6 rankl and gcp 2 in mouse embryo fibroblasts and this induction is potently inhibited by ifn g
Báo cáo y học: "Expression of cartilage-derived morphogenetic protein in human intervertebral discs and its effect on matrix synthesis in degenerate human nucleus pulposus cells" potx
... GAA GG 5'; probe: 3'FAM- CTG ATA GGC ACT GTT GAC - MGB 5'; RP: 3' GGG TAG TTG GGC AGT GAG AC 5') (Accession numbers: [GenBank:NM_001135 .2] (variant 1) and [GenBank:NM_01 322 7 .2] (variant 2) primers ... regenerating the degenerate disc Previous studies investigating the effect of CDMP1 on rabbit disc cells in monolayer [9] and mouse [22 ] and bovine disc cells in alginate [21 ] have shown significant increases ... resulted in significant increases in GAG production [21 ,22 ] The accumulation of GAG within alginate beads was investigated within the compartments: CM and FRM, together with GAG released into media...
- 10
- 437
- 0
Báo cáo khoa học: Ribonuclease H: properties, substrate specificity and roles in retroviral reverse transcription ppt
... Le Grice SF (1995) Footprint analysis of FEBS Journal 2 76 (20 09) 15 06 15 16 ª 20 09 The Authors Journal compilation ª 20 09 FEBS J J Champoux and S J Schultz 57 58 59 60 61 62 63 64 65 66 67 68 69 ... Journal 2 76 (20 09) 15 06 15 16 ª 20 09 The Authors Journal compilation ª 20 09 FEBS J J Champoux and S J Schultz Rausch JW & Le Grice SF (20 04) ‘Binding, bending and bonding’: polypurine tract-primed initiation ... that is derived by proteolysis of p 66 and is missing the C-terminal RNase H domain (Fig 2) The p51 subunit is enzymatically inactive and simply plays a structural role in the protein The avian sarcoma-leukosis...
- 11
- 296
- 0
Báo cáo sinh học: " Quantitative assessment of the effect of uracil-DNA glycosylase on amplicon DNA degradation and RNA amplification in reverse transcription-PCR" pdf
... 31 .28 34.81 21 .79 25 . 96 31.74 36. 16 0. 72 0. 16 0. 46 1.35 22 .69 26 . 83 32. 15 36. 01 1 . 62 1.03 0.87 1 .20 22 .74 27 .51 32. 78 35 .6 1 .67 1.71 1.50 0.79 28 .19 31 .22 34 .60 No Cte 6. 73 6. 49 6. 52 0 .67 6. 58 ... 4 . 62 3.95 0 .28 3. 92 26 . 04 29 .20 32. 89 36. 00 4.84 5 .29 5.80 5. 52 0 .27 5. 36 27 .54 31. 46 33.50 36. 24 6. 34 7.55 6. 41 5. 76 0.76d 6. 52 24 .67 28 . 06 32. 00 36. 78 3.47 4.15 4.91 6. 30 0 .68 4.71 28 .09 32. 30 ... -0 .27 0 . 62 21 .38 25 .29 28 .41 31.59 0.17 0.38 0.09 0.43 21 .81 25 .44 29 .23 32. 15 0 .60 0.53 0.91 0.99 22 .04 25 .10 28 .47 32. 70 0.83 0.19 0.15 1.54 21 .97 26 . 23 29 .73 32. 70 0. 76 1. 32 1.41 1.54 23 .34 26 . 69...
