4 the existence of island groups that formed over hot spots and that provide a frame of reference for tracing the direction of plate motion
Báo cáo sinh học: "Distinguishing between hot-spots and melting-pots of genetic diversity using haplotype connectivity" pot
... particular, based on considerations - such as the shape of the GDS for the Landes and Pantelleria locations - it was hypothesized that Landes and Pantelleria are hot- spots, although it was also stated ... (GDS) for (a) the Landes location and (b) the Pantelleria location in Figure For every possible distance, the number of pairs of haplotypes that are that distance apart is depicted Nguyen et al Algorithms ... Nature 20 04, 43 1 :44 9 -45 2 27 Rauch EM, Bar-Yam Y: Estimating the total genetic diversity of a spatial field population from a sample and implications of its dependence on habitat area Proc Natl...
- 10
- 281
- 0
báo cáo khoa học: " Evidence-informed health policy 4 – Case descriptions of organizations that support the use of research evidence" ppsx
... with a particular emphasis on Africa, Asia, and Latin America; 3) coverage of the three categories of organizations, with a particular emphasis on GSUs; and 4) coverage of the themes that emerged ... Tanzania, and Uganda) 8:26 AF 4- 2 Thailand A constellation of research units that informed the development and evaluated the implementation of Thailand's nascent universal health insurance program, ... led the data collection and the analysis of the qualitative data, and contributed to drafting the article EP contributed to data collection All authors read and approved the final manuscript Additional...
- 9
- 290
- 0
Tài liệu Dive Into Python-Chapter 4. The Power Of Introspection ppt
... make an instance evaluate to false You'll learn all about classes and special methods in Chapter If all values are true in a boolean context, and returns the last value In this case, and evaluates ... form of the and- or trick, which is okay, because a lambda function is always true in a boolean context (That doesn't mean that a lambda function can't return a false value The function is always ... usage pattern of getattr is as a dispatcher For example, if you had a program that could output data in a variety of different formats, you could define separate functions for each output format...
- 45
- 651
- 0
Tài liệu Gulf War and Health: Volume 4. Health Effects of Serving in the Gulf War docx
... LIMITATIONS OF THE GULF WAR STUDIES Overall, the studies of Gulf War veterans’ health are of varied quality Although, they have provided valuable information, many of them have limitations that hinder accurate ... Academy of Sciences The National Academy of Engineering was established in 19 64, under the charter of the National Academy of Sciences, as a parallel organization of outstanding engineers It is autonomous ... independently of input from IOM and its staff, we deeply appreciate their hard work and attention to detail and the extensive research that they conducted to ensure that we had all the information that...
- 292
- 574
- 0
Tài liệu Báo cáo Y học: A novel meta-cleavage dioxygenase that cleaves a carboxyl-groupsubstituted 2-aminophenol Purification and characterization of 4-amino-3-hydroxybenzoate 2,3-dioxygenase from Bordetella sp. strain 10d doc
... including those of extradiol dioxygenases available in the FASTA AND BLAST database programs at the DNA Data Bank of Japan The gene encoding 4- amino-3-hydroxybenzoate 2,3-dioxygenase is currently ... Chem 272, 147 27– 147 32 10 Aoki, K., Takenaka, S., Murakami, S & Shinke, R (1997) Partial purification and characterization of a bacterial dioxygenase that catalyzes the ring fission of 2-aminophenol ... Morphological and phenotypic characterization Physiological and biochemical parameters, such as Gram reaction, flagella type, catalase activity, oxidase activity and OF test, were determined using classical...
- 7
- 490
- 0
Tài liệu Báo cáo Y học: Analyses of the CYP11B gene family in the guinea pig suggest the existence of a primordial CYP11B gene with aldosterone synthase activity docx
... RNAse A/ H protected fragments were separated by PAGE and visualized by autoradiography RACE The cDNA for CYP11B2 of the guinea pig was amplified and cloned using a MarathonÒ cDNA Amplification ... NotI and a SmaI site was ligated to both ends of the cDNA pool Using a combination of a primer complementary to the adapter (adapter primer: 5¢-CCATCCTAATACGACTCACTA TAGGGC-3¢) and a gene-specific ... and precipitated using EtOH and sodium acetate After extensive washing the DNA was redissolved in Tris/EDTA, pH 8.0 and separated on a · Tris/borate/EDTA, 0.9% agarose gel After capillary transfer...
