53 invest in the long term with a prototype that sets a strong foundation
Báo cáo y học: " Change in quality of life and their predictors in the long-term follow-up after group cognitive behavioral therapy for social anxiety disorder: a prospective cohort study" pptx
Ngày tải lên :
11/08/2014, 16:22
... a a a a a a a a a Generalized SAD -0.22* a a a a a a -0.28* a a a a a a a a a a a a a a a a Benzodiazepine use 0.23* a a a a a a a a a a a a a a a a a a a a a a a SPS (total) a a a a a a a a a ... Age: 35 yrs or older a a a a a a 0.41* a a a a a a a a a a a a a a a a a Living situation a a a a -0.32** a a a a a a a a a a a a a a a a a a a Employment a a a a a a a a a a a a -0.30* a a a ... 0.39* a 0.29* a a a a a a a a a 0.49** a a SIAS (total) SCL-90-R depression a a a a a -0.44** a a a a a a a a a a a a a -0.64** a a a a a a a a a -0.46** a a a a a a a a a a a a -0.32* -0.41* a -0.61**...
- 10
- 388
- 0
Báo cáo y học: " Activation instead of blocking mesolimbic dopaminergic reward circuitry is a preferred modality in the long term treatment of reward deficiency syndrome (RDS): a commentary" potx
Ngày tải lên :
13/08/2014, 16:21
... neurons in the ventral tegmental area (VTA) allows them to release dopamine in the NAc and (via amygdala) in certain parts of the hippocampus, permitting the completion of the cascade and the development ... increase (approximately 50%, p < 0.05) in extracellular NAc GABA levels, but failed to alter either basal or cocaine-enhanced NAc DA These data suggest that Gabapentin is a weak GABA-mimic drug At the ... hunger and withdrawal against advice rate of cocaine abusers in a 30 day inpatient treatment program with the neuronutrient tropamine Curr Ther Res 1988; 43:1204 Alcohol and Cocaine SAAVE and Tropamine...
- 16
- 405
- 0
Báo cáo y học: "Long term follow up after surgery in congenitally corrected transposition of the great arteries with a right ventricle in the systemic circulation" pot
Ngày tải lên :
10/08/2014, 09:22
... dextrocardia and a long history of cardiac failure before transplantation The second patient also had a dextrocardia, with additionally mitral and aorta regurgitation, resulting in cardiac failure, finally ... cardiac transplantation at ages 33, 34 and 47 respectively These three patients had an intact atrial and ventricular septum and an adequate subpulmonary outflow One patient had a dextrocardia ... palliative procedure In all of these patients a VSD was present In patients there was pulmonary stenosis and in a pulmonary atresia In of them an ASD was present In all patients the ventricular...
- 7
- 387
- 0
Tài liệu The long-term reproductive health consequences of female genital cutting in rural Gambia: a community-based survey doc
Ngày tải lên :
13/02/2014, 16:20
... several large ethnic groups in The Gambia (Singhateh 1985) A national campaign to eliminate FGC in The Gambia was launched in 1997 In the same year, the government banned national radio and television ... to partial or total removal of the clitoris together with partial or total excision of the labia minora Type III is partial or total removal of the external genitalia and stitching or narrowing ... have attended primary school Around 95% of women report farming and working in the household as their main occupation (Walraven et al 2001) There has been no active campaign against FGC at the...
- 11
- 558
- 0
Báo cáo khoa học: "Pulmonary intravascular lymphoma diagnosed by 18fluorodeoxyglucose positron emission tomography-guided transbronchial lung biopsy in a man with long-term survival: a case report" pot
Ngày tải lên :
10/08/2014, 23:21
... interpreted the histological findings regarding intravascular lymphoma AK and FK performed chemotherapy KH interpreted the patient’s radiological findings MK supervised the clinical examination FO ... Kitanaka A, Kubota Y, Imataki O, Ohnishi H, Fukumoto T, Kurokohchi K, Tanaka T: Intravascular large B-cell lymphoma with FDG accumulation in the lung lacking CT/(67)gallium scintigraphy abnormality ... Thorac Imaging 2009, 24:231-233 Yamagata T, Okamoto Y, Ota K, Katayama N, Tsuda T, Yukawa S: A case of pulmonary intravascular lymphomatosis diagnosed by thoracoscopic lung biopsy Respiration...
