2— shear strength for non rectangular support
(free) Building code requirements for structural concrete and commentary pca notes on aci318 08
... CODE COMMENTARY Deformed reinforcement — Deformed reinforcing bars, bar mats, deformed wire, and welded wire reinforcement conforming to 3.5.3 Deformed reinforcement — Deformed reinforcement is defined ... CHAPTER 11 SHEAR AND TORSION 155 11.1 Shear strength 155 11.2 Shear strength provided by concrete for nonprestressed members 158 11.3 Shear strength provided ... mats for concrete reinforcement shall conform to ASTM A184 Reinforcing bars used in bar mats shall conform to ASTM A615 or ASTM A706 3.5.3.5 — Deformed wire for concrete reinforcement shall conform...
- 1,508
- 13,139
- 1
Báo cáo y học: " Mechanism of HIV-1 Tat RNA translation and its activation by the Tat protein" ppsx
... AATTGGGTGTCGACATAGCAGAATAGGCG 3' (exon2 sense for Tat1:290→ and for Tat2:343→) Ex2Tat rev 5'GGGATTGGGAGGTGGGTTGCTTTGATAGAGAAGCTTGATGAGTCTGACTG3' (exon2: reverse for Tat1:← 558 and for Tat2:← 611) Ex'Tat sense ... (exon':sense for Tat2:290→) Ex'Tat rev 5' CTGCTATGTCGACACCCAATTCTTTCCAGAGGAGCTTTGCTG 3' (exon':reverse for Tat2:← 343) Ex3Tat sense 5' ACCCACCTCCCAATCCCGAG 3' (exon3: sense for Tat1:558→ and for Tat2: ... TAATAATGCGGCCGCAGTACAGGCAAAAAGCAGCTGCTTATATGC 3' (exon3: reverse for Tat1:← 1718 and for Tat2:← 1770) PBSEcoRI sense 5' TATATTAGAATTCGTGTGCCCGTCTGTTGTGTGACT 3' (exon1: sense for Tat1 and for Tat2:104 →) SDEcoRI sense 5' ATATAAGAATTCCGAGGGGCGGCGACTG...
- 18
- 240
- 0
Báo cáo y học: " Processing sites in the human immunodeficiency virus type 1 (HIV-1) Gag-Pro-Pol precursor are cleaved by the viral protease at different rates" ppt
... shown Products are represented in abbreviated form by the N- and C-terminal domains according to the nomenclature of Leis et al [55] D Proposed pathway for the ordered processing of the HIV-1 Gag-Pro-Pol ... allowed for the separation and analysis of the appearance of each product An initial species of 120 kDa (processing intermediate pi120) was rapidly generated within minutes then disappeared to form ... precursors is highly regulated and is necessary for the production of an infectious, properly assembled virion We not yet know the extent of the requirement for timed cleavage of Gag-Pro-Pol in producing...
- 6
- 353
- 0
Synthesis and photoluminescence property of silicon carbon nanowires synthesized by the thermal evaporation method
... of rotary vacuum pump for many times Afterwards, the furnace was rapidly heated from room temperature to 1400 1C at a heating rate of 10 1C/min and maintained for reaction for h in atmosphere pressure ... mechanical strength material, and will be of use for application in electronic circuits, in light-emitting devices and in other advanced blocks of nanodevices Acknowledgements This research work is supported ... resolution of 0.65 cmÀ1 Phtotoluminescence (PL, Hitatch F-4500) spectroscopy measurement was performed with xenon lamp under 354 nm as the excitation source at room temperature Fig SEM image of the nanoporous...
- 5
- 552
- 0
Báo cáo toán học: " Photoluminescence characteristics of Cd1-xMnxTe single crystals grown by the vertical Bridgman method" doc
... larger than the separation of 41 meV for CdTe [10] In addition, the peak at 1.728 eV for x = 0.11 is the LO-phonon replica of the L1 transition giving a LO phonon energy of 21 meV in agreement with ... meV for x = 0.0 to approximately 9.49 meV for x = 0.2 The FWHM of the L1 emission line also increases with increasing temperature, which can be accounted for by increasing the excitonphonon interaction ... coefficient of exciton-acoustic phonon interaction, ГLO is the exciton-LO phonon coupling constant, ħωLO is the LO phonon energy, Гi is a proportionality factor which accounts for the concentration of...
- 14
- 547
- 0
Báo cáo toán học: "A Multiple Integral Evaluation Inspired by the Multi-WZ Method" potx
... , xk ) ˆ (x1 , , xi−1 , xi+1 , , xk ) for < i < k xi := for i = k (x1 , , xk−1 ) dx = dx1 · · · dxk , for m = (y)m := m−1 i=0 (y + i) for m > k e1(x) := xi , i=1 e2(x) := xi xj , ... the computational point of view, the recurrence form of the integral is nicer than its indefinite summation form (the above corollary) ,for the former requires O(mk) calculations, whereas the latter ... a forthcoming paper [T99] Notation In the sequel, k is a positive integer, m and n are non- negative integers The notations used in this article are defined as follows x := (x1 , , xk ), for...
