3 avian embryonic stem cells

Báo cáo khoa học: Recruitment of transcription complexes to the b-globin locus control region and transcription of hypersensitive site 3 prior to erythroid differentiation of murine embryonic stem cells docx

... locus activation during differentiation 35 36 37 38 39 40 41 42 43 44 tissue-specific chromatin domain initiated by epigenetic marking at the embryonic stem cell stage Mol Cell Biol 25, 1804–1820 ... enhancer (HS4), a region 5¢- to HS3 (5¢HS3), the core of HS3 (HS3), a region flanking HS2 and HS3 (3 ⁄ flank), the core of HS2 (HS2), a region downstream of HS2 (3 HS2), and the bmaj-globin gene ... b-actin [ 43] , Rex-1 [44], mouseHS4RT2 US: 5¢-GAGATCCTGCCAAGAC TCTG -3 and DS, 5¢-GGGCTGTACAGACATCTAGG -3 ; mouse5¢HS3: US, 5¢-GCCCCTCCTCTCATGAGCC -3 an DS, GATGGGGCAAGGGCCAAGGC -3 ; mouseHS3RT US:...

10
422
0

OCT 3 4 and SOX 2 are key factors for SDIA neurogenesis of mouse embryonic stem cells

Danh mục: Tổng hợp

... 1162 - 130 5 35 04 - 36 02 139 - 226 207 - 31 3 450 - 559 11 13 - 130 8 1 637 - 1 832 1559 - 1665 39 9 - 592 3. 60 3. 62 3. 99 4 .34 4.78 3. 68 3. 26 3. 4 3. 4 32 .8 29.25 30 .7 30 .8 35 .8 27.2 29.1 28 .3 30.8 Bold ... Oct -3/ 4 Oct -3/ 4 Oct -3/ 4 Sox-2 Sox-2 297 – 37 8 5 73 – 677 1056 - 11 53 71 - 230 1182 - 134 5 4.55 2.98 3. 68 3. 49 4 .36 19.4 33 .9 28.2 36 .7 34 .3 Fgf-4 Utf-1 Utf-1 Fbx-15 Fbx-15 Opn Opn 552 - 633 38 2 ... 38 2 - 644 865 - 10 63 214 - 30 5 866 - 951 600 - 682 880 - 969 3. 3 Poor Amplification 4.07 3. 20 3. 40 3. 70 3. 76 N/A 22.9 28.1 33 .8 25 .3 33. 5 29.2 Nestin Nestin Ptx -3 Ptx -3 Ptx -3 Brachyury Brachyury...

88
344
0

Báo cáo y học: "Low temperature tolerance of human embryonic stem cells"

Danh mục: Y học thưởng thức

... the pluripotency markers SSEA -3 and TRA-1- Int J Med Sci 2006, 81 [4] Briefly, the cells were fixed in 3. 7% formaldehyde solution for 30 at 37 ◦C, washed with PBS (3 ), and exposed to blocking ... Biotechnol 2000;18(4) :39 9-404 Richards M, Fong CY, Tan S, Chan WK, Bongso A An efficient and safe xeno-free cryopreservation method for the storage of human embryonic stem cells Stem Cells 2004;22(5):779-89 ... Marshall VS, Jones JM Embryonic stem cell lines derived from human blastocysts Science 1998;282( 539 1):1145-7 Reubinoff BE, Pera MF, Fong CY, Trounson A, Bongso A Embryonic stem cell lines from...

6
477
0

Báo cáo khoa học: Epigenetics: the study of embryonic stem cells by restriction landmark genomic scanning pptx

Danh mục: Báo cáo khoa học

... 1624–1 630 ª 2008 The Authors Journal compilation ª 2008 FEBS 1625 Epigenetic study of embryonic stem cells TE N Hattori and K Shiota ICM PGC TS cells Placental cells 77 ES cells 49 EG cells Embryonic ... euchromatic histone H3 lysine FEBS Journal 275 (2008) 1624–1 630 ª 2008 The Authors Journal compilation ª 2008 FEBS 1629 Epigenetic study of embryonic stem cells 36 37 38 39 40 N Hattori and K ... 14, 1 733 – 1740 Chen T, Ueda Y, Dodge JE, Wang Z & Li E (20 03) Establishment and maintenance of genomic methylation patterns in mouse embryonic stem cells by Dnmt3a and Dnmt3b Mol Cell Biol 23, 5594–5605...

