6 irg1 prok 2 hdc and puma g mrna upregulation in msu stimulated mouse peritoneal macrophages

Báo cáo y học: "Human palatine tonsil: a new potential tissue source of multipotent mesenchymal progenitor cells" pdf

Báo cáo y học: "Human palatine tonsil: a new potential tissue source of multipotent mesenchymal progenitor cells" pdf

Ngày tải lên : 09/08/2014, 10:23
... CTGCAGTAGCTGCACGTGTT Cartilage-specific genes AGN Sense: TGCGGGTCAACAGTGCCTATC Antisense: CACGATGCCTTTCACCACGAC COL2A1 Sense: GGAAACTTTGCTGCCCAGATG Antisense: TCACCAGGTTCACCAGGATTGC AGN, aggrecan; ... ATGAGAGCCCTCACACTCCTC Antisense: GCCGTAGAAGCGCCGATAGGC Adipose-specific genes LPL Sense: GAGATTTCTCTGTATGGCACC Antisense: CTGCAAATGAGACACTTTCTC PPARγ Sense: TGAATGTGAAGCCCATTGAA Antisense: CTGCAGTAGCTGCACGTGTT ... 710–8 76 167 Housekeeping gene GAPDH Sense: GGACTCATGACCACAGTCCATGCC Antisense: TCAGGGATGACCTTGCCCACA Bone-specific genes ALP Sense: TGGAGCTTCAGAAGCTCAACACCA Antisense: ATCTCGTTGTCTGAGTACCAGTCC OC...
  • 12
  • 359
  • 0
ENDOTHELIAL COLONY FORMING CELLS (ECFCS): IDENTIFICATION, SPECIFICATION AND MODULATION IN CARDIOVASCULAR DISEASES

ENDOTHELIAL COLONY FORMING CELLS (ECFCS): IDENTIFICATION, SPECIFICATION AND MODULATION IN CARDIOVASCULAR DISEASES

Ngày tải lên : 24/08/2014, 11:47
... area on 21 q 22. 2 to proximal 21 q 22. 3 and an approximate 6Mb region on 21 q 22. 2 and part of 21 q 22. 3 (DELABAR et al 1993) It was originally purported that this one or more of the genes in this region ... and Chr16rev_5’TGGCTTATTATTATCAGGGCATTT-3’ and amplified an approximate 27 5-bp region Positive control primers utilized were IMR1781_5’-TGTCTGAAGGGCAATGACTG-3’ and IMR17 82_ 5’-GCTGATCCGTGGCATCTATT-3’ ... 41 2 .6 In vivo Assessment of the Effects of EGCG 42 2 .6. 1 Treatment Technique 42 2 .6. 2 Embryo Processing 42 2 .6. 3 Histology …… 43 2 .6. 4 Stereological Analysis...
  • 144
  • 200
  • 0
ENDOTHELIAL COLONY FORMING CELLS (ECFCS): IDENTIFICATION, SPECIFICATION AND MODULATION IN CARDIOVASCULAR DISEASES

ENDOTHELIAL COLONY FORMING CELLS (ECFCS): IDENTIFICATION, SPECIFICATION AND MODULATION IN CARDIOVASCULAR DISEASES

Ngày tải lên : 24/08/2014, 11:59
... this process, including FGF signaling (Poole et al 20 01, Smith 1989), Wnt signaling (Wang & Wynshaw-Boris 20 04, Zerlin et al 20 08), BMP signaling (Winnier et al 1995) TGFβ signaling (Sirard et ... 20 02) Recent studies indicate that Nrp signaling can be independent of VEGF/KDR, by binding Nrp interacting proteins (NIPs) such as RGS-GAIP Interacting Protein (GIPC) and Synectin (Cai & Reed 1999, ... and regulates EC functions via autocrine and paracrine VEGF signaling It is very interesting to note that intracellular VEGF/KDR signaling plays an important role in maintaining EC viability and...
  • 216
  • 232
  • 0
Publication Information and Contributors Forming and Forging was published P1

