4 simulating while drilling horizontal gas wells through a dome shaped reservoir
Báo cáo khoa học: Human lactoferrin activates NF-jB through the Toll-like receptor 4 pathway while it interferes with the lipopolysaccharide-stimulated TLR4 signaling potx
... purified fraction, the concentration of the oligosaccharides was determined Acknowledgements We thank T Hiraga, K Ihashi, K Sato, N Komagata, H Majima, Y Namekawa, A Suzuki, A Kashimura, M Yamamuro, ... that contributes to the impairment of LPS action, while only hLF contains ‘active carbohydrate chains’ to stimulate TLR4-mediated signaling pathways As the candidate of ‘active carbohydrate chains’, ... endo-b-galactosidase, which is known to cleave the carbohydrate chains at the internal Galb1-4GlcNAc position, IKK activation and nuclear translocation of RelA were significantly impaired, while the same treatment...
- 16
- 456
- 0
Tài liệu Opportunities to Reduce Greenhouse Gas Emissions through Materials and Land Management Practices docx
... The total technical potential scenarios presented here represent early analysis based on existing and available data. As more analysis is completed, total technical potential scenarios can be generated for a greater number of materials and land management approaches. ... There is a strong link between U.S. GHG emissions and the management of materials and land. EPA, along with its partners, can help address the challenges of global climate change through materials and land management programs. As we develop programs and policies with our partners, more detailed ... Opportunities to Reduce Greenhouse Gas Emissions through Materials and Land Management Practices September 2009 SECTION 3 POTENTIAL GHG REDUCTIONS THROUGH MATERIALS AND LAND MANAGEMENT Materials and land management directly and indirectly impact 58‐62% of total U.S. GHG emissions, ...
- 98
- 501
- 0
Some aspects of American culture and society in the twentieth and twenty-first centuries through a number of selected short literary works
... American Short Story 2002, Tom McNeal draws a picture of an American woman in the late 1920s Doreen Sulivan, a beautiful woman from Philadelphia, had an appearance which was a fashion of the day ... mass consumer magazines such as Seventeen and Cosmopolitan, made up 20 % of the models to appear on 47 1 covers of 31 magazines published in 2002 (Garcia G, 20 04, p 43 ) Many African American have ... current 44 th president of the United States Barack Obama who has made a history in American presidency to be the first black to hold the office African American have gained recognizable stand in American...
- 49
- 785
- 1
Hydromagnetic convective flow past a vertical porous plate through a porous medium with suction and heat source
... m7 = A6 = − A5 + A4 + A3 , A7 = A1 0 = A7 − A8 + A9 , B1 = A1 m5 (m3 − m5 )(m4 + m5 ) , A8 = A1 m1 (m3 − m1 )(m4 + m1 ) , A9 = A2 m7 (m3 − m7 )(m4 + m7 ) , 2 A1 A3 Pr G r A1 A5 Pr G r − A1 A4 Pr ... from Table that both heat source parameter S and permeability parameter enhance the skin friction at the wall 4. 4 Rate of heat transfer The variations in the values of rate of heat transfer at the ... 833- 845 [9] Choudhury R., Das A Magnetohydrodynamic boundary layer flows of non-Newtonian fluid past a flat plate Ind J Pure Appl Math 2000, 31(11), 142 9- 144 1 [10] Sharma P R., Pareek D Steady...
- 12
- 428
- 0
Đề giao lưu toán tuổi thơ Lớp 4 năm 2010 trường Tiểu học Mường Chùm A
... Diện tích hình vuông ABCD là: (0.5đ) 12 x 12 = 144 (cm2) (2đ) Diện tích hình chữ nhật ABNM là: (0.5đ) x 12 = 72 (cm2) (2đ) Đáp số: Hình vuông ABCD 144 cm2 (0.5đ) Hình chữ nhật ABNM 72 cm2 ( 0.5đ) ... + 3) + (6+ 4) + (6 + 5) = 45 Vậy x = Đề số ;16 Số bé : 378 : = 126 Số lớn là: 378 + 126 = 5 04 Tổng cần tìm là: 5 04 + 126 = 630 Đề số (2.5đ) (2.5đ) (5đ) Mỗi số điểm 325 74 1300 2275 240 50 Đề số ... GD&ĐT MƯỜNG LA CỘNG HOÀ XÃ HỘI CHỦ NGH A VIỆT NAM Trường TH mường Chùm A Độc lập – Tự – Hạnh phúc ĐÁP ÁN CHẤM THI GIAO LƯU TOÁN TUỐI THƠ KHỐI LỚP Năm học: 2010 – 2011 Đề số; 1; 14 Điền số (2 điểm)...
