3 a protection requirements for transformers over 600 v
Assessment of Planetary Protection Requirements for Spacecraft Missions to Icy Solar System Bodies pptx
... France, 2010 C Sagan and S Coleman, Spacecraft sterilization standards and contamination of Mars, Astronautics and Aeronautics 3( 5), 1965 C Sagan and S Coleman, “Decontamination standards for ... Coordinator TANJA PILZAK, Manager, Program Operations CELESTE A NAYLOR, Information Management Associate CHRISTINA O SHIPMAN, Financial Officer SANDRA WILSON, Financial Assistant vi Copyright © National ... Spacecraft sterilization standards and contamination of Mars, Astronautics and Aeronautics 3( 5), 1965 21 C Sagan and S Coleman, “Decontamination standards for martian exploration programs,” pp...
- 101
- 331
- 0
Tài liệu Module 3: Using a Conceptual Design for Data Requirements docx
... Investigation Process Module 3: Using a Conceptual Design for Data Requirements Activity 3. 2: Relating Data Requirements to Conceptual Design Data Requirements Activity 3. 1: Identifying Data-Related ... Data-Related Use Cases and Data Requirements Module 3: Using a Conceptual Design for Data Requirements ! Overview Slide Objective To provide an overview of this module’s topics and objectives " Investigation ... within a conceptual design " Purpose $ Lead-in Validating data requirements can help improve the overall quality of a solution’s conceptual design " Ensures that data requirements are traceable...
- 20
- 580
- 0
Tài liệu Instructor Notes Module 3: Using a Conceptual Design for Data Requirements pdf
... Module 3: Using a Conceptual Design for Data Requirements Activities Activity 3. 1: Identifying Data-Related Use Cases and Data Requirements In this activity, students will determine data requirements, ... be able to: • Discuss use cases, data requirements, and requirements validation as they relate to conceptual design for data systems ! To prepare for the activity • Review the activity and anticipate ... clarify the data requirements to prepare for possible answers from the students Activity 3. 2: Relating Data Requirements to Conceptual Design In this activity, students will participate in an...
- 4
- 447
- 0
A research proposal submitted in partial fulfillment of the requirements for the degree of Master of Business Administration
... 1992 Nov., Malaysian supermarkets: tough times now and ahead, p.12- 13; Asian Retailer, 19 93 Jan/Feb., Indonesian retailing - a review of trend in 1992, p,11- 13; Asian Retailer, 19 93 Mar., Drama on ... deep appreciation to the Swiss-AITVietnam Management Development Program for providing me with a scholarship to pursue my MBA at AIT Thanks are also extended to many supermarkets managers and staff, ... market and tries to present an international image (Kawahara and Speece, 1994) Singapore is the easiest place in Asia for international retailers to enter the market A number of very big name retailers...
- 51
- 1,039
- 3
iec 60269-4-1 low-voltage fuses - supplementary requirements for fuse-links for the protection of
... courants assignés sont ceux qui suivent: – 130 V ou 150 V en courant alternatif jusqu’à 60 A; – 600 V en courant alternatif jusqu’à 30 A; – 000 V en courant alternatif jusqu’à 30 A 7.1 Réalisation ... Typical voltage rating V Typical maximum current rating A A max B max D max E nom F nom G nom H nom J K max 230 900 32 ,6 38 ,2 85 25,4 6,4 59 10 ,3 13 83 690 710 60 38 ,2 114 25,4 6,4 85 10 ,3 13 83 ... internationales, gouvernementales et non gouvernementales, en liaison avec la CEI, participent également aux travaux La CEI collabore étroitement avec l'Organisation Internationale de Normalisation (ISO), selon...