Publication Information and Contributors Forming and Forging was published P1

Ngày tải lên : 18/10/2013, 04:15
... forging Precision forging Metal powder forging Radial forging Upsetting Rolling Sheet rolling Shape rolling Tube rolling Ring rolling Rotary tube piercing Gear rolling Roll forging Cross rolling ... straight flanging Brake bending Roll bending Surface contouring of sheet Contour stretch forming (stretch forming) Androforming Age forming Creep forming Die-quench forming Bulging Vacuum forming ... Vacuum forming Linear stretch forming (stretch forming) Linear roll forming (roll forming) Deep recessing and flanging Spinning (and roller flanging) Deep drawing Rubber-pad forming Marform process...
  • 30
  • 547
  • 0
Java Testing and Design: From Unit Testing to Automated Web Tests pptx

Java Testing and Design: From Unit Testing to Automated Web Tests pptx

Ngày tải lên : 24/03/2014, 05:21
... Testing 30 30 v 22 19 15 10 vi Contents Defining Test Agents 30 Scalability and Performance Testing with Test Agents Testing for the Single User 35 Creating Intelligent Test Agents Automated Testing ... 140 145 1 46 Installing TestMaker on a Windows or Linux Computer Running TestMaker 148 Getting to Know the TestMaker Graphic Environment Opening and Running Test Agents 150 Building Agents with ... Java Integration 165 Bean Property Introspection 165 Sun Is Adopting Scripting in Java 166 Using Jython to Incorporate JUnit 166 JUnit for Repeatable Tests 166 A JUnit Example 167 JUnit and TestMaker...
  • 512
  • 369
  • 0
cytokines and colony stimulating factors

cytokines and colony stimulating factors

Ngày tải lên : 11/04/2014, 01:12
... ACCCAGGAATGTTTCCCATGC TCTGTCAATAGTCACTGCCCG Interleukin- 12 p40 AAAGGAGGCGAGGTTCTAAGCC TTTGCGGCAGATGACCGTGG -Actin GTGGGGCGCCCCAGGCACCA CTCCTTAATGTCACGCACGATTTC Product size (bp) Annealing temp ... IgG1), IL-8 (G 26 5 -8, mouse IgG2b), TNF- (Mab11, mouse IgG1), MCP-1 (5D3-F7, mouse IgG1) and MIP-1 (11A3, mouse IgG2a) were all purchased from Pharmingen (Heidelberg, Germany) 2 .6 Flow-Cytometric ... M., Banning, U., Mauz-Körholz, C., Kramm, C., et al (20 00) Regulation of interleukin -2 induced interleukin-5 and interleukin-13 22 15 16 17 18 19 20 21 Banning and Körholz production in human...
  • 463
  • 158
  • 0
Báo cáo hóa học: " The Effects of Notch Filtering on Electrically Evoked Myoelectric Signals and Associated Motor Unit Index Estimates" ppt

Báo cáo hóa học: " The Effects of Notch Filtering on Electrically Evoked Myoelectric Signals and Associated Motor Unit Index Estimates" ppt

Ngày tải lên : 19/06/2014, 08:20
... number index (MUNIX): principle, method, and findings in healthy subjects and in patients with motor neuron disease Muscle Nerve 20 10, 42: 798-807 23 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 Nandedkar ... filtering on, which was lower than the MUNIX value of 27 9 for the notching filtering off 12 Across all subjects (Figure 2b), the MUNIX value was 1 82 51 (range: 67 -24 3) for notch filtering on and 22 2±58 ... (range: 92- 221 ) for notch filtering on and 20 4±47 (range: 113 -27 3) for notch filtering off (p
  • 34
  • 449
  • 0
Báo cáo toán học: " Packing and covering a unit equilateral triangle with equilateral triangles" pot

Báo cáo toán học: " Packing and covering a unit equilateral triangle with equilateral triangles" pot

Ngày tải lên : 07/08/2014, 13:21
... packing of T by n2 equilateral triangles with sides of length n Such a configuration is called an n2 -grid When T is a unit equilateral triangle, the packing is a standard n2 -packing See Figure ... with an a2 -grid packing the same area The result is a packing of (k+1 )2 −(a+1 )2 +a2 = (k+1 )2 −2a−1 = 1 n equilateral triangles, the sum of whose length is [(k + 1 )2 −(a+ 1 )2 ] k+1 + a2 ( a+1 ... resulting k −1 equilateral triangles can’t be smaller This covering is a minimal covering, so T2 (k − 1) ≥ k − 2k It’s easy to see that a standard n-packing is also a standard n-covering By the...
  • 8
  • 257
  • 0
Báo cáo y học: "Hypoxia regulates human lung fibroblast proliferation via p53-dependent and -independent pathways" ppsx

