2d block cyclic distribution of a onto four ues part 1 decomposing a

Báo cáo sinh học: " Exact distribution of a pattern in a set of random sequences generated by a Markov source: applications to biological data" pdf

Báo cáo sinh học: " Exact distribution of a pattern in a set of random sequences generated by a Markov source: applications to biological data" pdf

Ngày tải lên : 12/08/2014, 17:20
... -6 1. 55 × 10 -6 -10 GCGCGCGC RTAAAYAA* 18 3 91 11 6.52 × 10 14 7.70 × 10 -12 1. 65 × 10 -9 1. 68 × 10 -12 WWWTTTGCTCR* 15 17 4 .15 × 10 -1 4.09 × 10 -1 AAAAAAAAAAAAAAAAAAAAAAAA TAWWWWTAGM* YCCNYTNRRCCGN* ... CGCACCC* 28 AAGAAAAA* AACAACAAC TCCGTGGA* 427 25 22 L homogeneous 10 2.95 × 10 -3 heterogeneous 3.74 × 10 -3 11 1. 31 × 10 -99 1. 29 × 10 -99 10 1. 76 × 10 -6 1. 38 × 10 -6 11 1. 12 × 10 -6 1. 55 × 10 -6 ... “homogeneous”) of a selection of known TFs (marked with a star) as well as arbitrary candidate patterns Several known TFs appear to be highly significant (e.g., TF AAGAAAAA with a P-value of 1. 31 × 10 -99)...
  • 18
  • 409
  • 0
Báo cáo sinh học: "Tissue distribution of a plasmid DNA encoding Hsp65 gene is dependent on the dose administered through intramuscular delivery" docx

Báo cáo sinh học: "Tissue distribution of a plasmid DNA encoding Hsp65 gene is dependent on the dose administered through intramuscular delivery" docx

Ngày tải lên : 14/08/2014, 19:22
... Ther 20 01, 8 :15 87 -15 92 Oh YK, Kim J-P, Hwang TS, et al.: Nasal absorption and biodistribution of plasmid DNA: an alternative route of DNA vaccine delivery Vaccine 20 01, 19 :4 519 -4525 Maniatis T, ... Identification of plasmid DNA rescued Nature of plasmid DNA obtained after transformation of cellular DNA from tissues of mice days after i.m immunization with pcDNA3-Hsp65 Escherichia coli DH5-α was ... VL, et al.: B-lymphocytes in bone marrow or lymph nodes can take up plas- 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 mid DNA after intramuscular delivery Hum Gene Ther 2003, 14 :12 79 -12 85 Tuomela...
  • 10
  • 243
  • 0
Báo cáo hóa học: " Identification of a contemporary human parechovirus type 1 by VIDISCA and characterisation of its full genome" pdf

Báo cáo hóa học: " Identification of a contemporary human parechovirus type 1 by VIDISCA and characterisation of its full genome" pdf

Ngày tải lên : 20/06/2014, 01:20
... Proc Natl Acad Sci U S A 20 01, 98 :11 609 -11 614 Page of 10 (page number not for citation purposes) Virology Journal 2008, 5:26 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 Allander T, Tammi MT, ... nM of primers CTCGTAGACTGCGTACGATG and GACGATGAGTACTGATCGC at 56°C annealing temperature with Platinum Taq polymerase (Invitrogen, Karlsruhe, Germany) Second round amplification used four variants ... Recombination and selection in the evolution of picornaviruses and other Mammalian positive-stranded RNA viruses J Virol 2006, 80 :11 124 -11 140 Lukashev AN, Lashkevich VA, Ivanova OE, Koroleva GA, Hinkkanen...
  • 10
  • 432
  • 0
Báo cáo hóa học: " Isolation and characterization of a new simian rotavirus, YK-1" docx

Báo cáo hóa học: " Isolation and characterization of a new simian rotavirus, YK-1" docx

Ngày tải lên : 20/06/2014, 01:20
... segment 11 , and (c) schematic diagram of the sequences of gene segment 11 Arrows indicate segment 11 of RRV and YK -1, or rearranged segment 11 of variant 311 The YK -1 and its variant clone 311 were ... segment 11 Both YK -1 and 311 showed a cytopathic effect typical of rotavirus grown in MA -10 4 cells and readily grew to titers over 10 8 ffu per ml Variant 311 has a rearranged segment 11 The nucleotide ... rotavirus RNA Comparison and(b) Northern blot analysis the variant 311 of Comparison between the YK -1 strain and its variant 311 by (a) plaques size, (b) Northern blot analysis for rotavirus RNA...
  • 8
  • 530
  • 0
Báo cáo y học: "Mutations in matrix and SP1 repair the packaging specificity of a Human Immunodeficiency Virus Type 1 mutant by reducing the association of Gag with spliced viral RN" ppsx

