... MS-PCR primers of specific genes analyzed in this study Sense primer (5'-3') MINT31(M31) CACAAAAACCCTCACTCACAACAA M TTATTAGAGGGTGGGGCGGATCGC GACCCCGAACCGCGACCGTAA TTATTAGAGGGTGGGGTGGATTGT CAACCCCAAACCACAACCATA ... AACAAAAAACCTCAACCCCACA M TTGTTAAAGTGTTGAGTTCGTC AATAACGACGATTCCGTACG U MINT2(M2) TTTTTGGTGTTAAAGGGTGGTGTAGT U MINT1(M1) AAAACCCTCACTCGCGACG U E-cadherin GTGTTAAAGGGCGGCGTAGC U p16INK4a M U p14ARF ... CAACCCCAAACCACAACCATA M TTAGGTTAGAGGGTTATCGCGT TAACTAAAAATTCACCTACCGAC TAATTTTAGGTTAGAGGGTTATTGT CACAACCAATCAACAACACA M AATTTTTTTATATATATTTTCGAAGC AAAAACCTCAACCCCGCG AATTTTTTTATATATATTTTTGAAGTGT AACAAAAAACCTCAACCCCACA...
... identifying antigens and describing immune interactionsincancer patients Many clinical trials have been conducted using active specific immunotherapy (ASI) in CRC, including autologous tumor cell ... Global cancer statistics, 2002 CA Cancer J Clin 2005, 55:74-108 Kerr D: Clinical development of gene therapy for colorectal cancer Nat Rev Cancer 2003, 3:615-622 Lorenz M, Staib-Sebler E, Hochmuth ... D, Thiel E: Clinical and Immunologic Responses to Active Specific Cancer Vaccines in Human Colorectal Cancer Clin Cancer Res 2006, 12:3064-3069 14 Alejandro R, Jadad MD, DPhil R, Andrew Moore...
... Liao CT, Wang HM, Yen TC, Chiu CC, Lu YC, Li HF, Cheng AJ: Head and neck cancerin the betel quid chewing area: recent advances in molecular carcinogenesis Cancer Sci 2008, 99:1507-1514 Ko YC, ... Lee CH, Chen MJ, Lin LM, Tsai CC: Betel quid chewing, cigarette smoking and alcohol consumption related to oral cancerin Taiwan J Oral Pathol Med 1995, 24:450-453 Clinical practice guidelines in ... Khaleque MA, Sawyer DB, Ciocca DR: Heat shock proteins in cancer: chaperones of tumorigenesis Trends Biochem Sci 2006, 31:164-172 10 Nicchitta CV: Biochemical, cell biological and immunological issues...
... that two socio-demographic characteristics (income and education) influence life satisfaction both directly and also indirectly through psychosocial factors such as activity-physical activity level, ... Awareness and acceptance of the fact that ageing has physiological, psychological and social determinants would make the ageing process acceptable, cheerful perhaps even desirable by making living ... families in case of older person has declined due to structural changes which have taken place in the Indian society and the concomitant disintegration of the joint family system, which results in...
... diagnostic for mucinous adenocarcinoma Dystrophic calcification occurs in ischemic and necrotic tissue Denatured proteins bind specifically to phosphate Page of ions and thereafter react with calcium ... necrosis with cystic degeneration may cause calcification [9-11] In our case, the CT scan years ago showed a cystic tumor with well circumscribed calcification in the stomach, but with greater ... have been reported in gastric cancer: mucin pool calcifications, psammomatous calcifications, and heterotopic ossification [9,12] In addition, four mechanisms of calcification within tumor have been...
... easier comparison with published incidence rates, since most cancer registries currently interpret breastcancer as invasive cancer (coded by ICD-9 174) and not include DCIS (coded by ICD-9 ... cancers diagnosed outside screening (interval cancers, cancers in non attenders, cancers in women not invited) All women withbreastcancer detected at screening, with or without signs of distant ... registers, cancer registers, review of death certificates, etc In this respect, it is of interest to specify whether ductal carcinomas in situ (DCIS) or lobular carcinomas in situ (LCIS) are included in...
... Factors in New York State Smoking has effects that can both increase and decrease breastcancer risk On one hand, tobacco smoke contains chemicals that can cause breastcancerin animals and could ... different chemicals, including the toxic chemicals in tobacco Examinations of the connection between breastcancer risk and differences in the processing of these toxic tobacco chemicals have produced ... on BreastCancerand Environmental Risk Factors in New York State breastcancer risk There is direct documentation that breasts are exposed to chemicals within tobacco smoke in active smokers...
... known HER ligands bind directly to HER2 with high affinity, heregulin, a cytokine secreted by the breast stromal cells, can activate HER2 by inducing or stabilizing heterodimers with other HER receptors ... showed single agent activity in treatment of breast cancers in a phase I trial, and conferred therapeutic benefits in combination with chemotherapy in triple-negative breast cancers without an increase ... other potent cytotoxic mechanisms will improve their apoptosis-inducing efficacy inbreast cancers Second, additional approaches to achieving a “genuine” breastcancer targeting in drug delivery...
