4—formulation for a sprayable textured acrylic latex modified cement mortar lavelle 1988
polymer-modified concrete
Ngày tải lên :
24/10/2014, 22:11
... acrylic latex- modified mortar properties—The physical properties of a latex- modified cement mortar are affected to an extent by the same variables that affect unmodified portland -cement mortars ... of unmodified and acrylic latex- modified cement mortars (Lavelle 1988) Fig 3.12—Adhesion strengths of acrylic latex- modified mortar versus unmodified brick mortar (Lavelle 1988) Fig 3.13—Durability ... represents another application for acrylic latexcement coatings Acrylic latex- cement coatings (Table 3.5) offer important features such as ease of application (brush or spray) and cleanup, low odor, and...
- 40
- 393
- 3
Báo cáo y học: "Effects of p-Synephrine alone and in Combination with Selected Bioflavonoids on Resting Metabolism, Blood Pressure, Heart Rate and Self-Reported Mood Changes"
Ngày tải lên :
25/10/2012, 11:04
... standard deviation for 10 subjects Table Mean changes from baseline in each rating for placebo and each treatment group with p values for between groups comparisons between placebo and treatment ... hesperidin and 600 mg naringin After remaining seated and resting for 45 min., participants completed a second self report rating scale After 75 min., a third and final self report rating scale was completed, ... completed, and measurements of blood pressure, heart-rate and RMR were determined Statistical Analyses ANOVAs were calculated between the groups’ baseline, ending and change scores for each treatment...
- 7
- 641
- 0
Báo cáo khoa học: Mutations in the C-terminal domain of ALSV (Avian Leukemia and Sarcoma Viruses) integrase alter the concerted DNA integration process in vitro pot
Ngày tải lên :
23/03/2014, 15:21
... and BL (5¢-CC GATATCAGACCAAGTTTAC-3¢) In the same way, the zeo gene was amplified from plasmid pHook (Invitrogen) using primers Z1 (5-CCGATATCGTGTTGACAATT AATC-3¢) and Z2 (5¢-CCGATATCCAGACATGATAA ... displayed and analysed on a graphic station using the program TURBO-FRODO [47] Contact distances were computed with CNS around each mutated residue In parallel, a BLAST search [48] was performed against ... core domains are related by a twofold symmetry axes, whereas the two C-terminal domains have a similar fold but associate asymmetrically, giving rise to a ÔproximalÕ and a ÔdistalÕ domain (close...
- 13
- 476
- 0
Báo cáo khoa học: Human papillomavirus 16 E7 protein inhibits interferon-c-mediated enhancement of keratinocyte antigen processing and T-cell lysis docx
Ngày tải lên :
29/03/2014, 00:20
... reverse, 5¢-AAG CCA AGG TGG ATG TGT TC-3¢; JAK1, forward, 5¢-TCA ACC TTC CCA AAG TGA CC-3¢; JAK1, reverse, 5¢-CAT GAC TCG CTG CAT GAA CT-3¢; PIAS1, forward, 5¢-AAG TGC TCA CAG CCT TGG AT-3¢; PIAS1, reverse, ... 5¢-TCC CTA GGT GCA TGT TCT CC-3¢; rRNA adenine dimethylase, forward, 5¢-GGA GGG CCC ATC AGT TTA AT-3¢; rRNA adenine dimethylase, reverse, 5¢-AAA CAA TTG CAT TGC ATA GTGC-3¢ The data were analyzed ... concentrations of IFNs can contribute to the clearance of HPV-associated genital warts [36] Administration of proinflammatory mediators that can enhance antigen presentation by an IFNindependent pathway,...
- 9
- 352
- 0
Tensile properties of cooked meat sausages and their correlation with texture profile analysis (TPA) parameters and physico chemical characteristics
Ngày tải lên :
05/05/2014, 08:43
... chemical and textural analysis 2.2 Physico-chemical analysis After removing the plastic case, chemical analyses were made in duplicate on all cooked sausages About 200 g of sample were finely cut and ... Hanson and Olley (1963) and was quantified gravimetrically Results are expressed as percentage of dry matter (DM) Table Characteristics of the cooked meat sausages analysed Samplea Product Meat ... analysis was carried out using a Statgraphics Plus version 5.0 The analyses were conducted across all sausages types Data were presented as the mean of each sample and the standard deviation (SD)...