- 6
- 181
- 0
Báo cáo y học: " Sustained favorable long-term outcome in the treatment of schizophrenia: a 3-year prospective observational study" ppsx
Ngày tải lên :
11/08/2014, 15:22
... and without sustained favorable long- term outcome over the 2-year postbaseline period are shown in Table In general, the univariate analyses showed that patients with sustained favorable long- term ... identifying those with sustained favorable long- term outcome, which was the main outcome of interest A patient was classified as having sustained favorable long- term outcome if they were in the “best” ... imputations of missing values, was used to determine baseline factors associated with sustained favorable long- term outcome A total of 62 variables, including the patient-reported variables, clinician-rated...
- 12
- 378
- 0
Báo cáo y học: " Factors affecting the long-term response to tacrolimus in renal transplant patients: Pharmacokinetic and pharmacogenetic approac"
Ngày tải lên :
26/10/2012, 09:32
... denaturation), 1min at 55οC (primer annealing), 1min at 72οC (primer extension) and finally, 7min at 72οC (final elongation) The PCR product was analyzed on a 2% agarose/Tris-borate EDTA gel with ... for the analysis of such data but it is more demanding in the quantity of available data In the LR analysis, the kinetic parameters were modeled based on sex, presence of CYP 3A5 *1 allele, age at ... variable It assumes that the model depends linearly on the unknown parameters and the conditional mean of Y variable given the value of X is an affine function of X In GLM repeated measures approach,...
- 7
- 785
- 0
Tài liệu Is the long-term interest rate a policy victim, a policy variable or a policy lodestar? docx
Ngày tải lên :
17/02/2014, 03:20
... interest rate exposures in the financial industry; and a more cyclical bond market During the financial crisis, central banks in the advanced countries have made the long- term interest rate a ... that trigger further sales in a market that is already falling Is the long- term interest rate a policy victim? (a) Macroeconomic factors: US monetary policy or the global saving rate The idea ... rise in the marginal propensity to save in developing Asia Graph shows that the marginal propensity to save in developing Asia has been above 40% for almost a decade In the years before the sub-prime...
- 39
- 514
- 0
Báo cáo khoa học: Enhancing the protein production levels in Escherichia coli with a strong promoter potx
Ngày tải lên :
06/03/2014, 01:20
... lacUV5 and trc were amplified by PCR from vectors including the relevant genes By using primers TEHA1: ACACAGATCTCTGCAGGGCACCCCAGGCTTTACA and TEHA2: ACACCCATGGAGCTTTCCTGTGTGAAATTGT, lacUV5 was ... sequence in the T7 vector, AAGGAG, is longer than the one used in the lacUV5 and trc vectors, AGGA (Doc S2) A study by Ringquist et al [23] concluded that the SD sequence UAAGGAGG initiates translation ... about the amount of soluble produced protein was obtained from the SDS ⁄ PAGE and western blotting analyses and compared with the data obtained when analyzing the same protein in vitro Because eGFP...
- 11
- 445
- 0
Báo cáo khoa học: Fast set-up of doxycycline-inducible protein expression in human cell lines with a single plasmid based on Epstein– Barr virus replication and the simple tetracycline repressor ppt
Ngày tải lên :
23/03/2014, 09:21
... eGFP, the 5¢ interface is GGTACCG CGGGCCCGGGATCCATC gccacc ATGG TGA; the 3¢ interface is CAAGTAAA GCGGCCGC For pEBTetD ⁄ eGFP, the 5¢ interface is identical; the 3¢ interface is CAAGTAAA GCGGCCGCGG ... 5¢ interface between cDNA and pEBTet is AAGCTT GAATTCTGCAGAT TCGA gccacc ATGCGGGA (polylinker in bold, Kozak motif in lower case, cDNA underlined); the 3¢ interface is ATTTCTAGA TCCAGCAC For pEBTetD ... SLC2 2A1 6h, the 5¢ interface is GGTACC CCCCCGGA; the 3¢ interface is ATGCCTGC GGGGATCCAC TAGTAACGGC CGCC AGTGTG CTGGAATTCT GCAGATATCC ATCACAC TGGCGGCC The cDNA of eGFP corresponds to GenBank entry...
