3d deviation maps from geomagic® of the left humerus of gpit 1 plateosaurus engelhardti length 351 mm 1 pointcloud based file compared to ct file 2 nurbs file compared to ct file
Báo cáo y học: " Preferences for the selection of unique tRNA primers revealed from analysis of HIV-1 replication in peripheral blood mononuclear cells" pdf
... tRNALys1 ,2 Page of 10 (page number not for citation purposes) Retrovirology 20 05, 2: 21 20 21 22 23 24 25 26 27 28 http://www.retrovirology.com/content /2 /1/ 21 rather than tRNALys,3 for initiation of reverse ... grant from the NIH to CDM (AI 34749) References 10 11 12 13 14 15 16 17 18 19 Marquet R, Isel C, Ehresmann C, Ehresmann B: tRNAs as primer of reverse transcriptases Biochimie 19 95, 77 :11 3 - 12 4 Mak ... most infectious of the Log 10 p24 ( pg/ml ) Retrovirology 20 05, 2: 21 16 24 32 Days post infection 40 tRNAPro2 human peripheral blood mononuclear cells complementary to the 3' 18 nucleotides of tRNAIle,...
- 10
- 395
- 0
Tài liệu Báo cáo Y học: NMR-based determination of the binding epitope and conformational analysis of MUC-1 glycopeptides and peptides bound to the breast cancer-selective monoclonal antibody SM3 pptx
... 2. 35 2. 35 3.03 3 .17 2. 48 2. 33 2. 99 2. 83 2. 56 2. 46 2. 52 2.44 2. 99 2. 97 3 .13 2. 65 2. 60 2. 60 3.35 3. 51 2. 74 2. 58 3.30 3 . 12 2. 83 2. 72 2.78 2. 69 3. 31 3 .28 3.46 2. 93 10 0 000 generations were subjected ... 4 .25 2 4.574 4. 327 2. 389 2. 707 4 .15 5 1. 798 2. 255 1. 978 2. 543 1. 978 1. 978 3.336 3.336 1. 134 1. 629 1. 978 1. 629 1. 879 3 .16 0 3.7 82 3 .16 0 3.5 82 1. 724 1. 978 7.7 61 7.043 Table 1H-NMR chemical shifts of ... 4 .29 5 2. 397 2. 747 4 .29 7 1. 813 2. 270 1. 983 2. 558 1. 983 1. 983 3.368 3. 317 1. 21 7 1. 645 1. 990 1. 645 1. 879 3 .16 0 3.705 3 .16 0 3.5 91 1.678 1. 990 7.788 7. 017 NH GalNAc CH3 6a 6b 7.803 1. 975 4.775 4. 016 ...
- 12
- 717
- 0
Báo cáo khoa học: "Effects of osteoprotegerin from transfection of pcDNA3.1(+)/chOPG on bioactivity of chicken osteoclasts" potx
... of receptor activator of nuclear factor κB ligand and MAPK Biochimica Biophysica Acta 20 04, 16 44 :1- 7 doi :10 .11 86 /17 51- 014 7-53- 21 Cite this article as: Hou et al.: Effects of osteoprotegerin from ... osteoclast apoptosis though inhibition of F-actin ring Hou et al Acta Veterinaria Scandinavica 2 011 , 53: 21 http://www.actavetscand.com/content/53 /1/ 21 Page of Figure The change of TRAP enzyme activity ... al Acta Veterinaria Scandinavica 2 011 , 53: 21 http://www.actavetscand.com/content/53 /1/ 21 to medullary bone [2] In the absence of structural bone formation, continued osteoclastic resorption of...