- 6
- 1,863
- 47
Tài liệu Báo cáo khoa học: C-Terminal extension of a plant cysteine protease modulates proteolytic activity through a partial inhibitory mechanism doc
... N-Pro 208 aa 34 aa CT - ex Stop 1 14 aa Xho1 365 aa 24 aa 208 aa N-Pro N Pro II 24 aa Protease domain BamH H1 Start I 1 14 aa Pre A S Dutta et al Protease domain CT - ex 34 aa III 208 aa N-Pro NP ... characterization of a highly stable cysteine protease from the latex of Ervatamia coronaria Biosci Biotechnol Biochem 62, 1 947 –1955 15 GuhaThakurta P, Biswas S, Chakrabarti C, Sundd M, Jagannadham ... Jagannadham MV & Dattagupta JK (20 04) Structural basis of the unusual stability and substrate specificity of ervatamin-C, a plant cysteine protease from Ervatamia coronaria Biochemistry 43 , 1532–1 540 ...
- 13
- 759
- 0
Tài liệu Báo cáo khoa học: Activated Rac1, but not the tumorigenic variant Rac1b, is ubiquitinated on Lys 147 through a JNK-regulated process docx
... ligase Itch Science 306, 271–275 40 Tapon N, Nagata K, Lamarche N & Hall A (1998) A new rac target POSH is an SH3-containing scaffold protein involved in the JNK and NF-kappaB signalling pathways ... ubiquitination is unlikely to be related to a defective membrane interaction While being persistently activated and associated with plasma membrane, Rac1b has an impaired ability to activate several ... that the stimulation of Rac1-dependent pathways may, in some way, activate the Rac1 ubiquitination machinery As Rac1b has been shown to display reduced capacity to bind POSH [28] and to activate...
- 11
- 469
- 0
Tài liệu Báo cáo Y học: Ornithine decarboxylase-antizyme is rapidly degraded through a mechanism that requires functional ubiquitin-dependent proteolytic activity pot
... mammalian cells is ATP dependent but ubiquitin independent Eur J Biochem 185, 46 9 47 4 Murakami, Y., Matsufuji, S., Kameji, T., Hayashi, S., Igarashi, K., Tamura, T., Tanaka, K & Ichihara, A (1992) ... cDNA encoding mammalian ornithine decarboxylase Proc Natl Acad Sci USA 81, 3 645 –3 649 30 Graham, F.L & van der Eb, A. J (1973) A new technique for the assay of infectivity of human adenovirus DNA ... Acta 1353, 209–216 42 Kitani, T & Fujisawa, H (1989) Purification and characterization of antizyme inhibitor of ornithine decarboxylase from rat liver Biochim Biophys Acta 991, 44 49 43 Fujita,...
- 7
- 382
- 0
Tài liệu Playing through: A Guide to the Unwritten Rules of Golf potx
... replaced, and littering xi playing through golf cart abuse Walking car ts and riding car ts are great conveniences and can save your back, but they also can wreak havoc on other people’s golf games ... trash bin manners matter 17 Foul Language Almost all of us are guilty of the occasional expletive Asking all golfers to cease swearing, while an admirable concept, simply isn’t practical What ... that way really was a pleasure.) Yes, traditions change, even in the hallowed game of golf And as traditions have changed, dress codes have changed as well One issue that percolated in the early...
- 223
- 404
- 0
Báo cáo khoa học: The SWI⁄SNF protein BAF60b is ubiquitinated through a signalling process involving Rac GTPase and the RING finger protein Unkempt doc
... process takes place Indeed, although Rac activation is believed to occur primarily at the plasma membrane, BAF60b ubiquitination is controlled by Rac and Unkempt BAF60b, as well as BAF6 0a and BAF60c, ... Y, Minoshima Y, Hatori T, Tsuchiya A, Kiyono M, Nosaka T et al (2006) Rac1 and a GTPaseactivating protein, MgcRacGAP, are required for nuclear translocation of STAT transcription factors J Cell ... cellular mRNA levels were monitored by RT-PCR (Access RT-PCR system; Promega, Madison, WI, USA) using Unkempt-specific primers 5¢TCTTCGAGTG CAAGTCCAAA and 5¢AAGATCACCTGTGCCTCCAC, and normalized against...
