4a new ct based workflow for patient specific modeling of fracture fixation implementing principal strain ratios
Báo cáo hóa học: " New Si-based multilayers for solar cell applications" ppt
... the effect of the aforesaid fabrication methods on the PL spectrum of the SRSO/SiNx multilayers All the spectra have been normalized to 100 nm thickness for comparison The interference effect in ... annealed for a very short time of at 1000°C is 1.43 times more intense than the SRSO/SiO structure annealed for a Figure Effect of sublayer thickness and total thickness of SiNx on the PL spectrum ... number of periods, i.e., fabricating 100 periods of 3.5 nm SRSO alternated with nm SiN x Figure Figure Effect of annealing treatment on the PL intensity of the multilayer structures Page of shows...
- 5
- 211
- 0
Báo cáo khoa học: "A catalytically and genetically optimized β-lactamase-matrix based assay for sensitive, specific, and higher throughput analysis of native henipavirus entry characteristics" doc
... HA: Site -specific introduction of an electroactive label into a non-electroactive enzyme (beta-lactamase I) FEBS Lett 1997, 400:155-157 Escobar WA, Miller J, Fink AL: Effects of site -specific ... proteins in a functional manner Fig 4a shows that our βla-M(NiV) construct allowed efficient formation of HeV-enveloped VLPs at levels equivalent to NiV-enveloped VLPs (Fig 4a and 2a) Infecting HMVECs ... βla-M based assay for future high-throughput tasks, we sought to improve the catalytic activity of βla Active site mutations have been shown to increase the substrate cleavage efficiency of βla for...
- 11
- 340
- 0
Báo cáo hóa học: " Bacterial-based systems for expression and purification of recombinant Lassa virus proteins of immunological relevance" doc
... TTTCAGAATTCGGATCCACCAGTCTTTATAAAGGGGTTTAT GGTACCAAGCTTTCAGTCATAGCAATCTTCTACTAATATAAATATCTCT TTTCAGAATTCGGATCCGGCACATTCACATGGACACTG GGTACCAAGCTTTCAGCTATGTCTTCCCCTGCCTCTCCAT TTTCAGAATTCAGTGCCTCAAAGGAAATAAAATCCTTTTTGTGGACACAATCTTTGAGGAG ... for early diagnostic detection of arenaviral infections in The MBP fusion -based pMAL-vector system (New England BioLabs), comprised of pMAL-p2x and -c2x vectors, Page of 14 (page number not for ... one of the putative future applications for the LASV proteins generated by these studies is the development of sensitive ELISA -based immunoassays for early detection of Lassa fever in infected patients...
- 14
- 411
- 0
báo cáo hóa học:" Research Article New Iterative Approximation Methods for a Countable Family of Nonexpansive Mappings in Banach Spaces" pot
... /t exists for all x, y ∈ U It is also said to be uniformly smooth if the limit is attained uniformly for x, y ∈ U By a gauge function ϕ, we mean a continuous strictly increasing function ϕ : ... some useful lemmas for proving the convergence result of this paper The first part of the next lemma is an immediate consequence of the subdifferential inequality and the proof of the second part ... F be a bifunction of H × H → R, where R is the set of real numbers The equilibrium problem for F : H × H → R is to find x ∈ H such that F x, y ≥ 0, ∀y ∈ H 4.10 The set of solutions of 4.10 is denoted...
- 24
- 331
- 0
Báo cáo hóa học: " Research Article A New General Iterative Method for a Finite Family of Nonexpansive Mappings in Hilbert Spaces Urailuk Singthong1 and Suthep Suantai1, 2" potx
... Kangtunyakarn and Suantai introduced a new mapping, called Kmapping, for finding a common fixed point of a finite family of nonexpansive mappings For a finite family of nonexpansive mappings {Ti }N1 and ... family of nonexpansive mappings with F : i n F Ti / ∅ There are many authors introduced iterative method for finding an element of F which is an optimal point for the minimization problem For n ... is identity mapping of H Lemma 1.7 see Let C be a nonempty closed convex subset of a strictly convex Banach space Let {Ti }N1 be a finite family of nonexpansive mappings of C into itself with...
- 12
- 427
- 0
Báo cáo hóa học: "Research Article A Rules-Based Approach for Configuring Chains of Classifiers in Real-Time Stream Mining Systems Brian Foo and Mihaela van der Schaar" pot
... correctly forwarded samples is captured by the probability of detection PiD = Pr{Xi ∈ Hi | Xi ∈ Hi }, and the proportion of incorrectly forwarded samples is captured by the probability of false ... the total fraction of stream data forwarded across the entire chain n=1 ℘i = n=1 πi PiD , on the other hand, is the fraction i i of data out of the entire stream that is correctly forwarded across ... different objectives (accuracy and delay), we construct a single objective function F · G(D), based on the concept of fairness implemented by the Nash product [38] (The generalized Nash product provides...