- 7
- 166
- 0
Báo cáo y học: "The evolution of HIV-1 reverse transcriptase in route to acquisition of Q151M multi-drug resistance is complex and involves mutations in multiple domains" ppt
... NNRTI E138 Y1 81 V100 F87 V SF 20 I A100 I100 I A100 I100 M230 L I100 A100 I100 A100 I100 Y70 H2 21 N348 N100 10 0 T69 Y100 10 0 I100 I3 L94 I 31 L100 A33 V97 T48 S100 S68 K1 02 G100 R 61 N100 S 123 Other ... (TVLMR) -5 Q174 3,8 51 39 (KR) 44 61 (KR) +22 Q174 12 ,2 41 (KEHR) 4 92 (RKH) +2 Q197 3,999 (K) 44 (E) -1 Q197 12 , 316 (KE) 4 92 (EK) +2 I2 02 3,955 (V) 44 27 (V) +20 I2 02 12 ,15 1 (V) 4 92 24 (V) +15 E203 4,008 ... 22 4 .1 ± 16 .9 26 .3 60.0 ± 13 .8 56.4 ± 7 .2 0.4 0.3 17 -Pol 20 6.5 ± 9.7 24 .2 58 .1 ± 14 .2 0.3 21 8 .9 ± 13 .3 10 0.9 37-RT 21 9 .7 ± 7.5 25 .8 5 12 0.9 ± 515 .6 30.4 23 0.9 ± 10 .2 10 6.4 37-Pol 21 7 .8 ± 18 .1 25 .6...
- 11
- 350
- 0
Báo cáo y học: " Dendritic cell-mediated HIV-1 transmission to T cells of LAD-1 patients is impaired due to the defect in LFA-1" docx
... ML: The immunological synapse Annu Rev Immunol 20 01, 19 :375-396 Page of (page number not for citation purposes) Retrovirology 20 06, 3:75 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 ... Page of (page number not for citation purposes) Retrovirology 20 06, 3:75 control http://www.retrovirology.com/content/3 /1/ 75 3 61 CD11a LAD -1 137 CD18 CD11a LAD -1 variant 10 4 CD11a CD18 19 9 positive ... analysis of integrin function in man: LAD -1 and other syndromes Matrix Biol 20 00, 19 : 21 1 -22 2 Anderson DC, Springer TA: Leukocyte adhesion deficiency: an inherited defect in the Mac -1, LFA -1, and p150,95...
- 9
- 355
- 0
Báo cáo sinh học: " Role of HIV-1 subtype C envelope V3 to V5 regions in viral entry, coreceptor utilization and replication efficiency in primary T-lymphocytes and monocyte-derived macrophages" docx
... CHIMERA_ 17 1 17 3 18 2 18 3 22 1A 28 2 28 4 3 31 334 4 52 5 12 514 639 10 11 1 014 20 99 (B-R5) 21 0 1 (B-X4/R5) 30 41 (C-R5) 54 41 (C-X4) MAGI-CXCR4 10 000 5000 No of blue cells 21 23 9 13 23 1 11 16 - 10 000 Phenotype ... -9.06 - 12 .26 -9.36 0 0 0. 01 0 .22 0. 01 0 .22 0.50 0.86 0 .17 0.83 SE SD SD SE 6 4 0.33 0.48 0.48 0. 31 Sinsi -11 .16 0. 01 0.04 SE 0. 31 AP .18 /18 2, 18 3 AP .2/ 221 A AP .28 /28 2, 28 4 AP.33/3 31, 334 AP.4/4 52, ... E.P.N.I E.L.N.V E.L.N.V -347 NL43 BAL HIV-1C 17 1 17 3 18 2 18 3 2 21 28 2 28 4 3 31 334 4 52 454 5 12 514 639 10 11 1 014 -27 5 -24 2 http://www.virologyj.com/content/4 /1/ 126 SEIFRPGGGD T.V T N I I T T T...
