3d deviation maps from geomagic® of the left ilium of gpit 1 plateosaurus engelhardti maximum extension 426 mm 1 pointcloud based file compared to unedited ct file 2 pointcloud based file compared to ct file in which all major crac
Báo cáo y học: " Preferences for the selection of unique tRNA primers revealed from analysis of HIV-1 replication in peripheral blood mononuclear cells" pdf
... tRNALys1 ,2 Page of 10 (page number not for citation purposes) Retrovirology 20 05, 2: 21 20 21 22 23 24 25 26 27 28 http://www.retrovirology.com/content /2 /1/ 21 rather than tRNALys,3 for initiation of reverse ... grant from the NIH to CDM (AI 34749) References 10 11 12 13 14 15 16 17 18 19 Marquet R, Isel C, Ehresmann C, Ehresmann B: tRNAs as primer of reverse transcriptases Biochimie 19 95, 77 :11 3 - 12 4 Mak ... We initiated infections in PBMC with the same amount of p24 antigen We noted a delay in the production of p24 antigen in the cultures of viruses in which both the PBS and A loop were mutated to...
- 10
- 395
- 0
Tài liệu Báo cáo Y học: NMR-based determination of the binding epitope and conformational analysis of MUC-1 glycopeptides and peptides bound to the breast cancer-selective monoclonal antibody SM3 pptx
... 2. 35 2. 35 3.03 3 .17 2. 48 2. 33 2. 99 2. 83 2. 56 2. 46 2. 52 2.44 2. 99 2. 97 3 .13 2. 65 2. 60 2. 60 3.35 3. 51 2. 74 2. 58 3.30 3 . 12 2. 83 2. 72 2.78 2. 69 3. 31 3 .28 3.46 2. 93 10 0 000 generations were subjected ... 4 .25 2 4.574 4. 327 2. 389 2. 707 4 .15 5 1. 798 2. 255 1. 978 2. 543 1. 978 1. 978 3.336 3.336 1. 134 1. 629 1. 978 1. 629 1. 879 3 .16 0 3.7 82 3 .16 0 3.5 82 1. 724 1. 978 7.7 61 7.043 Table 1H-NMR chemical shifts of ... 8. 914 8. 510 4.347 4.779 4.445 4.504 4 .29 5 2. 397 2. 747 4 .29 7 1. 813 2. 270 1. 983 2. 558 1. 983 1. 983 3.368 3. 317 1. 21 7 1. 645 1. 990 1. 645 1. 879 3 .16 0 3.705 3 .16 0 3.5 91 1.678 1. 990 7.788 7. 017 NH GalNAc...
- 12
- 717
- 0
Báo cáo khoa học: "Effects of osteoprotegerin from transfection of pcDNA3.1(+)/chOPG on bioactivity of chicken osteoclasts" potx
... Acta 20 04, 16 44 :1- 7 doi :10 .11 86 /17 51- 014 7-53- 21 Cite this article as: Hou et al.: Effects of osteoprotegerin from transfection of pcDNA3 .1( +)/chOPG on bioactivity of chicken osteoclasts Acta Veterinaria ... lacunae (μm2) 5755 .20 03 ± 23 4.7778 4987.7468 ± 12 4.54 71 739.4407 ± 15 0 .19 78** Note: compared with the control group, ** P < 0. 01 Hou et al Acta Veterinaria Scandinavica 2 011 , 53: 21 http://www.actavetscand.com/content/53 /1/ 21 ... al Acta Veterinaria Scandinavica 2 011 , 53: 21 http://www.actavetscand.com/content/53 /1/ 21 to medullary bone [2] In the absence of structural bone formation, continued osteoclastic resorption of...
- 7
- 166
- 0
Báo cáo y học: "The evolution of HIV-1 reverse transcriptase in route to acquisition of Q151M multi-drug resistance is complex and involves mutations in multiple domains" ppt
... 4-Pol 20 R T 4-RT 4- 62V 18 4I 13 5V 4- 348I d4T IC50, μM 30 90I 13 8A 18 1I 13 8A 18 1I 22 1Y 17 -RT 62V 69N 75I 18 4V C 31L 13 5T 20 2I D 17 -Cn-Rh 13 8A 18 1I 22 1Y 37-RT 62V 69N 75I 15 1M 18 4V 21 0 F 517 I W ... 22 4 .1 ± 16 .9 26 .3 60.0 ± 13 .8 56.4 ± 7 .2 0.4 0.3 17 -Pol 20 6.5 ± 9.7 24 .2 58 .1 ± 14 .2 0.3 21 8 .9 ± 13 .3 10 0.9 37-RT 21 9 .7 ± 7.5 25 .8 5 12 0.9 ± 515 .6 30.4 23 0.9 ± 10 .2 10 6.4 37-Pol 21 7 .8 ± 18 .1 25 .6 ... L 21 0 V90 NNRTI E138 Y1 81 V100 F87 V SF 20 I A100 I100 I A100 I100 M230 L I100 A100 I100 A100 I100 Y70 H2 21 N348 N100 10 0 T69 Y100 10 0 I100 I3 L94 I 31 L100 A33 V97 T48 S100 S68 K1 02 G100 R 61 N100...
