3 which of the following was a major result of the war of 1812
Tài liệu University Oars Being a Critical Enquiry Into the After Health of the Men Who Rowed in the Oxford and Cambridge Boat-Race, from the Year 1829 to 1869, Based on the Personal Experience of the Rowers Themselves pdf
Ngày tải lên :
14/02/2014, 21:20
... UNIVERSITY OARS.
fected, and an attack of inflammation of the right lung
ensued. This illness was a very protracted one, and he
was assured by one of the physicians who attended him
that there was a permanent ... profitable venture.
Apparently the best lived crew in the series was the
Cambridge crew of 1840; at the end of the year 1869
the eight men of which it was composed were all alive,
and had together ... (two of them from accidental causes, one
only three years after the race, and the other only five).
I have calculated that on an average the Oars who
pulled in this match, instead of surviving the...
- 419
- 541
- 0
Tài liệu The Role of BCG Vaccine in the Prevention and Control of Tuberculosis in the United States: A Joint Statement by the Advisory Council for the Elimination of Tuberculosis and the Advisory Committee on Immunization Practices docx
Ngày tải lên :
15/02/2014, 13:20
... strain that was maintained at the University of Montreal (Montreal, Canada).
Vaccine Efficacy
Reported rates of the protective efficacy of BCG vaccines might have been affected
by the methods and ... to evaluate the effectiveness of mass neonatal
BCG vaccination among Canadian Indians. Am J Public Health 1986;76:7 83 6.
38 . Shapiro C, Cook N, Evans D, et al. A case-control study of BCG and ... Public
Health Veterinarians
Keith A. Clark, D.V.M., Ph.D.
Texas Department of Health
Austin, TX
National Vaccine Program
Anthony Robbins, M.D.
Office of the Assistant Secretary for
Health
Washington,...
- 27
- 1.3K
- 3
Tài liệu Báo cáo khoa học: Hypoxia reduces the expression of heme oxygenase-2 in various types of human cell lines A possible strategy for the maintenance of intracellular heme level pdf
Ngày tải lên :
19/02/2014, 06:20
... FEBS
naya OA, Kolpakov FA et al. (1998) Databases on
transcriptional regulation: TRANSFAC, TRRD and
COMPEL. Nucleic Acids Res 26, 36 2 36 7.
47 Takahashi S, Takahashi Y, Ito K, Nagano T,
Shibahara ... 1162–1168.
13 Nakayama M, Takahashi K, Kitamuro T, Yasumoto
K, Katayose D, Shirato K, Fujii-Kuriyama Y & Shiba-
hara S (2000) Repression of heme oxygenase-1 by
hypoxia in vascular endothelial cells. ... the maintenance of intracellular heme level
Yongzhao Zhang
1
, Kazumichi Furuyama
1
, Kiriko Kaneko
1
, Yuanying Ding
1
, Kazuhiro Ogawa
2,
*,
Miki Yoshizawa
1
, Masaki Kawamura
1
, Kazuhisa Takeda
1
,...
- 12
- 621
- 0
Tài liệu Báo cáo khoa học: Molecular cloning, recombinant expression and IgE-binding epitope of x-5 gliadin, a major allergen in wheat-dependent exercise-induced anaphylaxis ppt
Ngày tải lên :
20/02/2014, 01:20
... x-5 gliadin gene, oligonucleo-
tides, 5 Â-AAGTGAGCAATAGTAAACACAAATCAAAC -3
and 5Â-CGTTACATTATGCTCCATTGACTAACAACGA
TG -3 , were constructed based on fragment DNA sequences
of the x-5 gliadin gene ... sequencer
(Applied Biosystems, Foster City, CA, USA).
Expression and purication of recombinant
protein
Sense (5Â-ATTTCATATGCAACAACAATTCCCCCAGC
AACAATCA -3 ) and antisense (5Â-TCTCGGATCCTCA
TAGGCCACTGATACTTATAACGTCGCTCCC -3 ) ... (Takara Bio Inc.,
Shiga, Japan). PCR was performed using KOD DNA polym-
erase (Toyobo, Osaka, Japan) and DNA AMPLIFIER
MIR-D40 (Sanyo, Osaka, Japan). To amplify the DNA frag-
ments containing a...