- 8
- 678
- 0
báo cáo hóa học:" Quantitative assessment of the effect of uracil-DNA glycosylase on amplicon DNA degradation and RNA amplification in reverse transcription-PCR" ppt
... 31 .28 34.81 21 .79 25 . 96 31.74 36. 16 0. 72 0. 16 0. 46 1.35 22 .69 26 . 83 32. 15 36. 01 1 . 62 1.03 0.87 1 .20 22 .74 27 .51 32. 78 35 .6 1 .67 1.71 1.50 0.79 28 .19 31 .22 34 .60 No Cte 6. 73 6. 49 6. 52 0 .67 6. 58 ... 4 . 62 3.95 0 .28 3. 92 26 . 04 29 .20 32. 89 36. 00 4.84 5 .29 5.80 5. 52 0 .27 5. 36 27 .54 31. 46 33.50 36. 24 6. 34 7.55 6. 41 5. 76 0.76d 6. 52 24 .67 28 . 06 32. 00 36. 78 3.47 4.15 4.91 6. 30 0 .68 4.71 28 .09 32. 30 ... -0 .27 0 . 62 21 .38 25 .29 28 .41 31.59 0.17 0.38 0.09 0.43 21 .81 25 .44 29 .23 32. 15 0 .60 0.53 0.91 0.99 22 .04 25 .10 28 .47 32. 70 0.83 0.19 0.15 1.54 21 .97 26 . 23 29 .73 32. 70 0. 76 1. 32 1.41 1.54 23 .34 26 . 69...
- 8
- 475
- 0
Báo cáo khoa học: "Development of a Lightcycler-based reverse transcription polymerase chain reaction for the detection of foot-and-mouth disease virus" pps
... '3-AACTGTACAGRAGGACGTAGA-'5 '3-TAGCGCATGGTGGGCAACCTCCA-'5 '3-CTGAARATGGGKACCTGCG-'5 '3-GTSCGYTTSTGYCGCACAA-'5 '3-px CCATGGACTTCCCGTAGGAATCGGACAm-'5 '3-CCATTGTRCGCTGTGAGC-'5 '3-CACGACCCCAACGTGTGT-'5 ... evitagen :- , evitisop :+ diulf ralucisev ,FV ;diulf tnatanrepus erutluc llec ,CC ;noisnepsus lailehtipe :SE* † + + + + + + + + + + + + - 61 52 12 51 42 62 22 81 81 51 32 61 61 81 51 52 32 SE ... ngised eht rof senilediug s’erutcafunam eht ot gnidrocca ,)ASU ,ehcoR( erawtfos ngised eborp )CL( relcycthgiL eht gnisu eneg VDMF fo snoiger devresnoc eht tegrat ot dengised erew seborp cinegoroulf...
- 6
- 347
- 0
Báo cáo khoa hoc:" Quantitative competitive reverse transcription polymerase chain reaction is not a useful method for quantification of CD4 and CD8 cell status during HIV infection" pptx
... Sense 5'GGTGAAGGTCGGAGTCAACG3', Antisense 5'CAAGTTGTCATGGATGACC3' Discussion Our results indicate that there is no correlation between CD4 and CD8 mRNA levels and numbers of cells expressing these ... virus type glycoprotein precursor retains a CD4-p56lck complex in the endoplasmic reticulum J Virol 19 92, 66 (4) :22 96- 23 01 Geleziunas R, Bour S, Boulerice F, Hiscott J and Wainberg MA Diminution ... template in a 25 µl PCR The remainder of the reactions were made up by µl PCR Buffer (Gibco BRL, Grand Island, NY), 0 .25 g of each primer, mM MgC 12 in each CD4 reaction and mM MgC 12 for CD8...
- 4
- 319
- 0
Báo cáo y học: " Variability in a dominant block to SIV early reverse transcription in rhesus monkey cells predicts in vivo viral replication and time to death" pot
... 5'-CCTCGGTTTCCCAAAGCAGAA-3'; late RT forward, 5'-AAGCAAGTGTGTGTTCCCATCT-3'; late RT reverse, 5'-CACTTACCTGCAACCGGAGG-3'; integrated forward, 5'-GCTGCCGATTGGGATTTACAAC3'; integrated reverse, 5'-AATGTCTGATCCTCTTGGCTCTC-3' ... SIVsmE 660 replication was defined by TCID50, and SIVsmE543-GFP infection was defined as % GFP+ PBMC following infection with VSV -G pseudotyped SIVsmE 660 -GFP determined using flow cytometric analysis ... as participated in all assays SL participated in B-LCL phenotyping and staging assay TS participated in B-LCL phenotyping, staging, and fusion assay TC participated in staging and fusion assay...