Báo cáo y học: "Mutations in matrix and SP1 repair the packaging specificity of a Human Immunodeficiency Virus Type 1 mutant by reducing the association of Gag with spliced viral RN" ppsx

Ngày tải lên : 13/08/2014, 01:20
... MA gene, NLΔSL1 -19 07 had a C1907T mutation in the SP1 region and NLΔSL1- 913 / 19 07 harbored both mutations Equal amounts of p24normalized NL4-3, NLΔSL1, NLΔSL1- 913 , NLΔSL 119 07 or NLΔSL1- 913 /19 07 ... deletion mutant RNA packaging defect Figure Characterization of the dimerization state and splicing of viral RNA (A) Dimerization analysis of virion RNA Virion RNAs of different proviral constructs ... HIV -1 mRNA compared to the wild type; 3- to 5-fold less HIV -1 mRNA was associated with the revertant Figure Characterization of the association between Gag and HIV -1 RNA (A) Measurement of the association...
  • 12
  • 300
  • 0
the american practical navigator table 20   meridian angle  altitude of a body on the prim~1

the american practical navigator table 20 meridian angle altitude of a body on the prim~1

Ngày tải lên : 09/05/2016, 09:00
... 81 81 82 83 84 85 86 87 88 ° 0 14 19 24 30 35 42 48 56 66 90 67 59 53 49 45 42 39 37 35 33 32 30 29 28 27 26 25 24 23 23 22 21 21 20 20 19 19 18 18 18 17 17 17 16 16 16 16 15 15 14 14 14 13 13 ... 0 4 13 18 22 27 32 38 44 50 58 67 90 68 60 54 50 46 43 41 38 36 35 33 32 30 29 28 27 26 25 25 24 23 23 22 21 21 20 20 20 19 19 18 18 18 17 17 17 17 16 16 15 15 15 14 13 13 13 13 ° 90 86 81 77 ... 55 62 70 90 71 63 58 54 51 48 46 43 41 40 38 37 35 34 33 32 31 30 29 29 28 27 27 26 25 25 24 24 24 23 23 22 22 21 21 20 20 19 18 18 17 17 17 ° 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25...
  • 2
  • 192
  • 0
A to Z Intermediate part 1

A to Z Intermediate part 1

Ngày tải lên : 03/10/2012, 15:01
... Barbara Bargagna, Monica Ciampi, Paolo Bassi, Andrea Ceccolini, Carlo Bellanca, Claudia Rege Cambrin, Luca Zamboni, Sergio Marchetti, Guido Coli (and all at LIST), Gianluca Soria, Patrizia Caselli ... meant that a man could amass Should parents be allowed to decide who their children marry? What are the advantages of an arranged marriage? What are the dangers of a marriage that is only based ... Caselli (and all at SIAS) Thanks also to LIST SpA for technological support, to International House in Pisa, in particular Chris Powell, Paola Carranza, Lynne Graziani and Antonia Clare, and to Tau...
  • 115
  • 765
  • 5
Numerical analysis of externally prestressed concrete beams part 1

Numerical analysis of externally prestressed concrete beams part 1

Ngày tải lên : 07/11/2012, 11:04
... the analysis of beams prestressed by external cables in particular necessitates an accurate evaluation of curvature variations since the compatibility equation should be formulated with the values ... behavior of partially bonded PC beams can be satisfactorily predicted, and analytical results are in good agreement with the experimental data The accuracy of the proposed equation for the cable strain ... of bond condition on ultimate strength of frame A more application of Eq.(3.38) for the analysis of partially bonded PC plate was carried out by Qutait, A. R., et al.53) The authors stated that...
  • 96
  • 510
  • 1
New masters of poster design volume 2 part 1