... Jensen and colleagues emphasizing the importance of early breastcancer detection in Sweden on decreasing breastcancer mortality [58] Our findings of higher breastcancer survival by increasing ... significantly higher incidence of breastcancer compared with their mothers However, lack of statistical power hindered any definitive conclusion because of wide confidence intervals at the country level ... national breastcancer screening in the Netherlands 1997-2008 Eur J Cancer Prev 2010, 19:195-198 Page 13 of 13 62 Coughlin SS, Wilson KM: Breastand cervical cancer screening among migrant and seasonal...
... BRCA1 increased, whereas the non-nuclear (cytoplasmic and perinuclear) level decreased In MCF-12A and HMEC cells, there was no difference in BRCA1 localization in cells exposed to hypoxia as compared ... Synergistic interactions of chemotherapeutic drugs and tumor necrosis factor-related apoptosisinducing ligand ⁄ Apo-2 ligand on apoptosis and on regression of breast carcinoma in vivo Cancer ... TRAIL and BRCA1 in regulating apoptosis inbreastcancer cells Experimental procedures Cell culture MCF-7, MDA-MB-468, HCC1937 and MCF-12A cells were from the American Type Culture Collection...
... reduced by CCR9 blockade Figure CCL25 inhibits cisplatin-induced cell death OVCAR-3 and SKOV-3 cells were cultured with (circles) or 100 ng/ml of CCL25 plus isotype control (squares) or anti-CCR9 ... statistical significant differences (p < 0.01) between CCL25-treated and untreated OvCa cells CCL25-CCR9 interactions impact on PI3Kp85-phospho Tyr and Akt-Ser473 activation To determine the CCR9-mediated ... study investigates the role of CCR9 signalling on OvCa cell survival and cisplatin resistance We show for the first time that CCL25-CCR9 interactionsin OvCa cells provide protection against cisplatin-induced...
... known HER ligands bind directly to HER2 with high affinity, heregulin, a cytokine secreted by the breast stromal cells, can activate HER2 by inducing or stabilizing heterodimers with other HER receptors ... showed single agent activity in treatment of breast cancers in a phase I trial, and conferred therapeutic benefits in combination with chemotherapy in triple-negative breast cancers without an increase ... other potent cytotoxic mechanisms will improve their apoptosis-inducing efficacy inbreast cancers Second, additional approaches to achieving a “genuine” breastcancer targeting in drug delivery...
... during cancer treatment: biopsychosocial outcomes Exerc Sport Sci Rev 2001;29:60-4 McTiernan A Physical activity after cancer: physiologic outcomes Cancer Invest 2004;22:68-81 Courneya KS Exercise ... USCenters for Disease Control and Prevention 2000:1–44 23 American Cancer Society Cancer Facts and Figures Atlanta, GA: American Cancer Society; 2001 24 Hortobagyi GH Treatment of breastcancer ... [22] There is a growing interest in the possible role of exercise in enhancing QOL, reducing recurrence and other diseases, and extending survival incancer survivors Preliminary research suggests...
... tuberculous infection or previous contact with persons suffering from TB In the present case, persistent questioning revealed the patient's prior close contact with infected persons Furthermore, the clinician ... ago, during the perimenopausal period, she was diagnosed with an infiltrating ductal carcinoma of the breast She underwent lumpectomy followed by adjuvant chemotherapy and radiotherapy Since then ... liquid culture gave a positive signal after days of incubation The presence of Mycobacterium tuberculosis was verified by AccuProbe assay (Gen-Probe, CA) and phenotypic-biochemical analysis Since...
... of cancer are increased when pre-diagnostic CRP levels are high [7] Cancer invasion begins with inflammation around cancer cells Thus, it has been reported that serum CRP levels are higher in cases ... 38:597-602 Polterauer S, Grimm C, Tempfer C, Sliutz G, Speiser P, Reinthaller A, Hefler LA: C- reactive protein is a prognostic parameter in patients with cervical cancer Gynecol Oncol 2007, 107:114-117 ... JL: Confirmation of a prognostic index in primary breastcancer Br J Cancer 1987, 56:489-492 14 Lonn U, Lonn S, Nilsson B, Stenkvist B: Breast cancer: prognostic significance of c- erb-B2 and int-2...
... intradermally in the peri-tumoral space just before surgery Histopathological procedures Surgical materials from breast- conserving surgery were sectioned at 0.5 cm intervals, and each section was examined ... Helbich TH, Jakesz R, Gnant M: Preoperative core needle biopsy does not increase local recurrence rate inbreastcancer patients BreastCancer Res Treat 2006, 97:9-15 Peters-Engl C, Konstantiniuk ... follows: curative surgical treatment, performance of sentinel lymph node biopsy, and no primary chemotherapy Patients with metachronous ipsilateral breastcancer were excluded Furthermore, we...
... 55(1):10-30 American Cancer Society: Cancer Facts & Figures 2004 Atlanta, GA, American Cancer Society; 2004 Cady B, Stone MD, Schuler JG, Thakur R, Wanner MA, Lavin PT: The new era inbreastcancer Invasion, ... Montgomery S: Cancer statistics, 1994 CA Cancer J Clin 1994, 44(1):7-26 Jemal A, Murray T, Ward E, Samuels A, Tiwari RC, Ghafoor A, Feuer EJ, Thun MJ: Cancer statistics, 2005 CA Cancer J Clin 2005, ... rate in 276 patients included in Danish BreastCancer Cooperative Group (DBCG) 82b and 8 2c trials was found to be 27% [10] In the present study, most recurrence of breastcancer occurred within...