- 7
- 445
- 0
Báo cáo khoa học: " Early changes of CD4-positive lymphocytes and NK cells in patients with severe Gram-negative sepsis" ppt
Ngày tải lên :
13/08/2014, 03:20
... were applied before the start of analysis for each patient Statistical analysis Results are expressed as the median and interquartile range, but those of cell cultures expressed as the means and ... metabolic acidosis, defined as any pH 5 mEq/l and serum lactate at least more than twice the normal value; acute coagulopathy, defined as any platelet count 5 The modified clinical pulmonary infection score was...
- 7
- 223
- 0
Báo cáo y học: "Urinary cystatin C is diagnostic of acute kidney injury and sepsis, and predicts mortality in the intensive care unit" pptx
Ngày tải lên :
13/08/2014, 20:22
... a Mann-Whitney U test, and for categoric variables, a χ2 test) For analysis, APACHE II subcategory scores were transformed to categoric variables according to whether they were normal (0, APACHE ... Ma Q, Raman J, Jeevanandam V, Kasza KE, O'Connor MF, Konczal DJ, Trevino S, Devarajan P, Murray PT: Urinary cystatin C as an early biomarker of acute kidney injury following adult cardiothoracic ... Kersten A, Venkataraman R, Angus DC, De Bacquer D, Kellum JA: RIFLE criteria for acute kidney injury are associated with hospital mortality in critically ill patients: a cohort analysis Crit Care...
- 13
- 224
- 0
Kinetic changes of volatile compounds during longan juice fermentation with single and mixed cultures of yeasts
Ngày tải lên :
08/11/2015, 17:24
... Isoamyl alcohol 1-Hexanol Linalool 2-phenylethyl alcohol Organic acids Acetic acid Propanoic acid Butanoic acid Isobutanoic acid Hexanoic acid Octanoic acid Decanoic acid Carbonyl compounds Acetaldehyde ... early stages, while Saccharomyces yeasts that are responsible for alcoholic fermentation and lactic acid bacteria that perform malolactic fermentation develop at the later stages (Fleet et al., ... comprise acetate esters (e.g ethyl acetate, isoamyl acetate and 2-phenylethyl acetate), ethyl esters of organic acids and straight chain or branched-chain fatty acids (e.g ethyl hexanoate, ethyl octanoate...
- 128
- 331
- 0
Báo cáo y học: No associations of Helicobacter pylori infection and gastric atrophy with plasma total homocysteine in Japanes
Ngày tải lên :
31/10/2012, 14:34
... demonstrated that gastric atrophy blocked the absorption of folate Gastric atrophy causes an increase in gastric pH and a decrease in ascorbic acid; the two mechanisms may cause a reduction in folate ... GTG ATG ATG AAA TCG G-3’, F2: 5’-GAG AAG GTG TCT GCG GGA GT-3’, and R2: 5’-CAT GTC GGT GCA TGC CTT-3’ The amplified DNA fragments were 128-base pairs (bp) for the C allele, 93-bp for the T allele, ... The authors are grateful to Ms Mio Kurata and Ms Yoko Mitsuda for their technical assistance This work was supported in part by a Grant-in-Aid for Scientific Research on Special Priority Areas...
- 7
- 578
- 1
Đề tài " Divisibility of anticyclotomic L-functions and theta functions with complex multiplication " pdf
Ngày tải lên :
06/03/2014, 08:21
... may also regard these data as fixed, and choose and fix an ideal a with N (a) ∈ C and a normalized integral eigenfunction prim a ∈ Td0 /N (a) ,a Then we want to show that for m large enough for all ... xi avoids a certain exceptional class in 2−1 a/ a, the map Φ is a bijection Since ar it maps Tr ,a into the space of algebraic vectors, it follows that if the values ar (Axi ϑ)(0) are all algebraic, ... which after extending scalars to C via i∞ has period lattice Ω∞,aa for some complex period Ω∞ ,a Over the complex numbers there is an analytic parametrization Ea ⊗i∞ C C /a, and for any rational number...