- 11
- 350
- 0
Báo cáo y học: " Dendritic cell-mediated HIV-1 transmission to T cells of LAD-1 patients is impaired due to the defect in LFA-1" docx
... 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 Dustin ML, Springer TA: T-cell receptor cross-linking transiently stimulates adhesiveness through LFA -1 Nature 19 89, 3 41: 619 - 624 van Kooyk ... analysis of integrin function in man: LAD -1 and other syndromes Matrix Biol 20 00, 19 : 21 1 -22 2 Anderson DC, Springer TA: Leukocyte adhesion deficiency: an inherited defect in the Mac -1, LFA -1, and p150,95 ... calcium influx, actin metabolism and protein kinase activity [20 ] Another factor influencing HIV -1 infectivity is the incorporation of host ICAM -1 in budding virions and expression of LFA -1 on target...
- 9
- 355
- 0
Báo cáo sinh học: " Role of HIV-1 subtype C envelope V3 to V5 regions in viral entry, coreceptor utilization and replication efficiency in primary T-lymphocytes and monocyte-derived macrophages" docx
... -9.06 - 12 .26 -9.36 0 0 0. 01 0 .22 0. 01 0 .22 0.50 0.86 0 .17 0.83 SE SD SD SE 6 4 0.33 0.48 0.48 0. 31 Sinsi -11 .16 0. 01 0.04 SE 0. 31 AP .18 /18 2, 18 3 AP .2/ 221 A AP .28 /28 2, 28 4 AP.33/3 31, 334 AP.4/4 52, ... clone are shown in Table Page of 12 (page number not for citation purposes) Virology Journal 20 07, 4 : 12 6 NL43 BAL HIV-1C 17 1 17 3 18 2 18 3 2 21 28 2 28 4 3 31 334 4 52 454 5 12 514 639 10 11 1 014 *** GGEFFYCNST ... HIV -1 subtype C chimeras in U373-MAGI-CCR5 and U373-MAGI-CXCR4 cell lines MAGI-CCR5 Infection counts → 5000 CHIMERA_ 17 1 17 3 18 2 18 3 22 1A 28 2 28 4 3 31 334 4 52 5 12 514 639 10 11 1 014 20 99 (B-R5) 21 0 1...
- 12
- 408
- 0
Báo cáo hóa học: " Role of HIV-1 subtype C envelope V3 to V5 regions in viral entry, coreceptor utilization and replication " docx
... -9.06 - 12 .26 -9.36 0 0 0. 01 0 .22 0. 01 0 .22 0.50 0.86 0 .17 0.83 SE SD SD SE 6 4 0.33 0.48 0.48 0. 31 Sinsi -11 .16 0. 01 0.04 SE 0. 31 AP .18 /18 2, 18 3 AP .2/ 221 A AP .28 /28 2, 28 4 AP.33/3 31, 334 AP.4/4 52, ... clone are shown in Table Page of 12 (page number not for citation purposes) Virology Journal 20 07, 4 : 12 6 NL43 BAL HIV-1C 17 1 17 3 18 2 18 3 2 21 28 2 28 4 3 31 334 4 52 454 5 12 514 639 10 11 1 014 *** GGEFFYCNST ... HIV -1 subtype C chimeras in U373-MAGI-CCR5 and U373-MAGI-CXCR4 cell lines MAGI-CCR5 Infection counts → 5000 CHIMERA_ 17 1 17 3 18 2 18 3 22 1A 28 2 28 4 3 31 334 4 52 5 12 514 639 10 11 1 014 20 99 (B-R5) 21 0 1...