- 42
- 420
- 2
iec 60269-4 low-voltage fuses - supplementary requirements for fuse-links for the protection of s
... Verification of overload capability For d.c.: 8.5 No 13 gR and gS breaking capacity and operating characteristics No 1 2a aR breaking capacity and operating characteristics No 12 Breaking capacity and ... Conditions for operation in service 3. 4 Voltage 3. 4.1 Rated voltage For a. c., the rated voltage of a fuse-link is related to the applied voltage; it is based on the r.m.svalue of a sinusoidal a. c voltage ... message: please call the Document Policy Group at 30 3 -39 7-2295 - 10- 60269-4 Amend O CEI:2002 Remplacer le tableau VIIA existant par le nouveau tableau VIIA suivant: Tableau VIIA - Liste des essais...
- 87
- 404
- 1
iec 60439-3 low-voltage switchgear and controlgear assemblies - particular requirements for iow-v
... dealt with may participate in this preparatory work International, governmental and non-governmental organizations liaising with the IEC also participate in this preparation The IEC collaborates ... by Information Handling Services 60 439 -3 O IEC: 1990 +A1 : 19 93 +A2 :2001 -11 - LOW-VOLTAGE SWITCHGEAR AND CONTROLGEAR ASSEMBLIES - Part 3: Particular requirements for low-voltage switchgear and ... traitộ peut participer Les organisations internationales, gouvernementales et non gouvernementales, en liaison avec la CEI, participent ộgalement aux travaux La CE1 collabore ộtroitement avec...
- 49
- 488
- 4
Đề tài " Ramification theory for varieties over a perfect field " docx
... Annals of Mathematics, 168 (2008), 33 –96 Ramification theory for varieties over a perfect field By Kazuya Kato and Takeshi Saito Abstract For an -adic sheaf on a variety of arbitrary dimension ... log DV /U = DV /V + g ∗ DV /U Proof We have V ×U V \ V = (V V V \ V ) (g ×g)−1 (V ×U V \ V ) Hence, the equalities follow from Lemma 3. 3.1.2 Proposition 3. 4 .3 Let f : V → U be a finite and etale ... (Γσ , V )log are defined in CH0 (V \ V ) RAMIFICATION THEORY FOR VARIETIES OVER A PERFECT FIELD 69 ´ Lemma 3. 4.2 For a morphism g : V → V of finite and etale schemes over U , we have (3. 21) log...
- 65
- 408
- 0
A GUIDE TO FEDERAL FOOD LABELING REQUIREMENTS FOR MEAT AND POULTRY PRODUCTS potx
... standard which permitted manufacturing deviations and allowances for variations caused by moisture loss The California law was thus declared preempted by federal law, and therefore, unenforceable ... the Agency’s decision to modify its prior label approval authority in a fashion that has dramatically reduced the number of labels that must actually be submitted for evaluation and approval by ... application may appear on “retail labels.” The labels applied at retail are not required to have sketch approval, but the animal production claims must be preapproved by the Agency (i.e., via...
- 117
- 4,416
- 0
Báo cáo khóa học: Vertical-scanning mutagenesis of amino acids in a model N-myristoylation motif reveals the major amino-terminal sequence requirements for protein N-myristoylation ppt
... ATATGGATCCATGGGCGCGGCAGCAGCGGCAGCAGCAGCAGACAAGCCTGTAGCC GCCGGGATCCATGGGCGCAGCAGCATCTGCAGCAGCAGCAGACAAGCCTGTAGCC GCCGGGATCCATGGGCGCAGCAGCANNKGCAGCAGCAGCAGAC ATATGGATCCATGGGCNNKGCAGCAGCGGCAGCAGCAGCAGAC GCCGCTCGAGCCTGTAGCCCATGTT AATTCTCGAGTGCTGCTGCTGCCGATGCTGC ... GCCGGGATCCATGGGCAAGCAGAATAGCGCACTGCGGCCAGACAAG GCCGGGATCCATGGGCAAGGCAGCATCTGCAGCAGCAGCAGACAAGCCTGTAGCC GCCGGGATCCATGGGCAAGGCAGCATCTAAGGCAGCAGCAGACAAGCCTGTAGCC AATTAACCCTCACTAAAGGG GCCGGGATCCTAGGGCGAATTGGGTACC Ó FEBS 2004 Analysis of the ... GCCGCTCGAGCCTGTAGCCCATGTT AATTCTCGAGTGCTGCTGCTGCCGATGCTGC AATTCTCGAGTGCTGCTGCTGCCGTTGCTGC AATTCTCGAGTGCTGCTGCTGCGAATGCTGC GCCGGGATCCATGGGCAAAACGCTGAGCAAAGAGGACAAGCTCGAG GCCGGGATCCATGGGCAAGCAGAATAGCGCACTGCGGCCAGACAAG...