- 12
- 432
- 0
Báo cáo khoa học: Organizing signal transduction through A-kinase anchoring proteins (AKAPs) docx
... proteasomal degradation or stabilization of the transcription factor HIF- 1a AKAP signaling AKAP-Lbc signaling complex AKAP-Lbc is another multivalent anchoring protein that organizes PKA and PKC ... proteins (AKAP150, mAKAP and AKAP-Lbc) and their interacting partners are discussed in detail (Table 1) AKAP79/150 signaling complexes To date, AKAP150 (the murine homolog of human AKAP79) remains ... mAKAP–PKA–PDE configuration forms a classic enzyme feedback loop because anchored PKA activity eventually leads to the termination of cAMP signals Interestingly, the same AKAP A B C D Fig mAKAP...
- 6
- 357
- 0
Báo cáo khoa học: The transcription factor ZBP-89 suppresses p16 expression through a histone modification mechanism to affect cell senescence doc
... 5¢-AGACAGCCGTTTTACACGCAG-3¢; P2 antisense, 5¢-CACCGAGAAATCGAAATCACC-3¢; P3 sense, 5¢-TAGGAAGGTTGTATCGCGGAGG-3¢; and P3 antisense, 5¢-CAAGGAAGGAGGACTGGGCTC-3¢ [28] The locations of P1, P2 and ... isothiocyanate-conjugated goat anti-(rabbit serum) as secondary antibody, incubated with rat anti-3MeK9H3 serum and stained with TRITCconjugated goat anti-(rat serum) as secondary antibody, and finally ... Immunofluorescence staining and SAHF assay This work was supported by grants from The National Basic Research Program of China (2005CB52 240 4 and 2006CB910506), the Program for Changjiang Scholars and Innovative...
- 10
- 374
- 0
Reducing Childhood Obesity in Ontario through a Health Equity Lens docx
... food, clean air, affordable child care, accessible and affordable recreation services, and access to high quality health care 23 Bierman et al, ‘Social Determinants of Health and Populations at Risk’, ... health is far higher for marginalized populations Health inequities – differences in health outcomes that are avoidable, unfair, and systematically related to social inequality and disadvantage ... Determinants of Health and Populations at Risk’, p 29 29 Bierman et al, ‘Social Determinants of Health and Populations at Risk’, p 29 30 Raine, Overweight and Obese in Canada: A Population Health...
- 13
- 322
- 0
Báo cáo Y học: A catalytically inactive b1,4-N-acetylglucosaminyltransferase III (GnT-III) behaves as a dominant negative GnT-III inhibitor potx
... overlapping peaks of asialo-agalacto biantennary and asialo-agalacto tetraantennary sugar chains; right, asialo, agalacto triantennary sugar chain containing a b1 ,4- GlcNAc residue on the Mana1,3 arm These ... tetraantennary sugar chain; 3, asialoagalacto-bisected triantennary sugar chain containing a b1 ,4- GlcNAc residue on the Mana1,3 arm Arrowheads indicate nonbisected sugar chains: left arrowhead, overlapping ... GnT-IIItransfectant (b) and D32 3A- transfectant (c) Numbers at the top indicate peaks for bisected sugar chains: 1, asialo-agalacto-bisected biantennary sugar chain; 2, asialo-agalactobisected tetraantennary...
- 9
- 352
- 0
Báo cáo khoa học: Mammalian 105 kDa heat shock family proteins suppress hydrogen peroxide-induced apoptosis through a p38 MAPK-dependent mitochondrial pathway in HeLa cells potx
... Biotechnology, Santa Cruz, CA, USA); cleaved caspase-3, rabbit polyclonal anti-cleaved caspase-3 (Asp175) (#9661; Cell Signaling Technology, Danvers, MA, USA); caspase-9, rabbit polyclonal anti-caspase-9 ... 31607–31611 41 Matsukawa J, Matsuzawa A, Takeda K & Ichijo H (20 04) The ASK1-MAP kinase cascades in mammalian stress response J Biochem (Tokyo) 136, 261–265 42 Kim AH, Khursigara G, Sun X, Franke TF ... & Hatayama T (1999) Molecular cloning, expression and localization of human 105 kDa heat shock protein, hsp105 Biochim Biophys Acta 144 4, 138– 142 Yamagishi N, Nishihori H, Ishihara K, Ohtsuka...