- 11
- 340
- 0
Báo cáo y học: " A multiplex reverse transcription-nested polymerase chain reaction for detection and differentiation of wild-type and vaccine strains of canine distemper virus" pptx
... (5'-AAATCCTGTGTTACCCGCTC-3'), P2 (5'-TGGTGGCTCTGCAATATGAA3'), and P3 (5'-AATGAATGGATGCCTGGGGTTT-3') were used as the primer specific for CDV species, wildtype strains, and vaccine strain Onderstepoort, ... (AF478544), Dog Turkey (AY09 367 4), 5804-Han90 (X85000), 007LMT(AB2 127 29), Dog5B (AY297453), Dog26D (AB040 766 ), Dog98-0 02 (AB 025 270), DogHM-3 (AB040 767 ), Greenland (Z47 760 ), Liu (AF1 724 11), Onderstepoort ... Research Institute, Chinese Academy of Agricultural Sciences, Harbin, China and 2Qingdao Agricultural University, Qingdao 26 6 109, China Received: 28 January 20 10 Accepted: May 20 10 Published: May 20 10...
- 6
- 480
- 0
Báo cáo y học: " The RNA binding protein HuR does not interact directly with HIV-1 reverse transcriptase and does not affect reverse transcription in vitro" doc
... Medicine, Pittsburgh, PA 15 26 1 , USA and 2Department of Medicine, Division of Infectious Diseases, University of Pittsburgh School of Medicine, Pittsburgh, PA 15 26 1 , USA Received: 22 February 20 10 ... HIV-1 replication [23 - 26 ] and that the expression of many inflammatory cytokines, including TNF-α, is tightly regulated at the post-transcriptional level by HuR [27 ] Interestingly, several studies ... Microbe 20 08, 4:495-504 32 Ahn J, Byeon IJ, Byeon CH, Gronenborn AM: Insight into the structural basis of pro- and antiapoptotic p53 modulation by ASPP proteins J Biol Chem 20 09, 28 4:138 12- 13 822 33...
- 7
- 258
- 0
Báo cáo y học: "Early and transient reverse transcription during primary deltaretroviral infection of sheep" ppt
... Clone M36m3-1 Wild-type 5’ LTR Eae I Eae I BLV gag BLV s1 U3 68 cggcca U5 gccggt R 88 gag 67 9 PCR BLV s1 BLV gag U3 69 9 68 R cgAcca U5 gcTggt 88 gag 509 Eae I digestion PCR PCR 67 9 69 9 Eae I digestion ... PCR 63 2 pb 63 2 pb M 45 36 + 4538 4533 + - M 63 2 pb G G C TC C A A G G G C G T C T T G T432C T/C TC C A A G G G C G T C T/C C G G C T T G T 861 7C BLV provirus TG TCT T A C T T 3’ LTR C TG T T G TTT ... 20 08, 5: 16 http://www.retrovirology.com/content/5/1/ 16 B A 5 06 3 96 344 29 8 22 0 20 1 154 134 M -3 S +3 +50 +24 0 M M -3 S M4535 +3 +50 +24 0 M M45 36 D C 5 06 5 06 3 96 3 96 344 344 29 8 29 8 22 0 20 1 22 0...
- 12
- 217
- 0
Báo cáo y học: " Contribution of the C-terminal tri-lysine regions of human immunodeficiency virus type 1 integrase for efficient reverse transcription and viral DNA nuclear import" pps
... by Page 13 of 15 (page number not for citation purposes) Retrovirology 20 05, 2 : 62 using primers including 5'-Alu oligo (5'TCCCAGCTACTCGGGAGGCTGAGG-3') and 3'-LTR oligo (5'-AGGCAAGCTTTATTGAGGGCTTAAGC-3') ... amplifying IN1 -21 2 cDNA are IN- HindIII-ATG-5' and IN -21 2-XmaI3'(5'-CAATTCCCGGGTTTGTATGTCTGTTTGC-3) IN substitution mutants INKK215,9AA-YFP, INKK240,4AE-YFP and INRK 26 3 ,4AA-YFP, were generated by ... replaced an arginine and a lysine at positions of 26 3 and 26 4 by alanines in this region and generated a mutant (INRK 26 3 ,4AA-YFP) The protein expression of different IN- YFP mutants in 29 3T cells...