- 12
- 512
- 0
A MASTER''''S PROJECT SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTERS IN NURSING potx
... other government data and analysis of a proprietary administration claims for an employed population The results of the data analysis revealed healthcare costs directly related to prescription abuse ... was an administrative database of medical and pharmacy claims of 16 selfinsured employer health plans with approximately two million patients The data were used to compare total payer costs against ... opioid abuse from a private payer's perspective The research analysts focused on an average per-patient direct health care cost that was measured in 20 03 United States dollars The data source...
- 20
- 552
- 0
A BOATER’S GUIDE TO THE FEDERAL REQUIREMENTS FOR RECREATIONAL BOATS AND SAFETY TIPS potx
... Chartscalerefersto a measurementofanarea,notthe distance A chartcovering a relativelylargeareaiscalled a “smallscale” chart; a “largescale”chartwillcover a relativelysmallareaandshow muchgreaterdetail Havingthemostcurrentchartisimportant ... AtmosphericAdministration’sNationalOceanService(NOS)produces a NN N varietyofnauticalchartsandrelatedproducts Nauticalchartscanvaryin scaleandformat Chartscalerefersto a measurementofanarea,notthe ... Oneofthemostimportanttools for safelynavigatingwaterwaysis a NauticalChart Today,manyrecreationalboatersuseGPSreceivers andperformelectronicwaypointnavigation Although a GPScantellyou whereyouareintermsoflatitudeandlongitude,itcannotshowwhatis...
- 45
- 515
- 0
A dissertation submitted in partial satisfaction of the requirements for the degree Doctor of Philosophy in Business Administration potx
... HAKANSSON T e diaclerta;tion of N i b Hemming Hakaneson is h appsoved, and it is acceptable In quality and form for publication on mlcrof'ilm: * r Committee Chairman Unlveraity of California, ... popular a u t h o r s , Loeb, for example, w r i t e s that "the p u r p o s e of investment i s to have funds available a t a l a t e r date f o r spending 112 In a different p a s s a g e he s t a ... postul a t e s presupposing c e r t a i n consistencies i n behavior, a r e ava-ilable i n the l i t e r a t u r e ; s e e f o r example the accounts of s a v a g e and M a r s c h a k - The r e a...
- 143
- 404
- 0
A Dissertation Presented to the Faculty of the Graduate School of Cornell University In Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy potx
... 2.10 Actuation 29 2.11 Optical Detection 30 x 2.12 MEMS and NEMS Applications 33 2. 13 Conclusions 33 Chapter GRAPHENE 3. 1 Carbon vs Silicon 36 3. 2 Forms of Carbon 38 3. 3 Graphene Fabrication 42 3. 4 ... band of AlGaAs, negative charges fall toward the GaAs side but are attracted by the positive charges that remain on the AlGaAs side This results in the bands bending and confining the charge at ... making it a useful quantity to compare different materials Ohm’s law is a general formula applicable to 3D, 2D, and 1D conductors In a typical conductor charges are moving and scattering at random...