- 12
- 684
- 0
Báo cáo hóa học: " Pharmacokinetic evaluation of a 1,3-dicyclohexylurea nanosuspension formulation to support early efficacy assessment" docx
... parameters of 12 3 29 4 Nanoscale Res Lett (20 07) 2: 2 91 29 6 10 Concentration (µ g/ml) V1 (central volume of distribution, 12 85.3 mL), k10 (elimination rate, 1. 62 h 1) , k 12 (rate of distribution from ... carbamazepine Product ions formed at a collision energy of 29 3 23 eV for DCU (m/z 22 5 .1 fi 10 0 .1) and at a collision energy of 27 eV for carbamazepine (m/z 23 7 .1 fi 19 4.3) Pharmacokinetic study of DCU ... by the software using Mie scattering theory There was no absorption by DCU at the laser line (750 nm) so the complex index of refraction was determined by finding the average refractive index of...
- 6
- 336
- 0
báo cáo khoa học: "Anomalous origin of the left coronary artery from the pulmonary artery associated with an accessory atrioventricular pathway and managed successfully with surgical and interventional electrophysiological treatment: a case report" docx
... pathways: getting to the origins Circulation 20 08, 11 7 :15 02 -15 04 doi :10 .11 86 /17 52 -19 47-5-384 Cite this article as: Tsoutsinos et al.: Anomalous origin of the left coronary artery from the pulmonary ... competing interests Received: 25 March 2 010 Accepted: 16 August 2 011 Published: 16 August 2 011 References Dodge-Khatami A, Mavroudis C, Backer CL: Anomalous origin of the left coronary artery from ... ring or infarction and dysfunction of the anterolateral papillary muscle The surgical treatment initially described in the literature was ligation of the left coronary artery [1] Since then, several...
- 4
- 247
- 0
Báo cáo y học: "Texture analysis of cartilage T2 maps: individuals with risk factors for OA have higher and more heterogeneous knee cartilage MR T2 compared to normal controls - data from the osteoarthritis initiative" pptx
... comprised of five contracts (N 01- AR -2- 225 8; N 01- AR -2- 225 9; N 01- AR -2- 226 0; N 01- AR -2- 22 61; N 01- AR -2- 226 2) funded by the National Institutes of Health, a branch of the Department of Health and Human ... - 32. 97 -22 . 81 -0. 72 -1. 18 -0. 72 $ Coefficient -30. 31 -39. 82 -27 .09 -0 .15 -0 . 12 -0 .10 -45.49 -57. 72 -37.48 -1. 39 -1. 94 -1. 31 -5.47 -9. 91 -6 .27 0. 02 0.003 0.03 -5.48 -8. 21 -8 .13 -0.04 -0. 42 -0 . 12 95% ... Oral Maxillofac Surg 19 95, 53 :11 82 -11 92 Mankin HJ: The reaction of articular cartilage to injury and osteoarthritis (first of two parts) N Engl J Med 19 74, 2 91: 128 5 - 12 92 Mosher TJ, Dardzinski BJ:...
- 34
- 294
- 0
The Argument from Laws of Nature Reassessed
... respect to the types of the two particles Suppose that 54 of P1: JRT/IRK P2: JZP 05 21 8 29 496c16.xml CY335B/Dembski 5 21 829 49 March 10 , 20 04 The Argument from Laws of Nature Reassessed 3: 51 3 01 these ... P1: JRT/IRK P2: JZP 05 21 8 29 496c16.xml CY335B/Dembski 5 21 829 49 March 10 , 20 04 The Argument from Laws of Nature Reassessed 3: 51 29 5 any world is equally good for having it or not having it, then ... a theory makes for the prior probability of its truth derives from my asessment of the extent P1: JRT/IRK P2: JZP 05 21 8 29 496c16.xml CY335B/Dembski 3 02 5 21 829 49 March 10 , 20 04 3: 51 Richard Swinburne...
- 15
- 343
- 0
Tài liệu A REVIEW OF INDOOR AIR POLLUTION AND HEALTH PROBLEMS FROM THE VIEWPOINT OF ENVIRONMENTAL HYGIENE: FOCUSING ON THE STUDIES OF INDOOR AIR ENVIRONMENT IN JAPAN COMPARED TO THOSE OF FOREIGN COUNTRIES pptx
... and Hagerhed-Engman, L (20 04) The association be- 10 1) 10 2) 10 3) 10 4) 10 5) 10 6) 10 7) 10 8) 10 9) 11 0) 11 1) 11 2) tween asthma and allergic symptoms in children and phthalates in house dust: a nested ... Indoor thermal factors and symptoms in of ce workers: findings from the US EPA BASE study Indoor Air, 19 , 2 91 3 02 Davis, M L and Cornwell, D A (19 98) Introduction to Environmental Engineering, 2nd ... centers in Sweden Indoor Air, 16 , 22 7 23 5 13 5) Takekuma, M., Ohmura, A and Saito, K (20 05) Measures for reducing the levels of chemical compounds in the indoor air of schools—A study of the 5 01 No 13 6)...