- 7
- 227
- 0
A numerical study of a permeable capsule under stokes flows by the immersed interface method
... nature of the problem For example, in capsules simulation under imposed simple shear flow, the time is often nondimensionalize using the shear rate (s-1) For the present formulation, the characteristic ... the force strength at kth control point f k is calculated using the discrete form of Eq (2.4) and then the effect of singular force on a r grid point (i, j) F is determined from the discrete form ... the membrane, J Ee shear modulus of the membrane, N/m r f r ∂ ˆ force strength, f ( s, t ) = Te ( s, t )τ ( s, t ) + Tb ( s, t ) n( s, t ) + f ad y , N/m2 ∂s ( ) f1, f2 force strengths in the x...
- 194
- 414
- 0
Damage progression in open hole tension composite laminates by the element failure method
... Fint Internal nodal force of elements Fd Desired nodal force of elements R(i) Residual nodal force of elements at the ith iteration viii Nomenclature (i Fext) External nodal force at the ith iteration ... 57 Figure 2.7 Prescribed normal and shear deformations for the extraction of mechanical strain amplification factors 57 Figure 2.8 Positions for extracting strain amplification factors ... potentials for lighter structures and improved performance Today fibrous composites are usually the choice of designers for a variety of reasons, including low density, high stiffness, high strength, ...
- 169
- 352
- 0
Impact of pH on Anaerobic Substrate Uptake by PAOs and GAOs in an EBPR Activated Sludge Process Analyzed by MAR-FISH
... determining factor for these two bacterial groups regarding their competition for substrate under anaerobic conditions Many of the studies on pH effect state that higher pH was beneficial for PAOs and ... 20mg mgC･L-1 with radioactivity 20 μCi･mL-1 For each pH, incubation was conducted in triplicate As control, activated sludge mixed liquor treated at 70oC for 10 was also incubated with the same substrate ... MAR-FISH Analyses Activated sludge after hot incubation was fixed with the same volume of 8% paraformaldehyde for 3hrs and washed with tap water The sample was suspended in the mixture of 98% ethanol...
- 9
- 457
- 0
Tài liệu Báo cáo khoa học: Olfactory receptor signaling is regulated by the post-synaptic density 95, Drosophila discs large, zona-occludens 1 (PDZ) scaffold multi-PDZ domain protein 1 pptx
... 20 s section; n = 15 for control, n = 27 for RNAi(exon5) (F) Bar chart showing the rise time (10–90%) for siRNA(exon45) transfected Hana3A cells; n = 12 for control, n = 12 for RNAi(exon45) (G) ... rise time (10–90%) for Hana3A cells expressing the truncated receptor (n = 12 for control, n = 17 for OR2AG1-trunc8) (F) Decay of response (90–10%) (n = 12 for control, n = 17 for OR2AG1-trunc8) ... 2-HA, transiently transfected with OR2AG1; n = 13 for control, n = 24 for PDZ domains + (D) Decay of response (90–10%) (n = 13 for control, n = 24 for PDZ domains + 2) and the percentage of responses...
- 12
- 543
- 0
Tài liệu Panda3D 1. 6 Game Engine Beginner''''s Guide by Dave Mathews doc
... Time for action – using Intervals in Sequences and Parallels Time for action – adding collision detection to the MachineGun Implementing the main cannon Time for action – creating the main cannon ... map Time for action – creating and using a key map Implementing advanced cycle controls Time for action – implementing acceleration Time for action – implementing throttle control Time for action ... the Game Ready for the Customer Collecting garbage Time for action – collecting garbage from the Explosion classes Time for action – collecting garbage from the Gun classes Time for action – collecting...
- 356
- 3,435
- 1
Tài liệu Báo cáo khoa học: Crystal structure of Trypanosoma cruzi glyceraldehyde-3-phosphate dehydrogenase complexed with an analogue of 1,3-bisphospho-D-glyceric acid Selective inhibition by structure-based design docx
... and T brucei) are summarized in Table With all mutants, and for both organisms, a decrease in kcat for the forward reaction was observed For T brucei, however, and unlike B stearothermophilus GAPDH, ... kinetics Therefore, these values were in the range of the substrate’s Km, or even lower for fluorinated compounds and Surprisingly, non uorinated molecules and have very similar Kd values for both ... Research COST-B9 for their financial support We also thank P A Michels (Brussels) for helpful discussions References WHO (2000) The World Health Report 2000: Health Systems Improving Performance WHO,...
- 13
- 588
- 0
Tài liệu Báo cáo Y học: Phosphatidylinositol synthesis and exchange of the inositol head are catalysed by the single phosphatidylinositol synthase 1 from Arabidopsis docx
... induced in fresh transformants as described previously [11] before the cells were washed in 50 mM Tris/HCl pH 8.0 and stored as pellets at )80 °C These pellets were used for lipid analyses or ... lL at 30 °C for 20 The reaction was stopped on ice by the addition of mL ice-cold methanol/ chloroform (2 : 1) Lipids were then extracted according to Sambrook et al [12] The chloroform phase ... · 104 MBqÆmmol)1) in a final volume of 1.6 mL for 30 at 30 °C The reaction was stopped by the addition of 4.8 mL methanol/chloroform (2 : 1) as before and lipids were extracted 3H-Labelled PtdIns...