- 9
- 671
- 0
Báo cáo khoa học: Existence of novel b-1,2 linkage-containing side chain in the mannan of Candida lusitaniae, antigenically related to Candida albicans serotype A potx
... Manb1fi2Manb1fi2Mana1fiphosphate a1 fi2Mana1fi3Mana1fi2 a1 fi3Mana1fi2Mana1fi3Mana1fi2 ›6 ›6 Mana1 Mana1 Mana1fi2Mana1fi2 a1 fi2Mana1fi2Mana1fi2 b1fi2Mana1fi2Mana1fi2 a1 fi3Mana1fi2Mana1fi2Mana1fi2 ›6 Mana1 Mana1fi3 a1 fi6Mana1fi6Mana1fi6Mana1fi6 ›2 Mana1 ... Mana1 a1 fi6Mana1fi6Mana1fi6Mana1fi6 > > ›2 ›2 ›2 > > = Mana1 a1 fi6Mana1fi6Mana1fi6Mana1fi6 > ›2 > > > a1 fi2Mana1 ; a1 fi6Mana1fi6Mana1fi6Mana1fi6 ›2 ›2 ›2 a1 fi2Mana1 Mana1fi2 Mana1fi6 a1 fi6Mana1fi6 a1 fi3Mana1fi2 Manb1fi2Mana1fi3 ... Suzuki, A. , Ikuta, K., Kobayashi, H., Suzuki, S & Okawa, Y (1996) Structure and antigenicity of the mannans of Candida famata and Candida saitoana Comparative study of the mannan of Candida guilliermondii...
- 11
- 456
- 0
Báo cáo khoa học: "ON THE EXISTENCE OF PRIMITIVE MEANING UNITS " potx
... is that the chosen building blocks are artifacts of the particular descrlptions that were given to Moran We feel this is an advantage rather than a drawback, since Moran must assume that the ... throws the b a l l " Ic show thac d u r i n g s e n s e of the actlan "throw," a human agent remains at a location AN OVERVIEW OF MORAN while a physical object changes location from where the Agent ... Eistin and Figaro are human As i n p u t to a learning crlal, Moran is p r e s e n t e d with: i) r e s e n t "Sharon threw the t e r m i n a l a t Raphael." a snapshot of the room Just before an action...
- 4
- 247
- 0
INFLUENTIAL MARKETING: A NEW DIRECT MARKETING STRATEGY ADDRESSING THE EXISTENCE OF VOLUNTARY BUYERS doc
... is that it reduces the data available for training In over- sampling, training samples of the minority class is over- sampled at random until the relative size of the minority and majority classes ... minority class Training samples of the majority class are randomly eliminated until the ratio of the majority and minority classes reach a preset value, usually close to A disadvantage of under-sampling ... on a real data set provided by the Canadian Imperial Bank of Canada (CIBC) In addition, a third model based on the same data set was constructed “in-house” by CIBC Recall that a traditional direct...
- 67
- 600
- 0
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx
... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGCTGACTCAGTCTCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTTCTTCTGAGCTGACTCAGGACCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTTCCTATGTGCTGACTCAGCCACC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCACGTTATACTGACTCAACCGCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGGCTGTGCTCACTCAGCCGTC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGGCTGTGCTCACTCAGCCGTC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC...
- 11
- 679
- 0
Báo cáo khoa học: N-Glycan structures of squid rhodopsin Existence of the a1–3 and a1–6 difucosylated innermost GlcNAc residue in a molluscan glycoprotein pot
... (tentatively named glycan B) was further chromatographed on the amide-silica column and separated into two fractions, glycan B1 and glycan B2, with a molar ratio of 17 : (data not shown) Each of the ... amide-silica columns On the basis of these data, we conclude that glycan C is an analog of glycan B1 that lacks only the a1 –3-linked fucose residue ESI-MS analysis showed that the molecular mass of glycan ... Kurono, M & Takahashi, N (1991) Calculated two-dimensional sugar map of pyridylaminated oligosaccharides: elucidation of the jack bean a- mannosidase digestion pathway of Man9GlcNAc2 Anal Biochem...
- 6
- 429
- 0
the scientific explanation for the existence of vampires
... such as the Babylonians and the Assyrians Throughout the ages many medicalexplanations that could explain the vampire phenomena have been overlooked The firstreason was the lack of education that ... genetically predisposed to have the disease by a sudden lossof large amounts of blood When these factor are taken into consideration, one could saythat when a vampire came back to attack a sibling and ... in Ireland they had black eyes Vampires have been around for centuries , in some cases they have beenrecognized and feared by cultures that were around thousands of years before the time ofChrist,...
- 4
- 203
- 0
molkentin-the book of qt 4-the art of building qt applications
... demanded of classes having QObject as a base class: the treatment of events and the translation of strings from one language to another These are explained in detail in Chapters and 14 39 Basics, ... languages—provided that you use QString for manipulating text that the user may see The classes QImage (used for loading and saving images), QColor (which saves a color), and many others are also ... Qt at a Glance The QtDBus Library DBus is a messaging protocol that has emerged as a de facto standard on Linux and other Unix derivates For instance, the Linux Hardware Abstraction Layer (HAL)...
- 442
- 454
- 0
the nothing that is, a natural history of zero - robert kaplan
... Gautama answers: ayuta, niyuta, karikara, vivara, achobya, vivaha, utsanga, bahula, nagabala, titilambha, vyavaithanaprajnapti (! that' s 1031), and so through the alluring samaptalambha (1037) and ... and 1087, you have to say that Archimedes' estimate wasn't all that bad This is a spectacular application of the Greek insight that the world afar can be grasped by analogy to the world at hand ... even claim that such flexibility was the greatest advantage of this notation Whoever it was, in the latter days of Babylon, that first gave to airy nothing a local habitation and a name, has left...