- 12
- 408
- 0
Báo cáo hóa học: " Role of HIV-1 subtype C envelope V3 to V5 regions in viral entry, coreceptor utilization and replication " docx
... CHIMERA_ 17 1 17 3 18 2 18 3 22 1A 28 2 28 4 3 31 334 4 52 5 12 514 639 10 11 1 014 20 99 (B-R5) 21 0 1 (B-X4/R5) 30 41 (C-R5) 54 41 (C-X4) MAGI-CXCR4 10 000 5000 No of blue cells 21 23 9 13 23 1 11 16 - 10 000 Phenotype ... -9.06 - 12 .26 -9.36 0 0 0. 01 0 .22 0. 01 0 .22 0.50 0.86 0 .17 0.83 SE SD SD SE 6 4 0.33 0.48 0.48 0. 31 Sinsi -11 .16 0. 01 0.04 SE 0. 31 AP .18 /18 2, 18 3 AP .2/ 221 A AP .28 /28 2, 28 4 AP.33/3 31, 334 AP.4/4 52, ... E.P.N.I E.L.N.V E.L.N.V -347 NL43 BAL HIV-1C 17 1 17 3 18 2 18 3 2 21 28 2 28 4 3 31 334 4 52 454 5 12 514 639 10 11 1 014 -27 5 -24 2 http://www.virologyj.com/content/4 /1/ 126 SEIFRPGGGD T.V T N I I T T T...
- 12
- 684
- 0
Báo cáo hóa học: " Pharmacokinetic evaluation of a 1,3-dicyclohexylurea nanosuspension formulation to support early efficacy assessment" docx
... rate, 1. 62 h 1) , k 12 (rate of distribution from compartment to compartment 2, 0 .22 4 h 1) , and k 21 (rate of drug distribution from compartment to compartment 1, 0 .16 6 h 1) obtained from modeling the ... selected for simulation of the IV infusion data Estimated parameters of 12 3 29 4 Nanoscale Res Lett (20 07) 2: 2 91 29 6 10 Concentration (µ g/ml) V1 (central volume of distribution, 12 85.3 mL), k10 ... 79, 773 (19 90) 12 3 Nanoscale Res Lett (20 07) 2: 2 91 29 6 K Korttila, A Sothman, P Andersson, Acta Pharmacol Toxicol (Copenh) 39, 10 4 (19 76) R.S Langer, N.A Peppas, Biomaterials 2, 2 01 (19 81) N.A...
- 6
- 336
- 0
báo cáo khoa học: "Anomalous origin of the left coronary artery from the pulmonary artery associated with an accessory atrioventricular pathway and managed successfully with surgical and interventional electrophysiological treatment: a case report" docx
... pathways: getting to the origins Circulation 20 08, 11 7 :15 02 -15 04 doi :10 .11 86 /17 52 -19 47-5-384 Cite this article as: Tsoutsinos et al.: Anomalous origin of the left coronary artery from the pulmonary ... interventional electrophysiology Page of Competing interests The authors declare that they have no competing interests Received: 25 March 2 010 Accepted: 16 August 2 011 Published: 16 August 2 011 References ... interruption of canal myocardium due to the late arrival of EPDCs Therefore, we theorize that a probable connection of the theories regarding the genesis of the ALCAPA malformation and the creation of...
- 4
- 247
- 0
Báo cáo y học: "Texture analysis of cartilage T2 maps: individuals with risk factors for OA have higher and more heterogeneous knee cartilage MR T2 compared to normal controls - data from the osteoarthritis initiative" pptx
... U 01 AR059507 and NIH F 32 AR059478 The OAI is a public-private partnership comprised of five contracts (N 01- AR -2- 225 8; N 01- AR -2- 225 9; N 01- AR -2- 226 0; N 01- AR -2- 22 61; N 01- AR -2- 226 2) funded by the ... - 32. 97 -22 . 81 -0. 72 -1. 18 -0. 72 $ Coefficient -30. 31 -39. 82 -27 .09 -0 .15 -0 . 12 -0 .10 -45.49 -57. 72 -37.48 -1. 39 -1. 94 -1. 31 -5.47 -9. 91 -6 .27 0. 02 0.003 0.03 -5.48 -8. 21 -8 .13 -0.04 -0. 42 -0 . 12 95% ... 32. 01 23 3 .10 ± 38.60 17 1.74 ± 24 .57 6.09 ± 0.34 6.90 ± 0 .17 6.30 ± 0 .19 22 6.96 ± 47.83 333.37 ± 66.58 22 7. 41 ± 35.00 29 . 51 ± 1. 77 36.85 ± 2 .16 32. 07 ± 1. 38 (n = 53) Group Control p value 0.001...
