/2014, 15:20
... Ethnicity/Race Asian/Pacific Islander (1, 255) African-American (5,826) Hispanic (3 ,12 9) White (19 ,75 1) Native American (234) Other ( 912 ) Marital Status Married (2,9 31) Not Married (28, 17 7 ) Fair Good ... Excellent 0.8 11 .6 43.0 35.0 9.6 3.40 0 .7 1. 0 10 .4 15 .3 41. 1 48 .7 37. 2 28.3 10 .6 6 .7 3.45 3.23 1. 0 0.9 0.6 0 .7 1. 3 0.5 14 .3 11 .2 11 .4 11 .6 10 .7 11 .0 44.9 38.5 38.8 45.0 42.3 41. 4 30.0 36.3 36 .7 34.6 ... smoking status and discharge from the military Smoking status at the one-year follow up was assessed using a 7- day point prevalence analysis [16 ] Discharge was assessed both after BMT and after technical...
  • 9
  • 301
  • 0
Báo cáo toán học: " Music expression with a robot manipulator used as a bidirectional tangible interface" pptx

Báo cáo toán học: " Music expression with a robot manipulator used as a bidirectional tangible interface" pptx

Ngày tải lên : 20/06/2014, 20:20
... new hardware capabilities Instead of considering separated interfaces to communicate and send commands to the robot, the proposal is to explore the use of the robot as a tangible interface We adopt ... onto the creation of robots which can take part in live performances, as a means to create music or dance choreographies For example, specific classes are available at the California Institute of ... κP and κV are adaptive stiffness and damping gains in the plane of the circle κP and κV are constant gains in a direction perpendicular to the circle ⊥ ⊥ The variable scalar gains κP and κV are...
  • 34
  • 323
  • 0
Báo cáo hóa học: " Effects of pentacene-doped PEDOT:PSS as a holeconducting layer on the performance characteristics of polymer photovoltaic cells" pot

Báo cáo hóa học: " Effects of pentacene-doped PEDOT:PSS as a holeconducting layer on the performance characteristics of polymer photovoltaic cells" pot

Ngày tải lên : 20/06/2014, 23:20
... USA) PCBM as an electron acceptor was purchased from Nano-C (Westwood, MA, USA) Aluminum as a cathode was purchased from CERAC™, Inc (Milwaukee, WI, USA) Device fabrication The pre-patterned ITO ... temperature, thus leading to more grain boundaries [18 ] As the annealing temperature increases, the grain surface also increases, leading to enhanced interfacial adhesion between buffer layer and active ... et al Nanoscale Research Letters 2 012 , 7: 5 http://www.nanoscalereslett.com/content /7/ 1/ 5 [11 -13 ] Many researchers have reported on photovoltaic applications of pentacene as a dopant into a hole-conducting...
  • 8
  • 401
  • 0
Báo cáo hóa học: " Biofabrication of Anisotropic Gold Nanotriangles Using Extract of Endophytic Aspergillus clavatus as a Dual Functional Reductant and Stabilizer" potx

Báo cáo hóa học: " Biofabrication of Anisotropic Gold Nanotriangles Using Extract of Endophytic Aspergillus clavatus as a Dual Functional Reductant and Stabilizer" potx

Ngày tải lên : 21/06/2014, 08:20
... 2 :1 16 Vigneshwaran N, Ashtaputre NM, Varadarajan PV, Nachane RP, Paralikar KM, Balasubramanya RH: Mat Lett 20 07, 61: 1 413 17 Bhainsa KC, D’Souza SF: Coll Surf B Biointer 2006, 47: 16 0 18 Shankar ... 25: 819 2 Binupriya AR, Sathishkumar M, Vijayaraghavan K, Yun SI: J Hazard Mat 2 010 , 17 7 :539 10 Sarikaya M: PNAS-USA 19 99, 96 :14 183 11 Klaus T, Joerger R, Olsson E, Granqvist CG: PNAS USA 19 99, ... doi :10 .10 07/ s 11 6 71 - 010 - 974 3-6 Cite this article as: Verma et al.: Biofabrication of Anisotropic Gold Nanotriangles Using Extract of Endophytic Aspergillus clavatus as a Dual Functional Reductant...
  • 7
  • 261
  • 0
báo cáo hóa học:" Music expression with a robot manipulator used as a bidirectional tangible interface" potx

báo cáo hóa học:" Music expression with a robot manipulator used as a bidirectional tangible interface" potx

Ngày tải lên : 21/06/2014, 17:20
... new hardware capabilities Instead of considering separated interfaces to communicate and send commands to the robot, the proposal is to explore the use of the robot as a tangible interface We adopt ... onto the creation of robots which can take part in live performances, as a means to create music or dance choreographies For example, specific classes are available at the California Institute of ... κP and κV are adaptive stiffness and damping gains in the plane of the circle κP and κV are constant gains in a direction perpendicular to the circle ⊥ ⊥ The variable scalar gains κP and κV are...
  • 34
  • 183
  • 0

Xem thêm