New masters of poster design volume 2 part 1

Ngày tải lên : 11/03/2014, 20:23
... Theatre and France Danse Europe, a French national organization that promotes French dance companies abroad, Pesce had a challenge on his hands “I had to a sort of poster/flyer for a mini dance ... to translate into one image: the life and work of Roorda, a 19 30s mathematics teacher, pedagogue, and writer, who was a pioneer in new forms of education and a master in absurdity and surrealistic ... New Master of Poster Design#2 (Rockport) Page:29 8/ 31/ 11 5:00 AM 9/24 /11 10 :11 PM KUOKWAI CHEONG MACAO, CHINA REFERENCE MATERIAL “I remember many years ago, when I was still in college,” recalls...
  • 126
  • 411
  • 2
Micromachining Techniques for Fabrication of Micro and Nano Structures Part 1 ppt

Micromachining Techniques for Fabrication of Micro and Nano Structures Part 1 ppt

Ngày tải lên : 21/06/2014, 02:20
... Mak and Hoi Wai Choi Chapter Laser Ablation for Polymer Waveguide Fabrication 10 9 Shefiu S Zakariyah Chapter Micro Eletro Discharge Milling for Microfabrication 13 1 Mohammad Yeakub Ali, Reyad ... MEMS 18 3 Salvador Mendoza-Acevedo, Mario Alfredo Reyes-Barranca, Edgar Norman Vázquez-Acosta, José Antonio Moreno-Cadenas and José Luis González-Vidal VI Contents Chapter 10 Micro Abrasive-Waterjet ... and chemistry Mojtaba Kahrizi, Professor ECE Department, Concordia University, Montreal, Quebec, Canada 1 Focused Ion Beam Based Three-Dimensional Nano-Machining 1Jeju Gunasekaran Venugopal1,2,...
  • 20
  • 548
  • 0
PRINCIPLES OF TISSUE ENGINEERING 3RD EDITION - PART 1 pot

PRINCIPLES OF TISSUE ENGINEERING 3RD EDITION - PART 1 pot

Ngày tải lên : 29/06/2014, 09:21
... Mason Seattle, WA 9 810 1 Rajiv Saigal Medical Engineering Harvard-M.I.T Division of Health Sciences and Technology Massachusetts Institute of Technology Cambridge, MA 0 213 9 W Mark Saltzman Department ... Centro Andaluz de Biolog a Molecular y Medicina Regenerativa (Cabimer) C/Américo Vespucio, s/n 410 92 Isla de la Cartuja, Seville Spain Paul T Sharpe Department of Craniofacial Development Dental ... NY 10 595 Charles A Vacanti Harvard Medical School Brigham and Women’s Hospital Boston, MA 0 211 4 Joseph Vacanti Harvard Medical School Massachusetts General Hospital Boston, MA 0 211 4 F Jerry Volenec...
  • 606
  • 447
  • 0
Fundamentals of english grammar third edition part 1 docx

Fundamentals of english grammar third edition part 1 docx

Ngày tải lên : 01/07/2014, 14:20
... Library of Congx-esshas cataloged the student book as follows: Azar, Betty Schrampfer, 19 41Fundamentals of English grammar / Betty SchrampferAzar.-3rd ed p cm .- ?yy$ ;* , - .r , ; i n speakers ... other(s) 18 3 Summary of forms of other 18 6 Chapter MODAL AUXILIARIES 7 -1 7-2 7-3 7-4 7-5 7-6 7-7 7-8 7-9 7 -10 7 -11 7 -12 7 -13 7 -14 ~ ,I.' Chapter ?? XI* : Chapter i : 18 ... Betty Schrampfer Azar Fundament& of English Grammsr,Third Edition WithAnawerKey q ' & i,,*,l $ @ * Copyright O 2003 ,19 92 ,19 85 by Betty Schrampfer Azar All rights reserved ,-i :A - No part of this...
  • 7
  • 1.1K
  • 7
The grammar of the english verb phrase part 1 pdf

The grammar of the english verb phrase part 1 pdf

Ngày tải lên : 01/07/2014, 23:20
... Williams Table of contents Acknowledgements Table of contents V VII Chapter Chapter Chapter Chapter Chapter Chapter 91 1 71 193 209 Chapter Chapter Chapter Chapter Chapter Chapter 10 11 12 Chapter ... bibliographical references and index ISBN -13 : 978-3 -11 - 018 589-8 (hardcover : acid-free paper) ISBN -10 : 3 -11 - 018 589-X (hardcover : acid-free paper) English language − Tense English language − Grammar ... writing of the book by commenting on an earlier draft of one or more chapters In alphabetical order they are: Griet Beheydt, Ilse Depraetere, Raphael Salkie, Elizabeth Traugott, Naoaki Wada, and...
  • 7
  • 510
  • 2
Cultivation of soya and other legumes - Part 1 ppsx