Báo cáo y học: "Hypoxia regulates human lung fibroblast proliferation via p53-dependent and -independent pathways" ppsx

Ngày tải lên : 12/08/2014, 14:20
... 5'TCAAAACTCCCAAGCACCTC-3'; p53 forward primer 5'GTTCCGAGAGCTGAATGAGG-3', reverse primer 5'TTATGGCGGGAGGTAGACTG-3'; β-actin forward primer 5'-GCAAGCAGGAGTATGACGAG-3', reverse primer 5'CAAATAAAGCCATGCCAATC-3' ... B-Bridge International Inc (Sunnyvale, CA, USA) The p21, p27, p53 and negative control siRNA target sequences were 5'-CGUCAGAACCCAUGCGGCA-3', 5'-GGAGCAAUGCGCAGGAAUA-3', 5'-CUGGAAGA CU CCAGUGGUA-3', and ... p21, p27, p53, and β-actin The primers used were as follows: p21 forward primer 5'GGAAGACCATGTGGACCTGT-3', reverse primer 5'GGCGTTTGGAGTGGTAGAAA-3'; p27 forward primer 5'GCCCTCCCCAGTCTCTCTTA-3',...
  • 12
  • 284
  • 0
Báo cáo khoa học: "The influence of volume and intensive care unit organization on hospital mortality in patients admitted with severe sepsis: a retrospective multicentre cohort study" ppsx

Báo cáo khoa học: "The influence of volume and intensive care unit organization on hospital mortality in patients admitted with severe sepsis: a retrospective multicentre cohort study" ppsx

Ngày tải lên : 13/08/2014, 03:20
... Lancet 20 04, 363 :1147-1154 Garland A: Improving the ICU: part Chest 20 05, 127 :21 51 -2 164 Glance LG, Szalados JE: Benchmarking in critical care: the road ahead Chest 20 02, 121 :3 26 - 328 25 26 Pronovost ... in drafting the manuscript NP assisted in the statistical analyses, in interpreting the results and in drafting the manuscript GJS was involved in the set-up of the NICE registry and helped in ... 1.01 (3.8) 0.9 56 (0. 861 –1. 063 ) 0.4 06 General physiciane 60 .7 (17) 0.981 (0.741–1 .29 8) 0.891 Residents 96. 4 (27 ) b b Fellows in training for intensivist 21 .4 (6) 1.014 (0.749–1.374) 0. 927 MCU as a...
  • 10
  • 276
  • 0
listen and read ò unit 9

listen and read ò unit 9

Ngày tải lên : 10/02/2015, 06:00
... Getting Started  Listen and Read GETTING STARTED GETTING STARTED : What are these people in this picture doing? a/ swimming in the river b/ feeding the pig c/ plowing with buffalo d/ watering ... watering the vegetables e/ flying a kite on buffalo f/ collecting the eggs g/ playing soccer h/ harvesting the crop She is watering the vegetables They are swimming in the river She is collecting ... the eggs They are harvesting the crop He is feeding the pig He is plowing with his buffalo He is flying a kite on his buffalo They are playing soccer swim feed the chickens water the vegetables...
  • 29
  • 214
  • 0
ELA and literacy curriculum unit 2 workbook

ELA and literacy curriculum unit 2 workbook

Ngày tải lên : 08/06/2015, 13:45
... dropped and replaced with -ing Root Word Suffix Spelling Word smile -ing smiling race -ing racing hope -ing hoping bake -ing baking invite -ing inviting confuse -ing confusing taste -ing tasting compete ... tasting compete -ing competing hop -ing hopping Tricky Word: were Unit © 20 13 Core Knowledge Foundation 29 30 Unit © 20 13 Core Knowledge Foundation 6. 2 Name Title: Characters Setting Middle Plot ... 34 Unit © 20 13 Core Knowledge Foundation 8 .2 Name Directions: Have students write the correct word for each sentence and then insert quotation marks doing enjoying giving writing hoping Mom asked,...
  • 190
  • 335
  • 0
ELA and literacy curriculum unit 4 workbook