7
439
0

embryonic stem cells, methods and protocols - kursad turksen

Danh mục: Sinh học

... cyclin-dependent kinase inhibitors in mouse embryonic stem cells Oncogene 12, 30 932 2 Weinberg, R A W (1995) The retinoblastoma protein and cell cycle control Cell 81, 32 333 0 Bartek, J., Bartkova, J., and ... rescuing ES cells during the selection process Murine Embryonic Stem Cells 11 Prepare the ES cells from one of the two dishes made d previously for subculture (see Subheading 3. 8 .3. ) While the cells ... pluripotent stem cells from cultured human primordial germ cells Proc Natl Acad Sci USA 95, 13, 726 13, 731 11 Reubinoff, B E., Pera, M F., Fong, C.-Y., Trounson A., and Bongso, A (2000) Embryonic stem...

516
553
0

differentiation of embryonic stem cells

Danh mục: Sinh học

... Repopulating Cells from Embryonic Stem Cells The In Vitro Diﬀerentiation of Mouse Embryonic Stem Cells into Neutrophils 10 Development and Analysis of Megakaryocytes from Murine Embryonic Stem Cells ... Mouse Embryonic Germ Cells 25 Isolation and Culture of Embryonic Germ Cells MARIA P DE MIGUEL AND PETER J DONOVAN 35 3 Section III Gene Discovery by Manipulation of Mouse Embryonic Stem Cells ... Development of Lymphoid Lineages Embryonic Stem Cells In Vitro from 12 Probing Dendritic Cell Function by Guiding the Diﬀerentiation of Embryonic Stem Cells 13 Gene Targeting Strategies for the...

574
619
0

báo cáo hóa học:" Transplantation of vascular cells derived from human embryonic stem cells contributes to vascular regeneration after stroke in mice" docx

Danh mục: Hóa học - Dầu khí

... Saline Saline F hES-ECs+MCs hES ECs+MCs ss -DNA+ cells (/mm2 ) * 60 50 40 30 20 10 Saline hES ECs+MCs Exercise time on rota-rod (sec) 42 40 38 36 34 32 30 28 26 24 22 20 Saline hMNCs hES- ECs hES- ... progenitor cells For therapeutic neovascularization Proc Natl Acad Sci USA 2000, 97 :34 22 -34 27 Peichev M, Naiyer AJ, Pereira D: Expression of VEGFR-2 and AC 133 by circulating human CD34+ cells identifies ... Characterization of the transplanted vascular cells derived from human ES cells (HES -3) Characterization of the transplanted vascular cells derived from human ES cells (HES -3) A, Flow cytometric analysis of...

14
450
0

báo cáo hóa học:" MicroRNA and gene expression patterns in the differentiation of human embryonic stem cells" doc

Danh mục: Hóa học - Dầu khí

... 25 26 27 28 29 30 31 32 33 34 35 36 37 Tang F, Hajkova P, Barton SC, Lao K, Surani MA: MicroRNA expression profiling of single whole embryonic stem cells Nucleic Acids Res 2006, 34 (2):e9 Chen ... let-7f miR-10b miR-10a miR-126* miR -36 9-5p miR-181b miR -30 c miR-26b miR-26a miR-190 miR -30 e-5p miR-219 miR -37 3 miR -36 3 miR- 130 a miR-148a miR -30 1 miR -37 4 miR101 miR -33 miR-25 miR-106a miR-524* miR-517c ... miR -36 7 miR-520e miR -30 2a* miR -30 2c miR -30 2a miR -30 2b miR-200c miR-141 miR -30 2d miR-200b miR-96 miR -30 2b* miR-612 miR-299-3p miR-550-2 miR-127 miR -36 9-3p miR-520g miR-515-5p miR-519c miR -37 2...

17
593
0

báo cáo hóa học:" Human embryonic stem cells hemangioblast express HLA-antigens" pot

Danh mục: Hóa học - Dầu khí

... engraftment of mouse embryonic stem cells in allogeneic recipients Stem Cells 2006, 24(10):2192-201 Magliocca JF, Held IK, Odorico JS: Undifferentiated murine embryonic stem cells cannot induce ... susceptible to immune rejection than adult cells Stem Cells 2006, 24(2):221-9 Koch CA, Geraldes P, Platt JL: Immunosuppression by embryonic stem cells Stem Cells 2008, 26(1):89-98 Fabricius D, Bonde ... dried for 24 hours H9 cells, EB (day 3) cells and BC (day 6) cells were harvested, washed in PBS, and were allowed to settle on the coated coverslips for 30 at 37 °C The cells were then fixed...