Cultivation of soya and other legumes - Part 1 ppsx

Ngày tải lên : 02/07/2014, 05:20
... Tanzania Zaire Zimbabwe America Argentina Mexico Paraguay Asia China India Indonesia Europe World Production (10 00 ton) 7026 362 12 7 51 6847 273 13 31 39 245 51 5640 12 985 354 5294 55200 Yield (kg/ha) ... Africa (Nigeria) Asia (China, India) Europe (Italy) North America South America Hectares (10 00 ha) 57778 4 01 15439 547 23837 16 787 The importance of legumes Yield (kg/ hectare) 19 20 12 70 13 40 ... Soya is a legume that is very rich in nutrients and there are a number of products that can only be made from soya Soya beans and soya products can also be sold and can therefore be a source of...
  • 9
  • 281
  • 0
Electromagnetic Field Theory: A Problem Solving Approach Part 1 ppsx

Electromagnetic Field Theory: A Problem Solving Approach Part 1 ppsx

Ngày tải lên : 03/07/2014, 02:20
... CartesianCoordinates(x, y, z) af af Vf = - , + O i, + af i, ax Oz ay aA, aA, + aA, V A= a+ ax az ay (LAX, A AaA\ ay z V2f a' +f Ox jy + az a, O aA ax Ox ay a' f az CylindricalCoordinates ... z) Of I •af4 + af r04 az Vf = arr 1a iA, aA, rr rr a Oz V *A= - -(rAr)+M +M I a BA, rr) r V~ f la0 af\ r- rr aA 82f + I(rAs) ar 'L ,+ a2 f ae+I r •O af If -14 r sin aO A (r a( sin OAo) oA* V" -A ... (rPA,)+ + r ar r sin ae r sin a4 x r sin a( sin OAs) aA] a8 0 a 04, S r sio V'f = r-r a- " r+ MA, arsin a( rA,)) [ra(rAo) dA ,1 r Or O- a+ sin O+ I A a4J 4) af a ar DA A -2 Ora r) 14 az SphericalCoordinates...
  • 10
  • 313
  • 0
Handbook of Microbiological Media, Fourth Edition part 1 pptx

Handbook of Microbiological Media, Fourth Edition part 1 pptx

Ngày tải lên : 03/07/2014, 18:20
... Agar, BiTek™ Agar prepared as a special technical grade Agar, Flake A technical-grade agar Agar, Grade A A select-grade agar containing minerals Agar, Granulated A high-grade granulated agar ... amino acids It contains total nitrogen of 11 .9% and NaCl of 1. 4% Liver Digest Neutralized A papaic digest of liver that contains total nitrogen of 11 .0% and NaCl of 1. 6% Mycological Peptone A ... media Agar Bacteriological (Agar No 1) An agar with low calcium and magnesium Agar, Bacto A purified agar with reduced pigmented compounds, salts, and extraneous matter 2 Composition of Media Agar,...
  • 10
  • 348
  • 0
Chapter 030. Disorders of Smell, Taste, and Hearing (Part 1) doc

Chapter 030. Disorders of Smell, Taste, and Hearing (Part 1) doc

Ngày tải lên : 06/07/2014, 15:21
... mediated through the trigeminal, glossopharyngeal, and vagal afferents in the nose, oral cavity, tongue, pharynx, and larynx Flavor is the complex interaction of taste, smell, and somatic sensation ... odorants or to recognize them may be normal An odor stimulus is referred to as an odorant Each category of smell dysfunction can be further subclassified as total (applying to all odorants) or partial ... sensation of smell begins with introduction of an odorant to the cilia of the bipolar neuron Most odorants are hydrophobic; as they move from the air phase of the nasal cavity to the aqueous phase of...
  • 6
  • 416
  • 1
Chapter 060. Enlargement of Lymph Nodes and Spleen (Part 1) ppsx

Chapter 060. Enlargement of Lymph Nodes and Spleen (Part 1) ppsx

Ngày tải lên : 07/07/2014, 01:20
... lymphadenopathy have nonspecific causes or upper respiratory illnesses (viral or bacterial), and
  • 6
  • 425
  • 0

Xem thêm