ELA and literacy curriculum unit 4 workbook

Ngày tải lên : 08/06/2015, 13:45
... to see the Green Fern Zoo We will see things with wings and things with scales, things that bite and things that sting, things that creep and things that swim I have lots of fun facts and tales ... writing the letters Name 4.1 1 2 1 2 2 2 2 2 2 © 20 13 Core Knowledge Foundation Unit 13 Print the words on the lines where they fit best arm car star yarn cart 14 Unit © 20 13 Core Knowledge Foundation ... challenging than the previous one-syllable words Your child may find it helpful to practice writing and remembering the spelling words syllable by syllable Spelling Words Lesson 11 zipper barking...
  • 184
  • 212
  • 0
ELA and literacy curriculum unit 1 teacher guide

ELA and literacy curriculum unit 1 teacher guide

Ngày tải lên : 03/10/2015, 21:38
... (15 min) Teacher Chaining (10 min) Teacher Chaining (10 min) Teacher Chaining (10 min) Teacher Chaining (10 min) Teacher Chaining (10 min) Dictation (10 min) Dictation (10 min) Dictation (10 min) ... Reading with Teacher (25 min) The Tricky Spelling ‘s’ (15 min) 60 60 (10 min) 60 Whole Group: “The Fish” (20 min) Whole Group: “The Milk” (20 min) 60 60 Week Five Day 21 (Lesson 21 ) Day 22 (Lesson ... (hiccup), and ‘ck’ > /k/ (black) • g > /g/ (gift) and ‘gg’ > /g/ (egg) • ‘ch’ > /ch/ (chin) and ‘tch’ >/ch/ (itch) • ‘j’ > /g/ (jump), g > /g/ (gem), and ‘ge’ >/ ge/ (fringe) • ‘f’ > /f/ (fit) and...
  • 254
  • 874
  • 0
Interaction between legionella pneumophila and biofilm forming organism pseudomonas aeruginosa

Interaction between legionella pneumophila and biofilm forming organism pseudomonas aeruginosa

Ngày tải lên : 08/11/2015, 16:31
... development 27 2. 2.4.1 Stage 1: Reversible attachment 27 2. 2.4 .2 Stage 2: Irreversible attachment 28 2. 2.4.3 Stage 3: Maturation-1 29 2. 2.4.4 Stage 4: Maturation -2 29 2. 2.4.5 Stage 5: Dispersion 30 2. 2.5 ... Contents 2. 1.5.5 Interaction of Legionella with Pseudomonas spp 2. 2 Biofilm 24 24 2. 2.1 Introduction to biofilm 24 2. 2 .2 General characteristics of biofilm 25 2. 2.3 Biofilm development 26 2. 2.4 Stages ... Wang Shugui and especially Chow Wai Ling and Janice Yong Jing Ying for their generous help, precious friendship and incredible understanding when absentmindedness get the better of me Post-graduate...
  • 195
  • 144
  • 0
SYLLABUS FAMILY AND FRIENDS 5 UNIT 1  6

SYLLABUS FAMILY AND FRIENDS 5 UNIT 1 6

Ngày tải lên : 06/01/2016, 14:42
... Speaking 19 Writing and Speaking 20 Reading and Speaking 21 22 23 24 Listening and Speaking Writing and Speaking Listening, Speaking and Writing Listening and Speaking Putting on a play Putting ... context 59 60 Speaking and Writing 55 56 Speaking and Writing Reading 57 Listening and Speaking 58 Writing 59 Listening, Speaking and Writing 60 -63 Reading Final English Test Outdoor teaching and course ... Lesson 2: Words 20 21 22 25 26 Writing and Listening Reading, Writing and Speaking Household items 27 Writing and Speaking 23 Extra Lesson Outdoor teaching Lesson 5: Skills time! Reading Reading:...
  • 7
  • 4.3K
  • 62
Báo cáo y học: "The epidemiology of intensive care unit-acquired hyponatraemia and hypernatraemia in medical-surgical intensive care unit"

Báo cáo y học: "The epidemiology of intensive care unit-acquired hyponatraemia and hypernatraemia in medical-surgical intensive care unit"