10
409
0

EMBRYONIC STEM CELLS – DIFFERENTIATION AND PLURIPOTENT ALTERNATIVES doc

Danh mục: Sức khỏe giới tính

... stem cells These include very small embryonic/ epiblast like stem cells, multipotent dental stem cells, pluripotent stem cells from testis and amniotic fluid stem cells In the book Embryonic Stem ... display H3K4me3 on their promoter region and H3K36me3 across the gene body, while repressed genes are enriched in H3K27me3 over the gene body, with some amount of H3K9me3 and H4K20me3 [178-180] H3K4 ... pluripotent cells Development, 2007 134 (6): p 11 23- 32 [162] Kaji, K., et al., The NuRD component Mbd3 is required for pluripotency of embryonic stem cells Nat Cell Biol, 2006 8 (3) : p 285-92 [1 63] Zhu,...

518
390
1

EMBRYONIC STEM CELLS – DIFFERENTIATION AND PLURIPOTENT ALTERNATIVES pdf

Danh mục: Sức khỏe giới tính

... stem cells These include very small embryonic/ epiblast like stem cells, multipotent dental stem cells, pluripotent stem cells from testis and amniotic fluid stem cells In the book Embryonic Stem ... display H3K4me3 on their promoter region and H3K36me3 across the gene body, while repressed genes are enriched in H3K27me3 over the gene body, with some amount of H3K9me3 and H4K20me3 [178-180] H3K4 ... pluripotent cells Development, 2007 134 (6): p 11 23- 32 [162] Kaji, K., et al., The NuRD component Mbd3 is required for pluripotency of embryonic stem cells Nat Cell Biol, 2006 8 (3) : p 285-92 [1 63] Zhu,...

518
442
0

EMBRYONIC STEM CELLS – BASIC BIOLOGY TO BIOENGINEERING doc

Danh mục: Sức khỏe giới tính

... Applications of Embryonic Stem Cells in Research and Development 191 Chapter 11 Methods to Generate Chimeric Mice from Embryonic Stem Cells 1 93 Kun-Hsiung Lee Chapter 12 Embryonic Stem Cells in Toxicological ... of Galanin in Embryonic Stem Cells and Tissues 32 1 Maria-Elena Lautatzis and Maria Vrontakis Chapter 18 Rho-GTPases in Embryonic Stem Cells Michael S Samuel and Michael F Olson 33 3 Contents Chapter ... and Sterility, 84, 132 8 133 4 Oh KS, Kim HS, Ahn JH (2005) Derivation and Characterization of New Human Embryonic Stem Cell Lines: SNUhES1, SNUhES2, and SNUhES3 Stem Cells, 23, 211-219 Pickering...

490
420
0

Báo cáo khoa học: "Human embryonic stem cells and therapeutic cloning" pdf

Danh mục: Báo cáo khoa học

... characterization of human embryonic stem cells Stem Cells Dev 2004, 13, 32 5 -33 6 18 Drukker M, Benvenisty N The immunogenicity of human embryonic stem- derived cells Trends Biotechnol 2004, 22, 136 -141 19 Evans ... pluripotential phenotype of embryonic stem cells through direct activation of gp 130 signalling pathways Mech Dev 1994, 45, 1 63- 171 87 Zerhouni E Embryonic stem cells Science 20 03, 30 0, 911- 912 88 Zhang ... of neurons and neural precursors from human embryonic stem cells Exp Neurol 2001, 172, 38 3 -39 7 Chen U, Kosco M Differentiation of mouse embryonic stem cells in vitro; III Morphological evaluation...

10
403
0

Báo cáo khoa học: " Effect of dihydrotestosterone on mouse embryonic stem cells exposed to H2O2-induced oxidative stress" pdf

Danh mục: Báo cáo khoa học

... 20, 239 -246 33 Heo JS, Lee YJ, Han HJ EGF stimulates proliferation of mouse embryonic stem cells: involvement of Ca2+ influx and p44/42 MAPKs Am J Physiol Cell Physiol 2006, 290, C1 23- 133 34 Ikeda ... basis of pluripotency in mouse embryonic stem cells Cloning Stem Cells 2004, 6, 38 6 -39 1 17 Cobb MH, Goldsmith EJ How MAP kinases are regulated J Biol Chem 1995, 270, 148 43- 14846 18 Cochrane CG Cellular ... with or without DHT for 30 and Trypan blue exclusion assay The cells were pretreated with or without DHT for 30 and Effect of dihydrotestosterone on mouse embryonic stem cells exposed to H2O2-induced...