- 42
- 595
- 0
Báo cáo "On the asymptotic behavior of delay differential equations and its relationship with C0 - semigoup " potx
Ngày tải lên :
22/03/2014, 11:20
... talk given at the Conference on Mathematics, Mechanics, and Informatics, Hanoi, 7/10/2006, on the occasion of 50th Anniversary of Department of Mathematics, Mechanics and Informatics, Vietnam ... nonlinear age- dependent population dynamics Pure and applied mathematics, a program of monographs, textbooks, Lecture Notes, 1985 [10] K.J Engel, R Nagel, One-parametter semigoup for Linear Evolution ... Equations, Springer-Verlag, New York, Berlin, London, Paris, Tokyo, Hong kong, Barcelona, Heidelberg, Milan, Singapore, 2000 [11] A Pazy, Semigoup of linear operators and applications to partial...
- 7
- 553
- 0
Báo cáo khoa học: Characterization of a-synuclein aggregation and synergistic toxicity with protein tau in yeast potx
Ngày tải lên :
23/03/2014, 13:20
... the plasma membrane and may also occur on intracellular membranes or, alternatively, that the cells attempt to remove the aggregates formed at, and bound to, the plasma membrane via transport ... with an antia-syn rabbit polyclonal antibodies directed against the C-terminus (Sigma) Alkaline phosphatase-conjugated (Santa-Cruz Biotech, Santa Cruz, CA) or horseradish peroxidase-conjugated ... Hasegawa T, Matsuzaki M, Takeda A, Kikuchi A, Akita H, Perry G, Smith MA & Itoyama Y (2004) Accelerated alpha-synuclein aggregation after differentiation of SH-SY5Y neuroblastoma cells Brain Res 1013,...
- 15
- 364
- 0
báo cáo hóa học: " Joint optimization of MIMO radar waveform and biased estimator with prior information in the presence of clutter" pot
Ngày tải lên :
21/06/2014, 02:20
... bias gradient matrix is given, it may not be suitable because a biased estimator reduces the variance obtained by any unbiased estimator at the cost of increasing the bias As a sequence, a tradeoff ... MIMO radar waveform design IEEE J Sel Top Signal Process 1(1), 147–155 (2007) 18 A Leshem, O Naparstek, A Nehorai, Information theoretic adaptive radar waveform design for multiple extended targets ... hyperplane of g(x) [20] Following [20,21], some prior information can be available in array signal processing, for example, constant modulus constraint on the transmitted waveform, and the signal...
- 13
- 378
- 0
Báo cáo hóa học: " Synthesis of Tapered CdS Nanobelts and CdSe Nanowires with Good Optical Property by Hydrogen-Assisted Thermal Evaporation" docx
Ngày tải lên :
22/06/2014, 00:20
... liquid Au catalysts and precipitated at the liquid–solid interface In this process, a liquid cluster of metal catalyst provides energetically favored sites for the absorption of gas-phase reactants, ... of a quartz tube, which was inserted into a horizontal tube furnace The silicon wafer coated with *2 nm Au film was perpendicularly placed on the other ceramic boat located downstream, 10 cm away ... [23–25] As a result, the nanobelt’s width increases gradually along the axial direction starting from the contact region between liquid Au nanoparticle and CdS, i.e., the tapered CdS nanobelts form...
- 5
- 242
- 0
modeling and pricing of swaps for financial and energy markets with st
Ngày tải lên :
11/07/2014, 18:33
... variance, volatility, covariance and correlation swaps Variance, volatility, covariance and correlation swaps are relatively recent financial products that market participants can use for volatility ... Swishchuk, A (200 9a) Pricing of variance and volatility swaps with semi-Markov volatilities Canadian Applied Mathematics Quarterly, 18, Swishchuk, A (2009b) Variance swaps for local stochastic volatility ... Swaps are useful for volatility hedging and speculation Volatility swaps are forward contracts on future realized stock volatility and variance swaps are similar contracts on variance, the square...
- 326
- 1.2K
- 1
Executive summary PHD thesis in history the policy and guideline of the communist party of vietnam on education and training cooperation with ASEAN countries from 1995 to 2010
Ngày tải lên :
14/07/2014, 13:23
... Cooperation with Malaysia The education and training cooperation programs between Vietnam and Malaysia are carried out under the framework of regional organizations such as ASEAN and SEAMEO, ... cooperation on education and training sector spearhead of Vietnam's regional integration Since 1995, Vietnam's ASEAN policy has always been an inseparable and crucial part of the overall foreign ... Southeast Asia by Phan Thi Hong Xuan The Vietnam - ASEAN: 10 years of integration and development Seminar posted a speech on the topic ASEAN Educational Cooperation – a potential and prosperous area...