Ngày tải lên : 25/10/2012, 10:31
... (%) 26 5 (29 ) 129 4 ( 26 ) 599 (28 ) Night admission, number (%) 5 36 (58) 27 87 (55) 1 26 7 (59) Neurological/trauma 2 56 (28 ) 127 9 (25 ) 60 7 (28 ) Surgical 25 5 (28 ) 1570 (31) 570 ( 26 ) Medical 404 (44) 21 91 ... (13) 28 0 (13) Trauma and neurosurgery referral ICU 534 (58) 2 568 (51) 1 127 ( 52) Vascular surgery referral ICU 21 4 (23 ) 1388 (27 ) 595 (28 ) General medical-surgical ICU 169 (18) 11 12 (22 ) 435 (20 ) ... (41) 866 (40) Emergency department 337 (37) 19 26 (38) 833 (39) Operating room 24 3 (27 ) 1450 (29 ) 509 (24 ) Hospital floor 21 7 (24 ) 1049 (21 ) 534 (25 ) Transfer from another facility 118 (13) 63 2 (13)...
  • 8
  • 721
  • 0
Báo cáo y học: "Randomized trial comparing daily interruption of sedation and nursing-implemented sedation algorithm in medical intensive care unit patients"

Báo cáo y học: "Randomized trial comparing daily interruption of sedation and nursing-implemented sedation algorithm in medical intensive care unit patients"

Ngày tải lên : 25/10/2012, 10:35
... 26 (22 .9, 28 .8) 24 (21 .6, 27 .4) 0. 52 Sequential Organ Failure Assessment score 10 (8 .2, 10.9) (7 .6, 10.3) 0.50 Midazolam equivalents before randomization in mg/kg, median (IQR) 0.5 (0.05, 2 .61 ) ... Clinical Microbiology and Infectious Diseases, et al.: Surviving sepsis campaign: international guidelines for management of severe sepsis and septic shock: 20 08 Crit Care Med 20 08, 36: 2 96- 327 ... 9.1, 21 .2 6. 5, 8.7 < 0.0001 Hospital length of stay, days 23 14.8, 28 .7 12 11.3, 16. 0 0.01 Median IQR Median IQR 16. 1 0.00, 21 .77 23 .1 19. 16, 25 . 06 0.004 Midazolam equivalents, mg/kg-day 0 .2 0.01,...
  • 9
  • 605
  • 0
Báo cáo y học: "Strict glycaemic control in patients hospitalised in a mixed medical and surgical intensive care unit: a randomised clinical trial"

Báo cáo y học: "Strict glycaemic control in patients hospitalised in a mixed medical and surgical intensive care unit: a randomised clinical trial"

Ngày tải lên : 25/10/2012, 10:35
... days was 32. 4% (81 of 25 0) in the standard insulin group and 36. 6% (93 of 25 4) in the intensive insulin group ICU mortality was similar for patients of the standard insulin group and in those ... The mean calorie intake in 24 hours was 23 .1 ± 12. 7 kcal/kg in the standard insulin group and 25 .5 ± 14.4 kcal/kg in the intensive insulin group (mean difference: 2. 4; 95% CI: -0. 02 to 4.9) Total ... insulin group (p = 0.3 32) Admissions due to infections were similar in both groups: 82 patients of 25 0 ( 32. 8%) in the standard insulin group and 83 of 25 4 ( 32. 7%) in the intensive insulin group...
  • 9
  • 635
  • 0
Báo cáo khoa học: " Medication errors: a prospective cohort study of hand-written and computerised physician order entry in the intensive care unit"

Báo cáo khoa học: " Medication errors: a prospective cohort study of hand-written and computerised physician order entry in the intensive care unit"

Ngày tải lên : 25/10/2012, 10:39
... abbreviated drug name led to a patient receiving the wrong drug, but it is regarded as poor prescribing practice as defined by our own prescribing guidelines and national guidelines [ 16] CPOE effectively ... HWP, hand-written prescribing Table Error outcome category analysis Error category None Minor Moderate/major Total 993 (95.9%) 43 (4 .2% ) (0%) 10 36 23 32 ( 96. 0%) 93 (3.8%) (0 .2% ) 24 29 HWP 967 (93.3%) ... following dates: 17 September 20 01 for days; 24 September 20 01 for days CPOE data collection began on the following dates: 15 April 20 02 for days; 10 June 20 02 for days; 27 September 20 02 for days; and...
  • 6
  • 526
  • 0

Xem thêm