- 14
- 940
- 1
Tài liệu Báo cáo khoa học: Helix mobility and recognition function of the rat thyroid transcription factor 1 homeodomain – hints from 15N-NMR relaxation studies pdf
... 16 30 13 45 10 38 19 60 805 514 (406) (13 74) (780) ( 710 ) ( 613 ) (809) (740) (5 42) (10 47) (7 52) (27 7) 19 64 15 61 1008 15 96 905 12 97 11 42 468 14 03 27 6 20 6 (37) (57) (19 ) ( 51) ( 21 ) (37) (47) (47) (10 6) (3) ... proteins by two-dimensional hetero- FEBS Journal 27 5 (20 08) 435–448 ª 20 07 The Authors Journal compilation ª 20 07 FEBS D Gumral et al ¨ 13 14 15 16 17 18 19 20 21 22 23 24 25 26 nuclear 1H 13 C ... analysis of the spectral density functions can be performed using the bar charts of Fig to obtain the individual dynamic properties of each 15 N–1H vector It can be seen that the 15 N–1H vectors of the...
- 14
- 744
- 0
Tài liệu COSMIC MAPS, PROPHECY CHARTS, AND THE HOLLYWOOD MOVIE, A BIBLICAL REALIST LOOKS AT THE ECLIPSE OF OLD TESTAMENT NARRATIVE* ppt
... begin by looking at "cosmic maps. " I am taking the idea of a "cosmic map" from the Yale theologian G Lindbeck In his book, The Nature of Doctrine, Lindbeck addresses the question of the nature of ... shed the blood of the children of Israel, drowning them in the river, Exod 1. 22 so in this first plague, God rewardeth that, by turning their waters into blood . "16 The seriousness with which the ... change in the water, which caused the fishes to die, the stream to stink, and, what seems to indicate putrefaction, the water to become undrinkable .19 The point of this discussion is that in these...
- 17
- 576
- 0
Tài liệu Báo cáo khoa học: Evidence for interactions between domains of TatA and TatB from mutagenesis of the TatABC subunits of the twin-arginine translocase docx
... P97A L99A E103Q E103A R104A R105A F 118 A G 121 A Y154S F169A P172A T208A P209A D 21 1 N D 21 1 A L 225 A Sequence 5’ to 3’ Substitution G2A F W7P F I12P F V16G F F20A F G21A F K24A F L25A F G33A F F39A F K37Q ... Ile 81 to Met Pro85 to Ala Phe94 to Ala Pro97 to Ala Leu99 to Ala Glu103 to Gln Glu103 to Ala Arg104 to Ala Arg105 to Ala Phe 118 to Ala Gly1 21 to Ala Tyr154 to Ser Phe169 to Ala Phe1 72 to Ala Thr208 ... gtagcgggctggattaacgcgttgaattcactggcg caggacagtctgcagcaggttgaacaagcgagcctcac Glu8 to Gln Glu8 to Ala Leu 11, Val 12 and Phe13 to Gly Val 12 to Pro Gly 21 to Ala Pro 22 to Gly Pro 22 to Leu Leu25 to Ala Pro26 to Ala Leu63 to Ala...
- 15
- 532
- 0
Tài liệu Báo cáo khoa học: Different modes of dipeptidyl peptidase IV (CD26) inhibition by oligopeptides derived from the N-terminus of HIV-1 Tat indicate at least two inhibitor binding sites doc
... Ki (M) 2. 67 2. 30 1. 50 4.87 1. 75 4 .27 2 . 12 1. 70 1. 24 2. 69 2. 00 4.36 5. 02 1. 59 2. 45 · · · · · · · · · · · · · · · a )4 10 10 )4 10 )4 10 )4 10 )3 10 )5 10 )6 10 )6 10 )5 10 )4 10 )4 10 )5 10 )6 10 )5 10 )5 c ... suitable for the determination of the Ki value From the Hill-plot, binding of the inhibitor to different binding sites was reflected by the change of the slope in dependence of the inhibitor concentration ... IL -2 (1 12 ) substrate [23 ] Additionally, multiple interactions of Tat (1 9) with DP IV contributed to the attractive interaction between the inhibitor and the enzyme In the case of Tat (1 9) containing...