- 8
- 484
- 0
Tài liệu Company ''''A'''', corps of engineers, U.S.A., 1846-''''48, in the Mexican war doc
Ngày tải lên :
21/02/2014, 08:20
... Page
21 chapparal changed to chaparral | | Page 22 chapparal changed to chaparral | | Page 27 chapparal changed to
chaparral | | Page 28 Twigg's changed to Twiggs's | | Page 29 chapparal ... litter. The sergeant of the party
was instructed to report to the naval officer in charge of the surf boats, and in my name, request that Captain
Swift be taken as soon as practicable, to the steamer ... signed on the part
of the Mexicans; and accompanied General Persifor F. Smith to Vera Cruz, at which place he was charged
with making all preparations for the transportation of the army to the United...
- 48
- 504
- 0
The Help! Kit - A Resource Guide for Secondary Teachers of Migrant English Language Learners
Ngày tải lên :
17/03/2014, 17:46
... one
of the languages. Often, too, bilingual students switch
back and forth from one language to another as they
speak and think. These variations arise from such cir-
cumstances as their age of arrival ... (about $8,000 a year on aver-
age), and often live in substandard housing. They
tend to come from rural areas of their native coun-
tries or the U.S. and often have a marginal level of
education ... norms of behavior.
Some migrant students from rural areas of Mexico
or Central America face a more challenging adapta-
tion process because they may not speak Spanish
(see “home language”), and they...
- 251
- 484
- 0
THE CHEMICAL HISTORY OF A CANDLE A COURSE OF LECTURES DELIVERED BEFORE A JUVENILE AUDIENCE AT THE ROYAL INSTITUTION ppt
Ngày tải lên :
22/03/2014, 14:20
... that I can
actually pour the vapour out of the flask into that basin, and set it on
fire there. This, then, is exactly the same kind of vapour as we have in
the middle of the candle; and that ... manner
the particles of melted tallow ascend the cotton and get to the top; other
particles then follow by their mutual attraction for each other, and as
they reach the flame they are gradually ... liquid
state, in the same way as the vapour, one of the products of the candle,
was condensed against the bottom of the dish, and obtained in the form of
water; and to shew you how truly and thoroughly...
- 164
- 271
- 0
High Incidence of Pulmonary Tuberculosis Persists a Decade after Immigration, the Netherlands potx
Ngày tải lên :
22/03/2014, 18:20
... of
birth, date of arrival in the Netherlands, time of diagnosis,
localization of tuberculosis, country of origin, and sex. To
account for the fact that the reported time of immigration
was often exactly ... adults and a signif-
icantly higher rate for males than females. Except for age,
the univariate incidence rate ratios were largely similar to
the multivariate ratios. In univariate analysis, ... imputed datasets.
Incidence rates were only calculated for the 2,005
patients in whom tuberculosis was diagnosed more than
half a year after immigration because many patients with a
case diagnosed...
- 4
- 233
- 0
Báo cáo khoa học: Expression and characterization of cyanobacterium heme oxygenase, a key enzyme in the phycobilin synthesis Properties of the heme complex of recombinant active enzyme potx
Ngày tải lên :
23/03/2014, 20:22
... S.,
Watanabe, A. , Iriguchi, M., Ishikawa, A. , Kawashima, K.,
Kimura,T.,Kishida,Y.,Kohora,M.,Matsumoto,M.,Matsuno,
A. , Muraki, A. , Nakazaki, N., Shimpo, S., Sugimoto, M., Taka-
zawa, M., Yamada, M., Yasuda, ... The pK
a
value of this acid–base transition is
estimated based on the increase of absorbance at 418 nm as
pH increases. Curve fitting of the fraction of thealkaline form
to the calculated values ... nm bands and the shift of the
band at 630 nm to the longer-wavelength direction. At the
same time, a broad band with the maximum at approxi-
mately 690 nm appears and increases with time. The...
- 12
- 459
- 0
Báo cáo khoa học: Mapping the binding domains of the aIIb subunit A study performed on the activated form of the platelet integrin aIIbb3 pot
Ngày tải lên :
31/03/2014, 07:20
... loops (2 73 274) and (2 83 285)
and (c) a
IIb
31 3 33 2 incorporates strands 2 (31 3 31 8) and 3
(31 9 33 2) of W
5
, enclosing the loop (31 3 32 3). Kamata
et al. [45] showed that mutations which disrupt ... integrin alpha IIbbeta3 are clustered in
the beta-propeller model. J. Biol. Chem. 276, 44275–442 83.