- 34
- 294
- 0
The Argument from Laws of Nature Reassessed
... particles, there are 55 possibilities with respect to the types of the two particles Suppose that 54 of P1: JRT/IRK P2: JZP 05 21 8 29 496c16.xml CY335B/Dembski 5 21 829 49 March 10 , 20 04 The Argument from ... Hence the operation of laws of nature is evidence – one strand of a cumulative argument – for the existence of God P1: JRT/IRK P2: JZP 05 21 8 29 496c16.xml CY335B/Dembski 5 21 829 49 March 10 , 20 04 The ... liability to produce objects with chaotic and erratic powers Yet since there are so many P1: JRT/IRK P2: JZP 05 21 8 29 496c16.xml CY335B/Dembski 5 21 829 49 March 10 , 20 04 The Argument from Laws of Nature...
- 15
- 343
- 0
Tài liệu A REVIEW OF INDOOR AIR POLLUTION AND HEALTH PROBLEMS FROM THE VIEWPOINT OF ENVIRONMENTAL HYGIENE: FOCUSING ON THE STUDIES OF INDOOR AIR ENVIRONMENT IN JAPAN COMPARED TO THOSE OF FOREIGN COUNTRIES pptx
... Hasselgren, M and Hagerhed-Engman, L (20 04) The association be- 10 1) 10 2) 10 3) 10 4) 10 5) 10 6) 10 7) 10 8) 10 9) 11 0) 11 1) 11 2) tween asthma and allergic symptoms in children and phthalates in house ... February, 2 010 ) 15 ) Seki, A., Takigawa, T., Kishi, R., Sakabe, K., 496 16 ) 17 ) 18 ) 19 ) 20 ) 21 ) 22 ) 23 ) 24 ) 25 ) 26 ) Torii, S., Tanaka, M., Tanaka, M., Yoshimura, T., Morimoto, K., Katoh, T., Kira, ... Air, 16 , 22 7 23 5 13 5) Takekuma, M., Ohmura, A and Saito, K (20 05) Measures for reducing the levels of chemical compounds in the indoor air of schools—A study of the 5 01 No 13 6) 13 7) 13 8) 13 9) 14 0)...
- 14
- 940
- 1
Tài liệu Báo cáo khoa học: Helix mobility and recognition function of the rat thyroid transcription factor 1 homeodomain – hints from 15N-NMR relaxation studies pdf
... (0.04) (0 .19 ) (0.09) 19 83 24 93 14 86 18 85 10 30 16 30 13 45 10 38 19 60 805 514 (406) (13 74) (780) ( 710 ) ( 613 ) (809) (740) (5 42) (10 47) (7 52) (27 7) 19 64 15 61 1008 15 96 905 12 97 11 42 468 14 03 27 6 20 6 (37) ... ¨ 13 14 15 16 17 18 19 20 21 22 23 24 25 26 nuclear 1H 13 C correlation spectroscopy J Am Chem Soc 11 0, 7557–7558 Kay LE, Torchia DA & Bax A (19 89) Backbone dynamics of proteins as studied by 15 N ... 2. 83 2. 62 a J(xN) (0.30) (0.37) (0.34) (0 .26 ) (0 .25 ) (0 . 12 )a (0 .11 ) (0. 52) (0.30) 0.354 0.355 0.343 0.354 0. 329 0.340 0.3 42 0 .2 71 0 .26 2 J(0.87xH) (0.008) (0. 029 ) (0. 020 ) (0. 017 ) (0. 014 ) (0. 024 )...