- 13
- 215
- 0
Báo cáo khoa học: Efficient synthesis of a disulfide-containing protein through a batch cell-free system from wheat germ pdf
... [9] at the linker region was constructed by amplifying the whole plasmid pEU-scFvLH by inverse PCR with the primers s2: 5¢-CAAAAAATTGAATGGCATG AACCGCCGAGCTCCAAC-3¢ and a2 : 5¢-AGCTTCAA AAATATCATTTAAACCCGACGGGCTGCTTTT-3¢ ... 5¢-CTACC AGATCTGCCATGCAGATCGTTGTTACCCAGG-3¢ and a1 : 5¢-GGCTAAGAGCTCACGGTCAGGCTCG-3¢ by using a LATaq PCR kit (50 lL) The sequences underlined are the BglII restriction site and initiation codon, and ... 47 84 T Kawasaki et al (Eur J Biochem 270) Antigen-binding analyses We then examined the antigen binding activity The soluble material from each reaction was loaded on an antigen column and was...
- 7
- 330
- 0
synthesis and growth of hematite nanodiscs through a facile hydrothermal approach
... (2008) Anatase TiO2 single crystals with a large percentage of reactive facets Nature 45 3:638– 641 doi:10.1038/nature069 64 Yin Y, Alivisatos AP (2005) Colloidal nanocrystal synthesis and the organic–inorganic ... Int Ed 44 :41 97 42 01 doi:10.1002/ anie.20050 044 8 Casula MF, Jun YW, Zaziski DJ, Chan EM, Corrias A, Alivisatos AP (2006) The concept of delayed nucleation in nanocrystal growth demonstrated for ... Electronica S.L., Spain); The Brunauer–Emmett–Teller (BET) surface area of the as-prepared particles was measured at 77 K (liquid nitrogen) on a Quantachrome Autosorb-6B Surface Area & Pore Size Analyzer...
- 17
- 623
- 0
Báo cáo khoa học: Folding of epidermal growth factor-like repeats from human tenascin studied through a sequence frame-shift approach pdf
... forms are similar but not identical (Fig 4A) A fit of experimental data with a three-parameter negative exponential curve (R > 0.99, data not shown) gave an apparent rate constant value of 0. 54 min)1 ... apparatus using a PrePak Cartridge 25 · 100 mm (Agilent) casted on a PrepLC Universal Base apparatus (Waters) and a Zorbax 300SB-C18 9 .4 · 250 mm (Agilent) Samples were eluted using a linear gradient ... Fmoc-protected amino acids were purchased from ChemImpex International (Wood Dale, IL, USA), Fluka (Buchs, Switzerland), Advanced Biotech Italia (Seveso, Italy) and NovaBiochem (Darmstadt, Germany) TentaGel...
- 12
- 416
- 0
Báo cáo khoa học: "A Semi-Supervised Key Phrase Extraction Approach: Learning from Title Phrases through a Document Semantic Network" docx
... the abbreviation and synonymy phenomena, we construct a thesaurus and convert all manual and automatic phrases into their canonical forms when evaluated The traditional Recall, Precision and ... phrases are regarded as labeled samples, while the other phrases as unlabeled ones That is, the information we have at the beginning about how to rank phrases is that the title phrases are the ... performance; (2) to compare with other well known state-of-art key phrase extraction approaches 298 4. 2 Parameter tuning The approach involves two parameters: (0) is a relation factor balancing the influence...
- 5
- 367
- 0
Báo cáo Y học: CTGF/Hcs24 induces chondrocyte differentiation through a p38 mitogen-activated protein kinase (p38MAPK), and proliferation through a p44/42 MAPK/extracellular-signal regulated kinase (ERK) doc
... mitogen-activated protein kinase pathway Proc Natl Acad Sci USA 97, 1113–1118 Yonekura, A. , Osaki, M., Hirota, Y., Tsukazaki, T., Miyazaki, Y., Matsumoto, T., Ohtsuru, A. , Namba, H., Shindo, H & Yamashita, ... 2 748 9–2 749 4 Dudley, D.T., Pang, L., Decker, S.J., Bridges, A. J & Saltiel, A. R 37 38 39 40 41 42 43 44 45 46 (1995) A synthetic inhibitor of the mitogen-activated protein kinase cascade Proc Natl Acad ... Yamashita, S (1999) Transforming growth factor-beta stimulates articular chondrocyte cell growth through p 44/ 42 MAP kinase (ERK) activation Endocr J 46 , 545 –553 Hirota, Y., Tsukazaki, T., Yonekura, A. ,...
- 8
- 377
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008