- 140
- 510
- 0
Bacillus thuringiensis a new perspective for an induced protection to coffee leaf rust
... contra uma posterior lnfec^ao com o fungo Hemileia vastatrix, agente causa) da ferrugem alaranjada cafeeiro O Thuricide H D , foi efetivo em induzir prote^ao nas plantas desde a concentra^ao de ... cotton and sprayed on the abaxial (under) leaf surface with 152 DAGMAR S ROVERATTl, ANA REGINA R TEIXEIRA and WALKYRIA B C MORAES the inducer preparation, using nitrogen as the propellent gas, at ... remaining leaves (Table 4) 154 DAGMAR S ROVERATTI, ANA REGINA R TEIXEIRA and WALKYJUA B C MORAES Tahle Local and systemic effect of Thuricide HD as an inducer of protection of coffee plants...
- 12
- 421
- 0
báo cáo hóa học: " TCP NCE: A unified solution for non-congestion events to improve the performance of TCP over wireless networks" docx
... to adjust dupthresh dynamically The author utilizes a combined cost function for retransmission timeouts (RTO) and false fast retransmissions to adapt the false fast retransmit avoidance ratio ... detects out-of-order events only after a route has recovered from failures As a result, TCP DOOR is less accurate and responsive than a feed-back based approach, which can determine whether congestion ... one mss for each additional dupacks and transmits new packets, if allowed by the new value of cwnd and the receivers advertised window When the sender receives a new ack including Recover, the...
- 20
- 562
- 0
Báo cáo hóa học: " Research Article A Novel Method for Improving Fairness over Multiaccess Channels" pdf
... show the Average AME for the six methods which are compared As it was already pointed out previously, OMA achieves always the maximum possible AME We can notice from Figure 2(b) that SIC and TS ... A Maddah-Ali, A Mobasher, and A K Khandani, “Fairness in multiuser systems with polymatroid capacity region,” IEEE Transactions on Information Theory, vol 55, no 5, pp 2128–2 138 , 2009 [2] S Verdu, ... Tse and P Viswanath, Fundamentals of Wireless Communications, Cambridge University Press, Cambridge, UK, 2005 [6] A J Viterbi, “Very low rate convolutional codes for maximum theoretical performance...
- 10
- 385
- 0
Báo cáo hóa học: " Research Article Protection of Video Packets over a Wireless Rayleigh Fading Link: FEC versus ARQ" ppt
... by Ntr , and an average value that decreases with increasing Eb /N0 and increasing PHY layer diversity D; typically, these averages are considerably smaller than the fixed overhead and latency resulting ... “Parameter values for the HDTV+ standards for production and international programme ex-change,” ITU-R recommendation BT.709-5, 2002 [20] S Kanumuri, P C Cosman, A R Reibman, and V A Vaishampayan, ... the average overhead E[ovh] related to the retransmission protocol The average number E[#transm] of transmissions per packet is related to the average overhead by E[#transm] = + E[ovh] It is easily...
- 15
- 243
- 0
Báo cáo hóa học: " A Temperature Window for the Synthesis of Single-Walled Carbon Nanotubes by Catalytic Chemical Vapor Deposition of CH4 over Mo2-Fe10/MgO Catalyst" pptx
... Natural Science Foundation of Linyi, China Nanoscale Res Lett (2009) 4:574–577 References S Iijima, T Tchihashi, Nature 36 3, 6 03 (19 93) doi:10.1 038 / 36 360 3a0 R.H Baughman, C Cui, A. A Zakhidov ... 10.11 03/ PhysRevLett.86. 131 M Kruger, M.R Buitelaar, T Nussbaumer et al., Appl Phys Lett 78, 1291 (2001) doi:10.10 63/ 1. 135 0427 N Rajalakshmi, K.S Dhathathreyan, A Govindaraj et al., Electrochim Acta ... catalyst was put into the quartz tube The temperature was raised to the setting value in Ar atmosphere at a flow rate of 200 mL/min before CH4 was introduced into the reactor at 60 mL/min for 30 ...
- 4
- 395
- 0
Tìm thêm: xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008