- 17
- 416
- 0
Báo cáo hóa học: " Research Article Analysis of Filter-Bank-Based Methods for Fast Serial Acquisition of BOC-Modulated Signals" potx
... [17, 18], whose number of degrees of freedom depends on the method and the number of filters used Next section presents the parameters of the distribution of Z for each of the analyzed methods ... Fishman and J W Betz, “Predicting performance of direct acquisition for the M-code signal,” in Proceedings of the International Technical Meeting of the Institute of Navigation (IONNTM ’00), ... Pml / Npieces for ml √ single SB (and xλbin = 2Pml / Npieces for dual SB) For FBBefw , the reasoning is not so straightforward (because the sum of squares of Gaussian variables of different variances...
- 11
- 344
- 0
Báo cáo lâm nghiệp: "Assessment of the assortment potential of the growing stock – a photogrammetry based approach for an automatized grading of sample trees" potx
... contracts in the test regions The selection of these contracts was oriented on the validity period (1998–2002) and on the representativity of the contracts for the customer structure for the forest ... objects and facilitate a realistic definition of object memberships The fuzzy logic based classification in eCognition uses therefore a broad spectrum of different object features, such as spectral ... directions and two different distances: for an objective recording of the average quality, the photos were taken from the directions of the smallest and of the largest DBH For the documentation of...
- 10
- 359
- 0
Báo cáo y học: "Differential expression, function and response to inflammatory stimuli of 11β-hydroxysteroid dehydrogenase type 1 in human fibroblasts: a mechanism for tissue-specific regulation of inflammation" pps
... primer: GTAGCCCACTCTCTCGTCCAA Probe: AAGGCACGCCCTCCCAGCG GRα Forward primer: GCGATGGTCTCAGAAACCAAAC Reverse primer: GAGATTACAGAGGAAGTTATCCTCTGC Probe: TGCAGTGAAGGTTGCTGAGGCTCTGA GRβ Forward primer: ... TTGTCACTGGTCAGCTCCAG Probe: CACCTTCTGCTGCGTCTCCACGTT C/EBPβ Forward primer: GACAAGCACAGCGACGAGTA Reverse primer: GTGCTGCGTCTCCAGGTT Probe: ATCTTGGCCTTGTCGCGGCTCTT IL-6 Assay on demand Hs00174131_m1 ... CAA CT Reverse primer: AACTCTTGGATTCTATGCATGAAAATGTTA TGTGGTTA Probe: TGT GTG AGA TGT GCT TTC TGG TT C/EBPα Forward primer: TGGACAAGAACAGCAACGAG Reverse primer: TTGTCACTGGTCAGCTCCAG Probe: CACCTTCTGCTGCGTCTCCACGTT...
- 10
- 438
- 0
Báo cáo sinh học: " A tree-based method for the rapid screening of chemical fingerprints" potx
... of Chemical Information and Modeling 2007, 47(2):302-317 Smellie A: Compressed Binary Bit Trees: A New Data Structure For Accelerating Database Searching Journal of Chemical Information and Modeling ... Algorithms for Molecular Biology 2010, 5:9 http://www.almob.org/content/5/1/9 Page of 10 Figure 12 Fraction of coefficient calculated, different threshold The fraction of the database for which ... 11 Fraction of coefficients calculated, different database size The fraction of the database for which the Tanimoto coefficient is calculated explicitly, measured for different number of fingerprints...
- 10
- 372
- 0
A filter based approach for stochastic performance monitoring of feedback control systems
... Comparison of tradeoff curve obtained from exact G and identified G for example 75 Figure 5.6: Variance tradeoff curve for example 76 Figure 5.7: Comparison of tradeoff curve obtained from exact G ... identified G for example 77 Figure 5.8: Comparison of tradeoff curve for various control strategies for example 4, obtained with exact G 78 x LIST OF TABLES Table 4.1: Comparison of results with exact ... algorithm for MIMO performance assessment Harris et al (1996) also extended MVC for MIMO performance assessment based on the estimation of interactor matrix The issue of estimation of time delay...
- 105
- 332
- 0
Báo cáo khoa học: " Systematisation of spatial uncertainties for comparison between a MR and a CT-based radiotherapy workflow for prostate treatments" pptx
... development of an online treatment setup workflow designed for soft tissue tumours Figure illustrates a MRonly workflow and a more conventional CT- based workflow In the MR -based workflow, the ... between MR and CT for prostate patients can be performed based on fiducial markers [14] The trend is, however, to use mutual information (MI) registration based directly on the patient anatomy ... gradient coil specific distortion correction algorithm was applied Even though this device specific corrections only correct for intrinsic gradient non-linearity connected to a specific type of scanner/gradient...