- 14
- 744
- 0
Tài liệu COSMIC MAPS, PROPHECY CHARTS, AND THE HOLLYWOOD MOVIE, A BIBLICAL REALIST LOOKS AT THE ECLIPSE OF OLD TESTAMENT NARRATIVE* ppt
... in fact, the blessed hope of the Christian The return of Christ is the end of the story Or, as C S Lewis would say, the end of the beginning of the story which God will write for eternity The ... in history and the description of them in the Bible was broken God was no longer the author of either Scripture or history .15 The loss of such a link meant that the task of describing the relationship ... away from the text and onto the events of history which Frei speaks of as an "eclipse" of the biblical narrative According to Frei, one can see most clearly13 the theologians' shift in attitude toward...
- 17
- 576
- 0
Tài liệu Báo cáo khoa học: Evidence for interactions between domains of TatA and TatB from mutagenesis of the TatABC subunits of the twin-arginine translocase docx
... F94A P97A L99A E103Q E103A R104A R105A F 118 A G 121 A Y154S F169A P172A T208A P209A D 21 1 N D 21 1 A L 225 A Sequence 5’ to 3’ Substitution G2A F W7P F I12P F V16G F F20A F G21A F K24A F L25A F G33A F F39A ... Ile 81 to Met Pro85 to Ala Phe94 to Ala Pro97 to Ala Leu99 to Ala Glu103 to Gln Glu103 to Ala Arg104 to Ala Arg105 to Ala Phe 118 to Ala Gly1 21 to Ala Tyr154 to Ser Phe169 to Ala Phe1 72 to Ala Thr208 ... gtagcgggctggattaacgcgttgaattcactggcg caggacagtctgcagcaggttgaacaagcgagcctcac Glu8 to Gln Glu8 to Ala Leu 11, Val 12 and Phe13 to Gly Val 12 to Pro Gly 21 to Ala Pro 22 to Gly Pro 22 to Leu Leu25 to Ala Pro26 to Ala Leu63 to Ala...
- 15
- 532
- 0
Tài liệu Báo cáo khoa học: Different modes of dipeptidyl peptidase IV (CD26) inhibition by oligopeptides derived from the N-terminus of HIV-1 Tat indicate at least two inhibitor binding sites doc
... Ki (M) 2. 67 2. 30 1. 50 4.87 1. 75 4 .27 2 . 12 1. 70 1. 24 2. 69 2. 00 4.36 5. 02 1. 59 2. 45 · · · · · · · · · · · · · · · a )4 10 10 )4 10 )4 10 )4 10 )3 10 )5 10 )6 10 )6 10 )5 10 )4 10 )4 10 )5 10 )6 10 )5 10 )5 c ... peptide IL -2 (1 12 ), Tat (1 9) was found to be a competitive inhibitor with a Ki of (1. 11 ± 0 . 12 ) · 10 )4 M [23 ] One possible explanation for these, on the first view Ó FEBS 20 03 contradictory results, ... Morimoto, C (19 91) 1F7 (CD26): a marker of thymic maturation involved in the differential regulation of the CD3 and CD2 pathways of human thymocyte activation J Immunol 14 7, 28 25 28 32 11 Kahne,...
- 10
- 505
- 0
Tài liệu Báo cáo Y học: Steady-state kinetics of the glutaminase reaction of CTP synthase from Lactococcus lactis The role of the allosteric activator GTP in coupling between glutamine hydrolysis and CTP synthesis potx
... subsequently the rate of ể FEBS 20 02 Glutaminase activity of CTP synthase (Eur J Biochem 26 9) 4775 0 .15 1. 25 A , s -1 Relative Activity 0 .1 0.05 0.75 0.5 0 .25 0 Glutamine, mM 0 , s Inhibitor, mM B -1 Fig ... concentration at the time of injection j )1, vj )1 is the steady-state rate of enzyme activity prior to injection j, tj )1 is the time between injection j )1 and j, [S]syr is the concentration of the injectant ... Ka (mM) kcat,2c (s )1) 2. 43 0.08 0.078e 1. 20 0.03 1. 62 0.03 0.076f 1. 054 0.007 0. 028 0.005 0 .19 5 0.007 0.0 027 0.0004 0 .13 0f 0 .22 0. 01 6.4 0 .1 a Assays were performed as described in the...