46. Ambo, H., Kamata, T., Handa, M., Kawai, Y., Oda, A. , Murata,
M., Takada, Y. & Ikeda, Y. ... of the a
IIb
31 3 33 2
peptide were added to the coated wells and the plates were
incubated for 2 h at room temperature. Plates were then
washed and incubated overnight with an IgM mouse mAb
[anti- (a
IIb
31 3 33 2)]...
- 8
- 499
- 0
báo cáo hóa học: " Population norms and cut-off-points for suboptimal health related quality of life in two generic measures for adolescents: the Spanish VSP-A and KINDL-R" pdf
Ngày tải lên :
18/06/2014, 18:20
... in the case of the
SDQ and by adolescents in the case of socio-demograph-
ical variables, Oslo Scale, and presence of a chronic condi-
tion.
Statistical analysis
Descriptive statistics of the ... clinical
outcomes. As a consequence of the increase in the survival
of chronic conditions and life expectancy, healthcare has
gone beyond the cure of illness. These facts and also a
greater implication of patients ... of health status meas-
ures. Mayo Clin Proc. 2002, 77(4) :37 1 -38 3.
8. Achenbach TM, Rescorla LA: Manual for the ASEBA school-Age
forms & profiles. An integrated system of multi-informant
assessment....
- 9
- 557
- 0
báo cáo hóa học: " The laval questionnaire: a new instrument to measure quality of life in morbid obesity" docx
Ngày tải lên :
20/06/2014, 15:20
... Questionnaire
The Laval Questionnaire is a 44-item questionnaire that is
meant to be used as an evaluative instrument - that is, as a
clinical outcome in clinical trials. The Laval Questionnaire
was developed ... study may also be considered as an independent
validation study of the IWQOL-Lite that was developed
and initially validated in a population of patients with
obesity that cannot be qualified as “morbid” ... significance was set at the
0.01 level.
Evaluative properties
In this analysis, we examined the extent to which the Laval
Questionnaire can capture changes in quality of life over
time (that is the...
- 8
- 460
- 0
Báo cáo hóa học: " The role of perfusion CT in identifying stroke mimics in the emergency room: a case of status epilepticus presenting with perfusion CT alterations" pdf
Ngày tải lên :
21/06/2014, 19:20
... was obtained from the patient
for publicatio n of this case report and any accompany-
ing images. A copy of the writ ten consent is availabl e
for review by the Editor-in-Chief of this journal.
Abbreviations
NCCT: ... in
acute stro ke management [11]. Relativ e MTT and abso-
lute CBV are CT perfusion p arameters that help define
areas of infarct from areas of penumbra [6]. Its use has
also been investigated ... utilized because of its decreased availability in
contrast to the short acquisition time and wide availability
for NCCT in the emergency room setting.
There are data su pporting the use of CT perfusion...
- 4
- 447
- 0
ecstasy the complete guide a comprehensive look at the risks and benefits of mdma
Ngày tải lên :
03/07/2014, 16:07
... clinical research into the nature of the MDMA experi-
ence has been meager. Amid the furor
about the dangers of MDMA abuse
have been the claims of psychotherapists and medicinal chemists that MDMA
ingestion ... incarnation as a drug once known as Adam, and we can stress
the importance of future clinical research into the therapeutic uses ofMDMA.
This book delineates the possible therapeutic advantages ... Trial" ran the headlines. Many questions be-
gan to be posed. Was MDMA an amazing therapeutic tool, as proposed by the
West Coast shrinks? Was it a killer drug that causes brain damage, as...
- 462
- 762
- 1
Function of Soils for Hum a n Societies and the Environment .The G e o l o g i c a l Society of L ppt
Ngày tải lên :
06/07/2014, 08:20
...
(Bath, UK) produces the Society's international journals and
books, and acts as European distributor for selected publications of the American Association of Petroleum
Geologists (AAPG), ... (AAPG), the Indonesian Petroleum Association (IPA), the Geological Society of America (GSA),
the Society for Sedimentary Geology (SEPM) and the Geologists' Association (GA). Joint marketing agree- ... A. Australian examples of the role of soils in environmental problems
MONTANARELLA,
L. Policies for a sustainable use of soil resources
INACIO, M., PEREIRA, V. & PINTO, M. Assessing anthropogenic...
- 5
- 287
- 0