- 8
- 331
- 0
báo cáo hóa học: " The reliability and validity of the SF-8 with a conflict-affected population in northern Uganda" doc
Ngày tải lên :
18/06/2014, 19:20
... data analysis and review BR, JB involved in drafting and reviewing the manuscript KFO, TO, ES involved in reviewing the manuscript Acknowledgements Assistance with data for the sample frame was ... References 10 11 Boas MHA: Northern Uganda IDP Profiling Kampala: UNDP/ GoU/FAFO; 2005 Internally Displaced Camps in Lira and Pader, Northern Uganda A Baseline Health Survey Preliminary Report [http://www.msf.or.jp/news/baseline/Baseline.pdf] ... Mental health, social functioning, and disability in postwar Afghanistan JAMA 2004, 292(5):575-584 Lopes Cardozo B, Vergara A, Agani F, Gotway CA: Mental health, social functioning, and attitudes...
- 10
- 647
- 0
báo cáo hóa học:" The long-term benefit of computer-assisted surgical navigation in unicompartmental knee arthroplasty" doc
Ngày tải lên :
20/06/2014, 04:20
... 0.908) with disagreements and 19 agreements The disagreements were in the adjacent zones and may represent the effects of weightbearing The mechanical axis crossed the tibial plateau at a mean or ... We used the same radiological methods and statistical analyses; clinical results had not been examined in the previous study Radiologic examination consisted of weightbearing long leg antero-posterior ... was a higher variance in the non-navigated group, with a SD 22.5% in the non-navigated group versus 15.1% in the navigated group Examining Kennedy zones, 16 knees were well aligned (in zone and...
- 5
- 405
- 0
báo cáo hóa học:" The long-term benefit of computer-assisted surgical navigation in unicompartmental knee arthroplasty" pptx
Ngày tải lên :
20/06/2014, 07:20
... 0.908) with disagreements and 19 agreements The disagreements were in the adjacent zones and may represent the effects of weightbearing The mechanical axis crossed the tibial plateau at a mean or ... We used the same radiological methods and statistical analyses; clinical results had not been examined in the previous study Radiologic examination consisted of weightbearing long leg antero-posterior ... was a higher variance in the non-navigated group, with a SD 22.5% in the non-navigated group versus 15.1% in the navigated group Examining Kennedy zones, 16 knees were well aligned (in zone and...
- 5
- 512
- 0
Báo cáo hóa học: " Research Article A Hilbert-Type Integral Inequality in the Whole Plane with the Homogeneous Kernel of Degree −2 Dongmei Xin and Bicheng Yang" pdf
Ngày tải lên :
21/06/2014, 05:20
... 2 Journal of Inequalities and Applications All of the above inequalities are built in the quarter plane Yang 10 built a new Hilbert-type integral inequality in the whole plane as follows: ... Mathematical Analysis and Applications, vol 325, no 1, pp 529–541, 2007 D M Xin, A Hilbert-type integral inequality with a homogeneous kernel of zero degree,” Mathematical Theory and Applications, ... where the constant factor π is the best possible Zeng and Xie 11 also give a new inequality in the whole plane By applying the method of 10, 11 and using the way of real and complex analysis, the...
- 11
- 386
- 0
Báo cáo hóa học: "Approaching the MIMO Capacity with a Low-Rate Feedback Channel in V-BLAST" docx
Ngày tải lên :
23/06/2014, 01:20
... note that, unlike the open-loop V-BLAST, the ordering has no impact on the capacity attained by the sum of all M antennas.1 It does, however, impact the fraction of that capacity that is allocated ... is generated 1000 times and the average capacity is calculated assuming that a scalar capacity-achieving code is used: Γ = at (1) First, the effect of rate quantization is investigated; later, power ... literatures in similar cases In a single user time-varying channel, a close-to-optimal performance is achieved by transmitting a constant power when the channel path gain is larger than a certain...