- 8
- 698
- 0
Tài liệu THE ECONOMIC FEASIBILITY OF ETHANOL PRODUCTION FROM SUGAR IN THE UNITED STATES docx
... 19 84 1, 124 1, 096 20 .2 19 85 1, 125 1, 1 02 20.4 19 86 1, 23 2 1, 1 91 21 . 1 19 87 1, 26 7 1, 25 2 22 .4 19 88 1, 327 1, 3 01 19 .1 1989 1, 324 1, 29 5 19 .4 19 90 1, 400 1, 377 20 .0 19 91 1, 427 1, 387 20 .3 19 92 1, 437 1, 4 12 ... 21 . 39 25 .53 19 92 12 . 42 21 . 49 24 .45 19 93 14 . 62 22. 05 25 .60 19 94 17 .97 22 .76 25 .26 19 95 17 . 41 22 .50 28 .84 19 96 14 .48 22 .00 28 .06 19 97 12 .36 22 .09 25 .66 19 98 9. 81 22 .07 27 . 02 19 99 9 .10 18 .40 21 . 90 20 00 ... 28 ,873 29 ,635 29 ,404 29 ,13 7 27 ,687 30,003 32, 743 33,577 34 ,2 91 32, 775 33,903 31, 9 42 27 ,24 3 24 , 726 10 .66 10 .83 10 .77 10 .77 11 .56 11 .28 11 .34 11 . 71 11. 93 11 . 32 11 . 91 11. 84 11 .68 11 .76 12 .06 11 .85 11 .76...
- 78
- 605
- 0
Tài liệu Báo cáo Y học: Trehalose-based oligosaccharides isolated from the cytoplasm of Mycobacterium smegmatis Relation to trehalose-based oligosaccharides attached to lipid docx
... from M smegmatis Oligosaccharide Structure Fraction CD2 CT3 a CT3 b CT4 a CT4 b CT4 c G1ca1-1aG1c G1ca1- 4G1ca1-1aG1c G1cb1- 6G1ca1-1aG1c G1cb1-6 G1cb1-6G1ca1-1aG1c G1ca1-4G1ca1-1aG1c6-1aGal Ga1a1-6 ... – Glucitol 2, 3,4,6-Tetra-O-methyl2,3,6-Tri-O-methyl2,3,4-Tri-O-methyl- 1. 0a – – 2. 0b – – 2. 0b – 2. 0b 0.8 – 1. 0a 0.7 – 2. 0b 0.9 – 2. 0b – 0.8 2. 0b – 1. 8 1. 0a 1. 2 0.9 0.7 – 1. 1 Galactitol 2, 3,4,6-Tetra-O-methyl2,3,4-Tri-O-methyl- ... 2, 3,4-trimethylglucitol acetate, indicating that the structure of this tetrasaccharide was either Glc1–6Glc1–1Glc6–1Glc or Glc1–6Glc1–6Glc1– 1Glc The 1H-NMR spectrum showed four anomeric proton signals at 5 .21 ...
- 8
- 403
- 0
Tài liệu There are two benches to the left of the shop ppt
... tiết từ đó) There are two benches to the left of the shop 2 Các bạn di chuột vào cụm từ để biết chức cụm câu: There are two benches to the left of the shop 3 Tại câu lại dịch vậy? -“There are ... trừ “o” - to the left of – (ở bên trái của) Nếu muốn nói vật bên trái bên phải vật dùng cấu trúc to the left / to the right + of + something” Lưu ý cấu trúc hay bị nhầm với “on the left/ right”- ... *There are two benches to the left of the shop Hình thức ngữ pháp : cấu trúc: “there are/is… .to the left of ” – (có bên trái gì) Chúng ta quan sát câu...
- 5
- 467
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25