- 6
- 551
- 0
Báo cáo khoa học: Activation of nematode G protein GOA-1 by the human muscarinic acetylcholine receptor M2 subtype Functional coupling of G-protein-coupled receptor and G protein originated from evolutionarily distant animals doc
... (Gakushuin University) for helpful suggestions and critical reading of this manuscript This work was supported by the program for Promotion of Basic Research Activities for Innovative Biosciences, ... muscarinic ligands The affinity of M2 for agonists, but not for antagonists, decreases on interaction with Gai ⁄ o in the presence of guanine nucleotides [28–30] The affinity for In this study, we have shown ... the affinity for GDP of Ga and the subsequent substitution of GDP by GTP [10] Such an agonist-dependent decrease in the affinity for GDP can be detected as the increase in binding of the nonhydrolysable...
- 9
- 400
- 0
Báo cáo khoa học: Structural and biological effects of a b2- or b3-amino acid insertion in a peptide Application to molecular recognition of substance P by the neurokinin-1 receptor ppt
... mLÆmin)1 Retention times were 7.3 for SP, 8.6 for [Ala9]SP, 7.5 for [HGly9]SP, 7.1 for [(R)-b2-HAla9]SP and 7.7 for [(S)-b3-HAla9]SP Enzymatic assays were performed twice and yielded similar results ... Percentages of degradation were found to be 54 ± 1% for SP, 55 ± 3% for [Ala9]SP, 33 ± 5% for [HGly9]SP, 26 ± 3% for [b2-HAla9] and 14.5 ± 2.5% for [b3-HAla9], thus showing that these b-amino acid-containing ... bond, can overlap canonical backbone conformers observed for a-amino acids Therefore the addition of a backbone methylene group could have minor effects on the overall conformation and biological...
- 11
- 860
- 0
Báo cáo khoa học: Interaction of gymnemic acid with cyclodextrins analyzed by isothermal titration calorimetry, NMR and dynamic light scattering doc
... main driving force for the interaction with c-CD as described above For the durability of antisweet effect of GA on a human tongue, this water-soluble aggregation might be important for its function ... specifically binds to c-CD Assuming formation of the inclusion complex for these interactions, it could be deduced that the cavity size of c-CD is suitable for GA binding, but those of a-CD and ... Shoichi Nakamura of Otsuka Electronics Co., Ltd for support of DLS measurements References ITC measurements MCS-ITC (Microcal, Northampton, USA) was used for thermodynamic analysis of the interaction...
- 7
- 502
- 0
Báo cáo khoa học: Maturation of Pichia pastoris-derived recombinant pro-Der p 1 induced by deglycosylation and by the natural cysteine protease Der p 1 from house dust mite doc
... IUámL)1) were used for RAST analysis Statistical analysis RAST results for natural and recombinant proDer p were compared by Spearmann rank correlation and Student's t-test after log transformation Responses ... YPD with zeocine and grown overnight at 29 °C Cells transformed with pPICZaA were then transferred to buffered glycerol-complex medium for 24 h, after which they were centrifuged (glycerol inhibits ... medium, pH 5.0) at D600 10 (SMD1168h) or D600 (GS115) for methanol-induced expression After 96 h, the supernatant was harvested For constitutive expression, cells containing pro-Der p in...
- 9
- 416
- 0
Why (Special Agent) Johnny (Still) Can’t Encrypt: A Security Analysis of the APCO Project 25 Two-Way Radio System docx
... destination talk group TGID for which a transmission is intended This permits radios to mute transmissions not intended for them The header also contains information for use in encrypted communications, ... aused for all voice information as we explainword contains n tion codes, Each code below symbols The first k symbols in the left hand part of the code word contain the A separate format exists for ... error correction even sensitive criminal codes usedFor the voice data innot all andthe available values are defined Forlaw enforcement surveillance opfor some fields, LDU1 of LDU2 frames example, the...
- 16
- 1,185
- 0
Báo cáo khoa học: Downregulation of protease-activated receptor-1 in human lung fibroblasts is specifically mediated by the prostaglandin E2 receptor EP2 through cAMP elevation and protein kinase A pot
... given in Fig 1F PGE2, forskolin and butaprost reduced the PAR-1 density on the plasma membrane by 31%, 27% and 30%, respectively (P < 0.001 for PGE2, P < 0.01 for butaprost and forskolin, n = 5), ... included a denaturation step at 95 °C for min, followed by 30 cycles at 94 °C for 30 s, 58 °C (PAR-1, AP-2, and GAPDH) or 55 °C (COL1A1) for 90 s, and 72 °C for min, and the final melting curve ... served as a loading control For experiments, after 24 h of incubation with AP-2 siRNA, cells were treated with 50 nM PGE2 for an additional h Total RNA was isolated and used for real-time PCR Control...
- 11
- 338
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25