- 10
- 221
- 0
Báo cáo lâm nghiệp: "Rationalization of the performance of a mobile off-road system working in the forest environment with respect to its emission load" doc
Ngày tải lên :
07/08/2014, 10:21
... performance The most important measures compensating the environment contamination by extraneous substances are preventive measures that can be applied on a larger part of the area of endangered ... cutting mechanism length – cutter bars); – By extending the cross sections within roads where the material is transported; – By increasing the maximum working capacity (performance) Determination ... from the analysis and from the determination of mathematic conditions required for reaching minimum specific emissions from logging and transport operations in the forest in relation to extracted...
- 6
- 341
- 0
Báo cáo khoa học: "Retrieval of an embolization coil accidentally dislodged in the descending aorta of a dog with a patent ductus arteriosus" doc
Ngày tải lên :
07/08/2014, 20:23
... desu neeb evah steksab ralucsav llams dna serans yrruC ,)ASU ,ekaL raeB etihW ,anevorciM( eranS kcenesooG ztalpmA eht ,enicidem namuh nI elbaliava era sloot laveirter etairporppa taht laitnesse ... ypocsoroulf lanimodba eht fo noitcejorp laretaL siht fo etar sseccus eht etad oT ADP llams a htiw sgod gnuoy ni ymotocaroht ot evitanretla evitceffe dna elpmis a si ,lioc noitazilobme na gnisu ,ADP a fo ... laitini eht morf syad 01 retfa devresbo erew noitazilobme citroa ot detaler sngis lacinilc tnerappa oN keew rof h OP gm 01 rolcafec dna h 21 OP gk/gm 01 ta niripsa rof noitpircserp a htiw desaeler...
- 3
- 280
- 0
Báo cáo toán học: "A Rainbow k-Matching in the Complete Graph with r Colors" pdf
Ngày tải lên :
07/08/2014, 21:21
... begin with the following basic Claim Claim G has a rainbow (k − 1)-matching Proof We may assume that G is not rainbow, because the complete graph of order at least 2k has a k-matching Hence, there ... rainbow k-matching? Since the case k = and k = is trivial, we assume k ≥ For example, if n = and r ≥ then we can find easily a rainbow 2-matching, but we may not find a rainbow 3-matching Generally, ... [3], the case where G1 is a star and G2 is a matching is discussed Also, in [4], the case where each Gi with i = 1, is a ki -matching is treated There, in particular, it is conjectured that RM(G1...
- 13
- 371
- 0
Báo cáo y học: "Lack of association of a variable number of aspartic acid residues in the asporin gene with osteoarthritis susceptibility: case-control studies in Spanish Caucasians" potx
Ngày tải lên :
09/08/2014, 07:20
... confirmation in the same ethnic population Therefore, although it remains possible that ASPN could be a crucial modulator in OA by fine-tuning transforming growth factor beta in the repair of damaged ... AG coordinated the study and participated in its design and analysis Acknowledgements The authors thank sample donors for their collaboration They thank also Yolanda Lopez-Golan and Fina Meijide ... Arthritis Research & Therapy Vol No Rodriguez-Lopez et al findings in UK Caucasians [9] and in the Greek population [10], and together the observations indicate that the ASPN microsatellite...
- 4
- 431
- 0
Báo cáo y học: "The ITGAV rs3738919-C allele is associated with rheumatoid arthritis in the European Caucasian population: a family-based study" docx
Ngày tải lên :
09/08/2014, 10:20
... same trend in replication sample 2, and again a significant association in replication sample (European Caucasian families) Finally, significant RA association and linkage were observed when all ... neither significant association nor linkage between SNP1 and RA in sample For SNP2, we observed a significant association for the C allele and a strong trend for a RA linkage (AFBAC, RA index cases ... clinical data All authors read and approved the final manuscript Acknowledgements The authors thank the RA members and their rheumatologists for their participation This work was funded by the...
- 7
- 605
- 0