- 238
- 5,165
- 0
the existence of god jun 2004
... explanation— they can state some of the causes that make up the ‘what’ and some of the reasons for their efficacy In that case they are providing an explanation, but only a partial one Also, of course, ... the latter It is along these lines that the theist may wish to answer the accusation that an argument such as the cosmological argument does not show the existence of the God of Abraham, Isaac, ... to the existence of God, but they start from premisses that are far from generally accepted On the other hand, I shall argue that most of the arguments (taken separately and together) for the existence...
- 372
- 279
- 0
Báo cáo hóa học: " The existence of fixed points for new nonlinear multivalued maps and their applications" potx
... = ∅ Remark 4. 2 (a) Corollary 4. 3 and Corollary 4. 4 are indeed equivalent (b) Theorems 4. 1 -4. 6 and Corollaries 4. 1 -4. 4 all generalize and improve [5, Theorem 2.6] and the primitive Kannan’s fixed ... means that T satisfies (D4) (4) Let (X, d) be a metric space and T: X ® X is a single-valued map of Kannan’s type, then T is a capable map since (D5) holds; for more detail, see [[16], Corollary ... Corollary 3.2 (b) Theorems 3.1-3 .4 and Corollaries 3.1 and 3.2 all generalize and improve [5, Theorem 3 .4] and the primitive Chatterjea’s fixed point theorem [3] Fixed point theorems of generalized...
- 13
- 501
- 0
Báo cáo hóa học: " The existence of solutions to the nonhomogeneous A-harmonic equation" docx
... X, K and L as Lemmas 4. 2, 4. 3, 4. 4 and 4. 5 By the proposition (4. 1) and Lemmas 4. 2, 4. 3, 4. 4 and 4. 5, there exists an element u in K such that L u, v − u ≥ whenever ν Ỵ K This means that there ... weakly in X Then, there exist ε0 >0, y0 Ỵ X’ and a subsequence xij of xi, such that Li et al Journal of Inequalities and Applications 2011, 2011:80 http://www.journalofinequalitiesandapplications.com/content/2011/1/80 ... Applications 2011, 2011:80 http://www.journalofinequalitiesandapplications.com/content/2011/1/80 (I) Page of 13 the mapping x → A( x, ξ ) is measurable for all ξ ∈ Rn and the mapping ξ → A( x, ξ...
- 13
- 291
- 0
Báo cáo hóa học: " Research Article The Existence of Positive Solution to a Nonlinear Fractional Differential Equation with Integral Boundary Conditions" potx
... Vasundhara Devi, Theory of Fractional Dynamic Systems, Cambridge Academic, Cambridge, UK, 2009 V Lakshmikantham and A S Vatsala, “Basic theory of fractional differential equations,” Nonlinear Analysis ... Theory and Applications of Fractional Differential Equations, vol 2 04 of North-Holland Mathematics Studies, Elsevier Science, Amsterdam, The Netherlands, 2006 V Lakshmikantham, S Leela, and J Vasundhara ... Analysis and Applications, vol 302, no 1, pp 56– 64, 2005 V Daftardar-Gejji and S Bhalekar, “Boundary value problems for multi-term fractional differential equations,” Journal of Mathematical Analysis...
- 14
- 430
- 0
Báo cáo hóa học: " Research Article On the Existence of Solutions for Dynamic Boundary Value Problems under Barrier Strips Condition" doc
... calculus,” Results in Mathematics, vol 18, no 1-2, pp 18–56, 1990 B Kaymakcalan, V Lakshmikantham, and S Sivasundaram, Dynamic Systems on Measure Chains, vol 370 of Mathematics and Its Applications, ... for nonlinear dynamical systems on a measure chain,” Journal of Computational and Applied Mathematics, vol 162, no 2, pp 42 1 43 0, 20 04 14 H Luo and R Ma, “Nodal solutions to nonlinear eigenvalue ... Erbe, A Peterson, and R Mathsen, Existence, multiplicity, and nonexistence of positive solutions to a differential equation on a measure chain,” Journal of Computational and Applied Mathematics,...
- 9
- 410
- 0
báo cáo hóa học:" Research Article Time-Scale-Dependent Criteria for the Existence of Positive Solutions to p-Laplacian Multipoint Boundary Value Problem" pdf
... Kluwer Academic Publishers, Dordrecht, The Netherlands, 2003 V Lakshmikantham, S Sivasundaram, and B Kaymakcalan, Dynamic Systems on Measure Chains, vol 370 of Mathematics and Its Applications, ... 3.2 and i γ Ax > c for all x ∈ ∂P γ, c , ii θ Ax < b for all x ∈ ∂P θ, b , and iii P α, a / ∅ and α Ax > a for all x ∈ ∂P α, a Then, the operator A has at least two fixed points, denoted by x1 and ... 107–127, 2003 38 A Cabada and D R Vivero, “Expression of the Lebesgue Δ-integral on time scales as a usual Lebesgue integral: application to the calculus of Δ-antiderivatives,” Mathematical and Computer...
- 20
- 250
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