- 33
- 460
- 0
Báo cáo khoa học: " Birth of puppies after intrauterine and intratubal insemination with frozen-thawed canine semen" ppt
Ngày tải lên :
07/08/2014, 20:23
... )napaJ ,abihsoT( aremac DCC a dna ,)napaJ ,supmylO( epocsorcim a ,)aeroK ,ylppuS lacideM ;SAIS( metsys sisylana egami mreps a gnisu detaulave saw ytilitom mreps dna ,)aeroK ,ylppuS lacideM ;ASAC( ... sisylanA elba T dna %1.89 erew nemes dewaht dna nemes hserf fo ytilitoM ASAC yb dezylana saw ,)3 elbaT( IA rof deraperp nemes dewaht sa llew sa ,)2 elbaT( nemes detalucaje hserF noitaulave nemeS ... erauqs-ihc yb dezylana saw atad ,)ASU ,SAS( erudecorp QERF metsys sisylana lacitsitats eht gnisU sisylana lacitsitatS ebut eniretu hcae otni detresni )ASU ,doowrehS( retehtac taC moT F 5.3 a...
- 6
- 200
- 0
Báo cáo y học: "Association of Adiposity, Cardiorespiratory Fitness and Exercise Practice with the Prevalence of Type 2 Diabetes in Brazilian Elderly Women" pot
Ngày tải lên :
08/08/2014, 16:23
... 22, 29] Health professionals should encourage individuals of all ages to maintain an active life-style that can attenuate the negative physiologic changes that accompany advancing age, leading to ... 1599-1603 Nasri F Diabetes Mellitus no Idoso In: Freitas EV et al, eds Tratado de Geriatria e Gerontologia Guanabara Koogan, 2002:496-501 Kanaya AM, Harris T, Goodpaster BH, Tylavsky F, Cummings SR Adipocytokines ... potential confounders’ variables – socioeconomic status (treated as a continuous variable), hypertension, family history of cardiovascular disease, and smoking status (all treated as a dichotomous...
- 5
- 426
- 0
Báo cáo y học: "Characteristics of HIV-infected women and factors associated with HCV seropositivity in the Republic of Georgia" doc
Ngày tải lên :
10/08/2014, 05:22
... partner information was available only on the last regular partner Finally, 21 women were missing data either on their own HCV status or partner-related information, and were excluded from analysis ... testing program for pregnant women in Georgia AIDS Care 2008, 20:1125-1127 41 Tsertsvadze T, Kakabadze T, Shermadini K, Abutidze A, Karchava M, Chkhartishvili N, Badridze N, Bokhua Z, Asatiani T: Prevention ... T, Platt L, Judd A, Mikhailova LA, Sarang A, Wallis N, Alpatova T, Hickman M, Parry JV: Hepatitis C virus infection, HIV co-infection, and associated risk among injecting drug users in Togliatti,...
- 6
- 556
- 0
báo cáo khoa học: "Characterization of Sucrose transporter alleles and their association with seed yield-related traits in Brassica napus" potx
Ngày tải lên :
11/08/2014, 11:21
... Eagle ATATACAGCATGAACGCAAC ATGAGAGAGGACCATTTGTG ET3-L GTTGTAGAGACACAGCCACCTTC ET3-R ET4 PT5-L CGGCAGTTTTCCGGTGAC ET4-L GTTGTAGAGACACAGCCACCTTC ET4-R TTCGTCGCCGGAGTTTGG S-1300 TTCCGACCAATCCACTCAAC ... from Asarina barclaiana: AbSUT1 (AAF04294); Apium graveolens: AgSUT3 (ABB89051); Alonsoa meridionalis: AmSUT1 (AAF04295); Arabidopsis thaliana: AtSUC1 (CAA53147), AtSUC2 (CAA53150), AtSUC3 (AAC32907), ... spinach (Spinacia oleracea L.) (Amaranthaceae) [5] In the last two decades, cDNA for SUTs has been isolated and cloned in higher plants (e.g., Solanaceae, Brassicaceae, Amaranthaceae, Poaceae) [6-8]...
- 47
- 405
- 0