- 10
- 505
- 0
Tài liệu Báo cáo Y học: Steady-state kinetics of the glutaminase reaction of CTP synthase from Lactococcus lactis The role of the allosteric activator GTP in coupling between glutamine hydrolysis and CTP synthesis potx
... ATP 0 .1 0 .1 1 0 .1 0 .1 1 kcat,1b (s )1) Ka (mM) kcat,2c (s )1) 2. 43 0.08 0.078e 1. 20 0.03 1. 62 0.03 0.076f 1. 054 0.007 0. 028 0.005 0 .19 5 0.007 0.0 027 0.0004 0 .13 0f 0 .22 0. 01 6.4 0 .1 a Assays ... kinetics of the glutaminase reaction of CTP synthase from L lactis in order to distinguish between the effects of GTP on the glutaminase reaction and the CTP synthesis reaction The results from ... at the time of injection j )1, vj )1 is the steady-state rate of enzyme activity prior to injection j, tj )1 is the time between injection j )1 and j, [S]syr is the concentration of the injectant in...
- 8
- 698
- 0
Tài liệu THE ECONOMIC FEASIBILITY OF ETHANOL PRODUCTION FROM SUGAR IN THE UNITED STATES docx
... 19 84 1, 124 1, 096 20 .2 19 85 1, 125 1, 1 02 20.4 19 86 1, 23 2 1, 1 91 21 . 1 19 87 1, 26 7 1, 25 2 22 .4 19 88 1, 327 1, 3 01 19 .1 1989 1, 324 1, 29 5 19 .4 19 90 1, 400 1, 377 20 .0 19 91 1, 427 1, 387 20 .3 19 92 1, 437 1, 4 12 ... 10 .77 10 .77 11 .56 11 .28 11 .34 11 . 71 11. 93 11 . 32 11 . 91 11. 84 11 .68 11 .76 12 .06 11 .85 11 .76 12 .09 11 .97 12 .27 12 .10 12 .14 11 .67 12 . 42 12 . 02 12 .33 3.99 3.96 4.37 4.00 4 .29 4 .20 4.37 4 .22 4 .28 3.95 ... 13 . 71 21 . 89 26 .57 19 91 12. 67 21 . 39 25 .53 19 92 12 . 42 21 . 49 24 .45 19 93 14 . 62 22. 05 25 .60 19 94 17 .97 22 .76 25 .26 19 95 17 . 41 22 .50 28 .84 19 96 14 .48 22 .00 28 .06 19 97 12 .36 22 .09 25 .66 19 98 9. 81 22 .07...
- 78
- 605
- 0
Tài liệu Báo cáo Y học: Trehalose-based oligosaccharides isolated from the cytoplasm of Mycobacterium smegmatis Relation to trehalose-based oligosaccharides attached to lipid docx
... Fraction CD2 CT3 a CT3 b CT4 a CT4 b CT4 c G1ca1-1aG1c G1ca1- 4G1ca1-1aG1c G1cb1- 6G1ca1-1aG1c G1cb1-6 G1cb1-6G1ca1-1aG1c G1ca1-4G1ca1-1aG1c6-1aGal Ga1a1-6 Gala1-6G1ca1-1aG1c CO2, CO3 -1 CO3 -2, CO4 -2 CO4-3 ... were linked together in a 1 1 linkage (i.e as trehalose) with a terminal galactose linked to one of the glucoses of the trehalose in either a 1 6 or 1 4 linkage, and the nonreducing glucose linked ... and the sequences obtained from the Mycobacterium tuberculosis genome [24 ] One of these pathways involves the direct rearrangement of the a1,4-glucosidic linkage of maltose to the a,a1 ,1 linkage...
- 8
- 403
- 0
Tài liệu There are two benches to the left of the shop ppt
... tiết từ đó) There are two benches to the left of the shop 2 Các bạn di chuột vào cụm từ để biết chức cụm câu: There are two benches to the left of the shop 3 Tại câu lại dịch vậy? -“There are ... trừ “o” - to the left of – (ở bên trái của) Nếu muốn nói vật bên trái bên phải vật dùng cấu trúc to the left / to the right + of + something” Lưu ý cấu trúc hay bị nhầm với “on the left/ right”- ... *There are two benches to the left of the shop Hình thức ngữ pháp : cấu trúc: “there are/is… .to the left of ” – (có bên trái gì) Chúng ta quan sát câu...
- 5
- 467
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu