4immune response against yellow fever vaccine and influenza vaccine

Báo cáo sinh học: " Reference gene selection for quantitative real-time PCR analysis in virus infected cells: SARS corona virus, Yellow fever virus, Human Herpesvirus-6, Camelpox virus and Cytomegalovirus infections" doc

Báo cáo sinh học: " Reference gene selection for quantitative real-time PCR analysis in virus infected cells: SARS corona virus, Yellow fever virus, Human Herpesvirus-6, Camelpox virus and Cytomegalovirus infections" doc

Ngày tải lên : 18/06/2014, 22:20
... participated in design and coordination of the study and helped to draft the manuscript All authors read and approved the final manuscript Material and Methods Virus culture and virus detection ... Niedrig M: Detection of yellow fever virus: a comparison of quantitative real-time PCR and plaque assay J Virol Methods 2003, 110:185-191 Nitsche A, Muller CW, Radonic A, Landt O, Ellerbrok H, Pauli ... viral RNA was performed to proof and monitor infection Thereafter the candidate reference genes were evaluated by the BestKeeper tool [6], the GeNorm tool [7] and the algorithm we described previously...
  • 5
  • 452
  • 0
báo cáo hóa học:" Reference gene selection for quantitative real-time PCR analysis in virus infected cells: SARS corona virus, Yellow fever virus, Human Herpesvirus-6, Camelpox virus and Cytomegalovirus infections" doc

báo cáo hóa học:" Reference gene selection for quantitative real-time PCR analysis in virus infected cells: SARS corona virus, Yellow fever virus, Human Herpesvirus-6, Camelpox virus and Cytomegalovirus infections" doc

Ngày tải lên : 20/06/2014, 04:20
... participated in design and coordination of the study and helped to draft the manuscript All authors read and approved the final manuscript Material and Methods Virus culture and virus detection ... Niedrig M: Detection of yellow fever virus: a comparison of quantitative real-time PCR and plaque assay J Virol Methods 2003, 110:185-191 Nitsche A, Muller CW, Radonic A, Landt O, Ellerbrok H, Pauli ... viral RNA was performed to proof and monitor infection Thereafter the candidate reference genes were evaluated by the BestKeeper tool [6], the GeNorm tool [7] and the algorithm we described previously...
  • 5
  • 539
  • 0
Báo cáo y học: " Vaccine based on a ubiquitous cysteinyl protease and streptococcal pyrogenic exotoxin A protects against Streptococcus pyogenes sepsis and toxic shock" pptx

Báo cáo y học: " Vaccine based on a ubiquitous cysteinyl protease and streptococcal pyrogenic exotoxin A protects against Streptococcus pyogenes sepsis and toxic shock" pptx

Ngày tải lên : 11/08/2014, 10:23
... Based Therapies and Vaccines 2008, 6:8 5' GAATTCGGATCCGCTAGCCTACAACAG 3' For cloning, the SpeA (L42R) gene was used as a PCR template and primers and were used to prepare a doublestranded sequence ... Animal Welfare Act and other federal statutes and regulations relating to animals and experiments involving animals and adhered to the principles stated in the Guide for the Care and Use of Laboratory ... A (SpeA) and other secreted superantigen toxins are potential candidates for vaccines because these proteins are associated with many outbreaks of streptococcal toxic shock syndrome and are virulence...
  • 8
  • 326
  • 0
Tài liệu Reproductive Health and Partner Violence Guidelines: An Integrated Response to Intimate Partner Violence and Reproductive Coercion doc

Tài liệu Reproductive Health and Partner Violence Guidelines: An Integrated Response to Intimate Partner Violence and Reproductive Coercion doc

Ngày tải lên : 13/02/2014, 10:20
... and reproductive health have expanded our understanding of the dynamics and health effects of abusive adult and teen relationships This has led to new terminology to describe forms of abuse and ... Problem and Focus IPV and dating violence are pervasive and persistent problems that have major health implications for women and adolescents • Approximately in women have been physically and/ or ... methods • Intervention strategies • Networking and training • Self care and support • Data and evaluation • Education and prevention • Environment and resources This section closes with two examples...
  • 52
  • 489
  • 0
Strengthening the Education Sector Response to School Health, Nutrition and HIV/AIDS in the Caribbean Region: A Rapid Survey of 13 Countries pdf

Strengthening the Education Sector Response to School Health, Nutrition and HIV/AIDS in the Caribbean Region: A Rapid Survey of 13 Countries pdf

Ngày tải lên : 14/03/2014, 20:20
... education to staff and students, and a range of health and nutrition services The extent of the SHN and HIV response varies between MoEs and is country-specific Highlights of the response are as ... sector responses to school health, nutrition and HIV, and on the allocation and mobilization of resources used in such responses, the rapid survey is intended to inform policy makers and to enhance ... education sector responses across the region and supportive school environment; skills-based health education; school-based health and nutrition services; and support to MoE SHN and HIV responses Of...
  • 40
  • 450
  • 0
Individual Preparedness and Response to Chemical, Radiological, Nuclear, and Biological Terrorist Attacks - A Quick Guide potx

Individual Preparedness and Response to Chemical, Radiological, Nuclear, and Biological Terrorist Attacks - A Quick Guide potx

Ngày tải lên : 15/03/2014, 15:20
... This study was conducted within RAND’s Public Safety and Justice program RAND Public Safety and Justice conducts research and analysis that helps inform policymakers and communities in the areas ... immigration, emergency response and management, and natural disasters; criminal justice, including sentencing and corrections policy, firearms, and community violence; and drug policy, which ... support, counsel, and encouragement of K Jack Riley, who leads RAND’s Public Safety and Justice unit vii ✺ INTRODUCTION There is much the nation must do and is doing—to guard against and prepare for...
  • 35
  • 326
  • 0
against coherence truth probability and justification jun 2005

against coherence truth probability and justification jun 2005

Ngày tải lên : 10/06/2014, 21:52
... Bovens and his associates Brandon Fitelson, Stephan Hartmann, and Josh Snyder about concurring testimonies My contributions to that debate appeared as ‘Corroborating Testimony, Probability and Surprise’, ... 273–88; and, in the same issue (565–72), ‘Corroborating Testimony and Ignorance: A Reply to Bovens, Fitelson, Hartmann and Snyder’ The discussion of the Klein–Warfield argument in Chapter and the ... number of students and a reasonable number of octogenarians (80–89-year-olds) Suppose that all and only students like to party, that all and only octogenarians are birdwatchers, and that there are...
  • 247
  • 306
  • 0
Báo cáo hóa học: " Effect of influenza and pneumococcal vaccines in elderly persons in years of low influenza activity" potx

Báo cáo hóa học: " Effect of influenza and pneumococcal vaccines in elderly persons in years of low influenza activity" potx

Ngày tải lên : 20/06/2014, 01:20
... of influenza and pneumococcal vaccines has been limited in many European countries Only 4–8% of all persons in Sweden, received influenza vaccine up to 1995 After 1997, however, the influenza vaccine ... cohort Influenza vaccinated Influenza and pneumococcal Non-vaccin Incidence 2003 2004 2005 Influenza season 65 – 79 years Non -influenza season 65 – 79 years Influenza season 65 – 79 years Non -influenza ... global impact of influenza and its complications Vaccine 1999, 17(Suppl 1):S3-10 Christenson B, Lundbergh P: Comparison between cohorts vaccinated and unvaccinated against influenza and pneumococcal...
  • 9
  • 384
  • 0
Báo cáo hóa học: " Genetic diversity and silencing suppression effects of Rice yellow mottle virus and the P1 protein" doc

Báo cáo hóa học: " Genetic diversity and silencing suppression effects of Rice yellow mottle virus and the P1 protein" doc

Ngày tải lên : 20/06/2014, 01:20
... activity and GUS assays were performed according to Jefferson [33] and involved pieces of leaves randomly collected from two to five plants at and dpi (inoculated leaves), and 7, 14, 35 and 40 ... plant at 35 or 40 dpi and separated into two independent samples before being ground for proteins (fluorimetry, ELISA and western) and RNA extractions Plasmid construction and biolistic delivery ... activity, as illustrated by isolates belonging to the same serotype Ni2 and CI4, or, CI63 and BF1 isolates (Figure 3C, lanes and or and 5) We also noted that the diversity of silencing suppression displayed...
  • 12
  • 384
  • 0
Báo cáo khoa học nông nghiệp " Classical Swine Fever (CSF): Development of a new classical swine fever vaccine - Milestone 7" pot

Báo cáo khoa học nông nghiệp " Classical Swine Fever (CSF): Development of a new classical swine fever vaccine - Milestone 7" pot

Ngày tải lên : 21/06/2014, 05:20
... CSF vaccine virus to growth in PK-15A cell culture under quality assured conditions and the resultant candidate improved vaccine has been further characterised both in vitro and in vivo Vaccine ... dropped and were both seronegative and negative for CSF antigen prior to experimental usage at 8-10 weeks of age All vaccine virulence, efficacy and safety assays were conducted at NAVETCO and performed ... project are: To develop an improved cell culture propagated vaccine CSF vaccine to allow the production of a cheap and high quality vaccine To enhance the diagnostic capability of Vietnamese laboratories...
  • 10
  • 426
  • 0
ABIOTIC STRESS RESPONSE IN PLANTS – PHYSIOLOGICAL, BIOCHEMICAL AND GENETIC PERSPECTIVES docx

ABIOTIC STRESS RESPONSE IN PLANTS – PHYSIOLOGICAL, BIOCHEMICAL AND GENETIC PERSPECTIVES docx

Ngày tải lên : 28/06/2014, 08:20
... to abiotic and biotic stress responses In plants, Ca2+ and ROS constitute important and common signaling molecules in the early response to abiotic and biotic stress Levels of Ca2+ and ROS rapidly ... protect itself against pathogens and environmental stress A body of research has shown that calcium and reactive oxygen species are second messengers in the early response to abiotic and biotic stress ... mitochondrion and chloroplast The intricate and finely tuned molecular mechanisms activated in plants in response to abiotic and biotic environmental factors are not well understood, and less is...
  • 358
  • 295
  • 0
Báo cáo khoa học " Lentinula edodes enhances the biocontrol activity of Cryptococcus laurentii against Penicillium expansum contamination and patulin production in apple fruits " ppt

Báo cáo khoa học " Lentinula edodes enhances the biocontrol activity of Cryptococcus laurentii against Penicillium expansum contamination and patulin production in apple fruits " ppt

Ngày tải lên : 28/06/2014, 11:20
... extracts is due, on the one hand, to the presence of compounds with intrinsic antioxidant activity like β-glucans and glycoproteins, (Slamenova et al., 2003) and on the other hand, to the stimulation ... ensuring microbiological quality and safety of fruits and juices as is the optimization of preventive strategies, such as good agricultural and industrial practices and the use of biocontrol agents ... positive and good correlation (R2 = 0.99) between intensity and DNA amount and this was expressed by the function {Intensity = 0,133 * ln(DNA) + 0.28} This curve was then used as a reference standard...
  • 7
  • 392
  • 0
BỆNH SỐT VÀNG ( Yellow Fever ) pptx

BỆNH SỐT VÀNG ( Yellow Fever ) pptx

Ngày tải lên : 02/07/2014, 08:21
... 1 ĐẠI CƯƠNG: - Bệnh sốt vàng virut sốt vàng (Yellow Fever Virus) gây ra, gặp chủ yếu châư Phi Nam Mỹ - Virut sốt vàng thuộc nhóm virut Arbo, họ...
  • 5
  • 312
  • 0
Bệnh sốt vàng (Yellow fever) pot

Bệnh sốt vàng (Yellow fever) pot

Ngày tải lên : 05/08/2014, 15:21
... tiêm ngày định vaccine Ngươc lại, người du lịch đợi đến tháng sau tiêm vaccine sốngrói định sau Vaccine virus sống ức chế hệ thống miễn dịch làm giảm tính hiệu vaccine sốt vàng -Vaccine không ... tuổi có nguy phơi nhiễm cao; -Vaccine phòng bệnh sốt vàng sử dụng từ năm 1930 300 triệu liều vaccine triển khai từ thời gian Vaccine dùng loại Stamaril Đây loại vaccine sống giảm độc lực dòng ... vào phát triển vaccine mới, nên công nghệ 60 năm tuổi đuổi kịp vụ dịch sốt vàng Các vaccine hệ sau dựa nuôi cấy tế bào thay vaccine 17D số điểm Áp dụng phòng chống vector tiêm vaccine phòng bệnh,...
  • 18
  • 319
  • 2
Báo cáo khoa học: "Development of a novel antigen capture-ELISA using IgY against porcine interleukin-6 and its application" potx

Báo cáo khoa học: "Development of a novel antigen capture-ELISA using IgY against porcine interleukin-6 and its application" potx

Ngày tải lên : 07/08/2014, 18:20
... This study generated and characterized a set of IgY and polyclonal antibodies to recombinant porcine IL-6 (rpIL-6), and then combined these antibodies to develop a sensitive and specific capture-ELISA ... confirmed by Western-blot using a polyclonal antibody against IL-6 Fig Antibody titer of mouse IgG against rpIL-6 IL-6 and IgG were diluted and IgG was up to : 10,240 dilution ratios for reaction ... conditions and symptoms, Efarm detected a higher concentration This result indicates that A- and E-farms have on-going infection and that in addition, E-farm might have a new infection recently C- and...
  • 7
  • 400
  • 0
Báo cáo khoa học: "Application of deltamethrin for spraying or dipping to protect Scots pine seedlings against Hylobius abietis L and logs against Tomicus piniperda L" ppsx

Báo cáo khoa học: "Application of deltamethrin for spraying or dipping to protect Scots pine seedlings against Hylobius abietis L and logs against Tomicus piniperda L" ppsx

Ngày tải lên : 08/08/2014, 23:21
... after 6, 10 and 16-wk periods All plants on experimental plots were inspected and a count was made of healthy, damaged and dead plants Plant samples were taken h after treatment and at the end ... especially species belonging to the Lepidoptera and Hymenoptera families At higher doses it is used in the protection of wood against the bark beetle and the control of the pine weevil in pine plantations ... took samples of sprayed bark and, using gas chromatography, evaluated the deltamethrin content and its degradation rate The bark was weighed, its surface area measured and, the after grinding, the...
  • 5
  • 265
  • 0
Báo cáo y học: "Antibodies against PM/Scl-75 and PM/Scl-100 are independent markers for different subsets of systemic sclerosis patients" doc

Báo cáo y học: "Antibodies against PM/Scl-75 and PM/Scl-100 are independent markers for different subsets of systemic sclerosis patients" doc

Ngày tải lên : 09/08/2014, 01:22
... the criteria of the EUSTAR and DNSS network [13,14] Briefly, diffuse SSc (dSSc) and limited SSc (lSSc) were defined according to LeRoy and colleagues [16] and the DNSS and EUSTAR criteria based ... by the commonly used standards of the DNSS and EUSTAR network Antibodies against PM/Scl-75 and PM/Scl100 can be considered independent markers for different SSc subsets and show partial differences ... for citation purposes) KH and AK helped to provide preclinical analyses, statistics, and graphics and to write the manuscript CD, AJ, LK, and WM helped to develop the LIA and to perform the tests...
  • 9
  • 473
  • 0
Báo cáo y học: "Response to commentary by Dixon and Silman on the systematic review and meta-analysis by Bongartz et al" doc

Báo cáo y học: "Response to commentary by Dixon and Silman on the systematic review and meta-analysis by Bongartz et al" doc

Ngày tải lên : 09/08/2014, 08:22
... antibody therapy in rheumatoid arthritis and the risk of serious infections and malignancies Systemic review and meta-analysis of rare harmful effects in randomized controlled trials JAMA 2006, ... effects in randomized controlled trials JAMA 2006, 295:2275-2286 Stern R, Wolfe F: Infliximab dose and clinical status: results of studies in 1642 patients with rheumatoid arthritis J Rheumatol 2004,...
  • 2
  • 391
  • 0