- 9
- 322
- 0
Báo cáo sinh học: " Research Article A New Switching-Based Median Filtering Scheme and Algorithm for Removal of High-Density Salt and Pepper Noise in Images" pptx
... Results of different filters for Lena image (a) Output of SMF (b) Output of PSMF (c) Output of AMF (d) Output of DBA (e) Output of REMF (f) Output of PA Row 1–Row show processed results of various ... Results of different filters for Boat image (a) Output of SMF (b) Output of PSMF (c) Output of AMF (d) Output of DBA (e) Output of REMF (f) Output of PA Row 1–Row show processed results of various ... Results of different filters for Cameraman image (a) Output of SMF (b) Output of PSMF (c) Output of AMF (d) Output of DBA (e) Output of REMF (f) Output of PA Row 1–Row show processed results of various...
- 11
- 356
- 0
Báo cáo hóa học: " A New Image Analysis Based Method for Measuring Electrospun Nanofiber Diameter" pptx
... of a broken skeleton at intersection points is a main challenging area within the use of this method Since two or more fibers cross each other at these intersections, the value of the center of ... measuring fiber diameter at intersections New Distance Transform Algorithm We established a new method based on image analysis in which the problem associated with the intersections was solved The method ... the location of these points Then the thickness of each intersection is recorded from the distance transformed image Finally the intersections are deleted from the skeleton image based on their...
- 4
- 296
- 0
Báo cáo hóa học: " A New Image Analysis Based Method for Measuring Electrospun Nanofiber Diameter" ppt
... of a broken skeleton at intersection points is a main challenging area within the use of this method Since two or more fibers cross each other at these intersections, the value of the center of ... measuring fiber diameter at intersections New Distance Transform Algorithm We established a new method based on image analysis in which the problem associated with the intersections was solved The method ... the location of these points Then the thickness of each intersection is recorded from the distance transformed image Finally the intersections are deleted from the skeleton image based on their...
- 4
- 330
- 0
Báo cáo hóa học: "A New Pipelined Systolic Array-Based Architecture for Matrix Inversion in FPGAs with Kalman Filter Case Study" docx
... for electronics projects at Polymer Electronic Research Centre at The University of Auckland He has been on the Executive Committee of IEEE New Zealand North Section since 2001 He has been acting ... sections with different mapping ratios This can be achieved by storing one inverse value, the median of the group, in the LUT to represent the results of 1/b for a group of consecutive values of ... “1” for enable and “0” for disable (iii) 1-bit multiplexer select signal: sel for controlling the input data sources selection in data path multiplexers: “1” for input from matrix and “0” for...
- 12
- 436
- 0
Báo cáo khoa học: "F-FDG PET/CT-based gross tumor volume definition for radiotherapy in head and neck Cancer: a correlation study between suitable uptake value threshold and tumor parameters" pdf
... match for GTV The PET data of the PET /CT image was only used for CT- based GTV comparison but not for seeking metastatic disease or for changing the radiation treatment strategy Methods Patient ... PET /CT workstation for diagnostic readings, and it allows for definition of threshold level and reproducible contouring of hypermetabolic areas Delineation of CT- based tumor volume On the basis of ... a history of diabetes and all had a normal serum glucose level before taking the PET /CT image The characteristics of the 15 patients are listed in Table PET -CT image acquisition All patients were...
- 8
- 368
- 0
Báo cáo khoa học: "Determination of patient-specific internal gross tumor volumes for lung cancer using four-dimensional computed tomography" pptx
... data set 4-D CT of IGTV for stage I lung tumors based on (a) IGTVMIP, (b) IGTVMIP-Modified, (c) IGTV2Phases, and (d) IGTVAllPhases of a Delineation of IGTV for stage I lung tumors based on (a) ... IGTVAllPhases of a Figure data set 4-D CT Delineation of IGTV for stage III lung tumors based on (a) IGTVMIP, (b) IGTVMIP-Modified, (c) IGTV2Phases, and (d) IGTVAllPhases of a 4-D CT data set MIP -based ... underestimation was generally lower for the two-phase -based IGTV than for the MIP -based IGTV Therefore, if 4-D CT based IGTVMIP-Modifiedis not available, the two-phase -based IGTV is a reasonable alternative...
- 14
- 352
- 0
báo cáo khoa học: " The IGNITE (investigation to guide new insight into translational effectiveness) trial: Protocol for a translational study of an evidenced-based wellness program in fire departments" ppsx
... Study power Analysis of cross-sectional survey data for outcomes will have sufficient power to detect small effects, with adjustment of the multilevel structure of the data For the more comprehensive ... covariance structure models, power depends on several factors, such as the number of parameters, effect sizes, levels of analysis, and measurement model Based on rule of thumb ratios of sample size ... simulation of latent variable models, this study has a power of approximately 0.4 for a small effect, 0.7 for a moderately small effect (halfway between small and medium), and 0.97 for medium effects...
- 8
- 402
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25