10
263
0

The signals of FGFs on the neurogenesis of embryonic stem cells ppsx

Danh mục: Báo cáo khoa học

... 20 03, 100:12759-12764 doi: 10.1186/14 23- 0127-17 -33 Cite this article as: Chen et al., The signals of FGFs on the neurogenesis of embryonic stem cells Journal of Biomedical Science 2010, 17 :33 ... requirement during early embryonic neurogenesis J Biol Chem 20 03, 278:48422-48 433 30 Amura CR, Marek L, Winn RA, Heasley LE: Inhibited neurogenesis in JNK1-deficient embryonic stem cells Mol Cell Biol ... Pera MF, Trounson AO: Human embryonic stem cells: prospects for development Development 2004, 131 :5515-5525 Spagnoli FM, Hemmati-Brivanlou A: Guiding embryonic stem cells towards differentiation:...

11
194
0

Báo cáo y học: "Identification of a truncated form of methionine sulfoxide reductase a expressed in mouse embryonic stem cells" pps

Danh mục: Báo cáo khoa học

... oxygen depletion/reoxygenation conditions in mouse embryonic stem cells Methods Mouse embryonic stem cell culture The mouse embryonic stem (MES) cells (CCE-24) were routinely grown on 0.1% gelatin-coated ... Miller School of Medicine, Miami, FL 33 136 , USA 2Department of Molecular and Cellular Pharmacology, University of Miami, Miller School of Medicine, Miami, FL 33 431 , USA Department of Biomedical Science, ... markers SSEA-1 (Mab 430 1) and SSEA-4 (Mab 430 4, Millipore, Billerica, MA) to ensure no differentiation Only cells within the 20th passage were used Page of 10 5% carbon dioxide at 37 °C Cells were removed...

10
309
0

báo cáo khoa học: "Epigenomics of human embryonic stem cells and induced pluripotent stem cells: insights into pluripotency and implications for disease" potx

Danh mục: Báo cáo khoa học

... Active enhancers Presence: p300, H3K4me1/2, H3K27ac Absence: H3K4me3, H3K27me3 General [ 63, 64,79] Poised enhancers Presence: p300, H3K4me1/2, H3K27me3 Absence: H3K4me3, H3K27ac Prevalent in hESCs ... protein; ESC, embryonic stem cell; H3K4me1, methylation of lysine of histone H3; H3K4me3, trimethylation of lysine of histone H3; H3K27ac, acetylation of lysine 27 of histone H3; H3K27me3, trimethylation ... methylated region; ESC, embryonic stem cell; hESC, human embryonic stem cell; H3K4me3, trimethylation of lysine of histone H3; H3K27ac, acetylation of lysine 27 of histone H3; H3K27me3, trimethylation...

13
338
0

báo cáo khoa học: " Embryonic stem cells in scaffold-free threedimensional cell culture: osteogenic differentiation and bone generation" ppt

Danh mục: Báo cáo khoa học

... 20 03, 3: 5- 13 37 Heng BC, Cao T, Stanton LW, Robson P, Olsen B: Strategies for directing the differentiation of stem cells into the osteogenic lineage in vitro J Bone Miner Res 2004, 19: 137 9- 139 4 ... neural precursors from human embryonic stem cells Nat Biotechnol 2001, 19:1129-1 133 doi:10.1186/1746-160X-7-12 Cite this article as: Handschel et al.: Embryonic stem cells in scaffoldfree three-dimensional ... potential of embryonic stem cells [30 ] In this respect, fusion of multiple bony units may allow the reconstruction of larger skeletal elements Through the ability of embryonic stem cells to differentiate...

6
257
0

báo cáo khoa học:" Induction of osteogenic markers in differentially treated cultures of embryonic stem cells" ppt

Danh mục: Báo cáo khoa học

... autologous cells as well as allogenic and xenogenic cells [ 13- 16] There are some reports that use totipotential embryonic stem cells in tissue engineering of bone [17,18] Embryonic stem cells (ESCs) ... pluripotency in mouse embryonic stem cells Cloning Stem Cells 2004, 6(4) :38 6 -39 1 Smith AG, Heath JK, Donaldson DD, Wong GG, Moreau J, Stahl M, Rogers D: Inhibition of pluripotential embryonic stem cell differentiation ... 21(4):911-916 Page of (page number not for citation purposes) Head & Face Medicine 2008, 4:10 33 34 35 36 37 38 39 40 41 http://www.head-face-med.com/content/4/1/10 Pfaffl MW: A new mathematical model...

7
397
0