- 15
- 416
- 0
Harvesting, oil extraction, and conversion of local filamentous algae growing in wastewater into biodiesel
... H.A Great Lakes Cladophora in the 21 st century: Same algae, different ecosystem J Great Lakes Res 20 10, 36( 2) , 24 8 -25 5 ISSN 20 76- 28 95 (Print), ISSN 20 76- 29 09 (Online) 20 13 International Energy ... depending on the season, chlorinated, dechlorinated, and then discharged Figure is a photograph of the algae growing in the launders The algae are a combination of several coexisting species including ... nitrogen dioxide (NO2), which often is greater Additionally, CO and hydrocarbons ISSN 20 76- 28 95 (Print), ISSN 20 76- 29 09 (Online) 20 13 International Energy & Environment Foundation All rights...
- 6
- 488
- 0
Nghiên cứu xây dựng quy trình phát hiện nhanh virus cúm gia cầm a h5n1 trong mẫu bệnh phẩm bằng kỹ thuật multiplex reverse transcription polymerase chain reaction
... DiagMR GTGACAGGATTGGTCTTGTCTT 158-139 55.8 DiagH5F AGTGATCAGATTTGCATTGGTTAC 46- 69 54 .6 DiagH5R GACCAAGAACTTTTGGGGATG 4 16- 3 96 55.4 DiagN1F CCAGTTGGTTGACAATTGGAAT 503- 524 54.5 DiagN1R GCATCAGGATAACAGGAGCA ... and hemagglutination inhibition tests in the diagnosis of influenza A and B virus infections”, Purified hemagglutinin in subtype-specific diagnosis, J Vir.Methods 10, 75-84 34 Kandun IN, Wibisono ... 79 (6) , pp 369 2- 37 02 40 Luong, G and P Palese (19 92) , “Genetic analysis of influenza virus”, Curr Opinion Gen Develop, 2: p 77-81 41 Ng EK, Cheng PK, Ng AY, Hoang TL, and Lim WW (20 05), “Influenza...
- 11
- 581
- 0
Tài liệu Báo cáo khoa học: Efficient RNA ligation by reverse-joined hairpin ribozymes and engineering of twin ribozymes consisting of conventional and reverse-joined hairpin ribozyme units ppt
... SU9 U A 6 0. 564 140.8 SG9 G A 0.938 141.1 SU9 U A 0.894 109.3 SG9 G A 1.140 75.3 SU9 U A 0.535 73.9 SG9 G A 0. 865 97.3 SU9 U A 12 0. 26 3 76. 6 SG9 G A 13 0.447 85.4 35 .2 55.8 43.7 61 .0 35.0 63 .3 43.3 ... introduced by Ohtsuka and colleagues [29 ,30], are derived from the conventional hairpin ribozyme by dissecting the two domains at the hinge between helix and helix and rejoining helix to helix via a linker ... extended inactive conformation [34,35] Because of the single-stranded linker, FEBS Journal 27 2 (20 05) 4 464 –4474 ª 20 05 FEBS An engineered ribozyme for RNA sequence exchange joining the two domains in...
- 11
- 481
- 0
Tài liệu Báo cáo khoa học: "Extraction and Approximation of Numerical Attributes from the Web" pdf
... 80 82 82 76 40 40 16 14 64 34 Height 79 84 84 86 56 56 16 11 72 25 Width 74 76 76 86 45 45 17 15 75 26 Weight 71 73 73 82 57 57 24 22 61 39 Depth 82 82 82 89 60 60 19 19 92 58 Total average 77 ... 84 52 52 18 16 72 36 TREC QA 87 90 90 100 62 62 13 57 20 NOB NOC 82 54 14 53 %Exact %Approx 79 70 16 53 76 60 15 63 77 71 19 53 90 84 40 FULL 82 78 19 63 79 64 16 62 NOCB Size 18.0 Weight 12. 5 ... KRAQ 06 ’ 06 John Prager, 20 06 Open-domain question-answering In Foundations and Trends in Information Retrieval,vol 1, pp 91 -23 1 13 16 Patrick Pantel and Marco Pennacchiotti 20 06 Espresso: leveraging...
- 10
- 465
- 0
Tài liệu Báo cáo khoa học: "A Mobile Touchable Application for Online Topic Graph Extraction and Exploration of Web Content" ppt
... feeling 33% 50% 17% 4% v.good good avg poor results first sight query answered interesting facts suprising facts 43% 65 % 62 % 66 % 38% 20 % 24 % 15% 20 % 15% 10% 13% 4% 6% overall feeling 54% 28 % 14% ... and is labeled with the corresponding PoS–tagged word group Node actions are used to trigger additional processing, e .g. , displaying the snippets, expanding the graph etc The nodes and edges ... G nter Neumann 20 06 Lanu guage Independent Answer Prediction from the Web In proceedings of the 5th FinTAL, Finland Eugenie Giesbrecht and Stefan Evert 20 09 Part-ofspeech tagging - a solved task?...
- 6
- 458
- 0
Tài liệu Báo cáo khoa học: "Integrating Information Extraction and Automatic Hyperlinking" docx
... converting linguistic resources Proceedings of LREC 20 02, Las Palmas, Spain, 20 02 A Przepiórkowski and M Wolinski The Unbearable Lightness of Tagging: A Case Study in Morphosyntactic Tagging of Polish ... Proceedings of ILT&CIP, 20 01 Figure 2: ExtraLink GUI The links in the right-hand window are generated after clicking on the marked named entity for Lisbon (marked in dark) The bottom left window ... languages covered by SProUT This involves the adaptation of the mapping into the ontology and a multilingual presentation of the ontology in the link target page D Petitpierre and G Russell MMORPH–the...
- 4
- 356
- 0
Tài liệu Báo cáo khoa học: "A HARDWARE ALGORITHM FOR HIGH SPEED MORPHEME EXTRACTION AND ITS IMPLEMENTATION" pptx
... text parsing systems This process is necessary for natural language parsing, because it is the first step in the parsing However, it is more laborious for Japanese and several other languages, which ... string in the morpheme dictionary and one sub-string of input text is repeated This is one to one comparison On the other hand, many to one comparison or one to many comparison is practicable in ... Unification Grammar", Proc l Oth International Joint Conference on Artificial Intelligence: 61 5 -61 8 Hamaguehl, S mad Suzuki, Y (1988) "Haxdwaxe-matchlng Algorithm for High Speed Linguistic Processing in...
- 8
- 504
- 0
Building bone vitality: A Revolutionary Diet Plan to Prevent Bone Loss and Reverse Osteoporosis pdf
... Kingdom 1977 1 16 United Kingdom 1978–79 111 Finland 1980 97 Finland 1970 93 Israel 1957 66 91 United Kingdom 1975 88 Netherlands 1 967 –79 77 United Kingdom 1954–58 76 Ireland 1 968 –73 72 Finland ... 1 .2 19 92, Yale Researchers (continued) Hip Fracture Rate Country Data Collected During 28 Former Yugoslavia 1 969 – 72 22 Singapore 1955 62 21 Former Yugoslavia 1 968 –73 South Africa (black) 1957 63 ... (non-Kuwaitis) 1995 399 Germany (former West) 19 96 355 Germany (former East) 19 96 3 46 Switzerland 19 92 3 16 Kuwait (Kuwaitis) 1995 29 7 Japan 1994 26 2 Thailand 1998 21 3 Malaysia 1998 168 Brazil 20 00 165 ...
- 257
- 268
- 1
Glycemic Load Diet Cookbook: 150 RECIPES TO HELP YOU LOSE WEIGHT AND REVERSE INSULIN RESISTANCE docx
... following pages, I’ll be guiding you through the ins and outs of cooking and eating according to Dr Rob’s glycemic-load diet, drawing on Dr Rob’s expertise of course The purpose of this cookbook is ... oz 12 oz 2 oz oz oz oz 51⁄3 oz oz oz oz oz oz oz 1¾ oz oz oz oz 3¼ oz oz 1¾ oz 5½ oz oz oz oz oz oz 2 oz oz Load 3 46 340 314 301 28 3 2 76 26 0 2 46 23 4 22 7 22 2 21 9 21 8 21 3 20 8 20 5 199 171 169 154 ... this by preventing large amounts of glucose from rushing into your bloodstream all at once Eliminating these “glucose shocks” not only helps you lose weight while continuing to enjoy satisfying...
- 286
- 421
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ rôto dây quấn đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008