2 where the customer has not been physically present for identification purposes a relevant person must take specific and adequate measures to compensate for the higher risk for example by applying one or more of the following measures—
... Park and Dr Mie Hiramoto, for their invaluable guidance and advice And saving the most special for last, my baby girl, Audrina, this one s for you darling Abstract This thesis serves as a contribution ... encounter, and vice versa – thesaurus.com and Roget’s International Thesaurus A word sketch is a one- page, automatic, corpus-derived summary ofa word’s grammatical and collocational behaviour each ... not adequately account forthe communicative impact ofa particular stance, this thesis will incorporate only the notions of Quality and Social Identity Face and exclude those of Equity and Association...
... or as a flow chart for children to expand in full prose • a basic text to be elaborated by vocabulary changes andthe addition of appropriate phrases, forexampleto create anticipation and interest ... coordinator ofa primary or special school and/ orthe appropriate head(s) of department in a secondary school, a member ofthe school’s senior management team (SMT) orthe LA advisory team, or ... affect a learner’s access to learning and limit his or her performance across all areas ofthe curriculum Low attainers, particularly boys, can become demoralised because of technical and organisational...
... (CGGTATTGG CTGCTGAGGTGAGTAAACGTGGTTTGG) and KRD- msAR (CCAAACCACGTTTACTCACCTCAGCAGCCA ATACCG) for KR mutation; RKDmsAF (GCTGCTGAG GTGAGTCGCAAAGGTTTGGTAAAAACG) and RKDmsAR (CGTTTTTACCAAACCTTTGCGACTCACCTC ... (CGTTTTTACCAAACCTTTGCGACTCACCTC AGCAGC) for RK mutation; and KRtoKKDmsAF (GCTGAGGTGAGTAAAAAGGGTTTGGTAAAAACG ACAGCG) and KRtoKKDmsAR (CGCTGTCGTTT TTACCAAACCCTTTTTACTCACCTCAGC) for KK mutation SDS/PAGE and western ... DNA using the primers PCR_AmiA_EcoRI _for (GGCC GAATTCACCATTATGAGCACTTTTA) and PCR_AmiA_EcoRI_rev (GGCCGAATTCGCTGTGTCCGTTGCTG GTT) for AmiA, and PCR_MdoD_EcoRI _for (GGCCGA ATTCACCATTATGGATCGTAGAC)...
... 1995 the dividend declared was $1.69 But what does this really mean? Let us take another example Some would say that if forexample we offer the 50% ormoreofthe corporation's profit tothe stockholders, ... people that closely watch GE's performance, such as creditors and short term investors All of these read our annual reports but at the same time try to find any sort of information about the actions ... possible to keep up with that good name that they have created One can say the effort to that is only related to an attempt, for example, notto create pollution ornotto be guilty of any kind of racist...
... cluster formation at IscA1 andthe variant C4 4A was compared it appeared that the cluster formation was retarded (data not shown) This demonstrates that the cluster formation at the variant C4 4A was ... NP_440066, Athal1 (Arabidopsis thaliana IscA1) AC007067.4, P_purp (Porphyra purpurea) NP_053 827 , Athal2 (Arabidopsis thaliana IscA2) AC005 825 .3, Athal3 (Arabidopsis thaliana IscA3), AC006 921 .5, A_ vinIscA ... GCTACC-3¢) and PRiscA 12 (5¢-GATCTAAGCTTAAA CCCCAAAGGATTTACC-3¢) The resulting 376-bp fragment was cleaved with NdeI and HindIII and cloned into the expression plasmid pRSET 5a [23 ] cleaved with the...
... the America and subtropical regions They can be found from Florida tothe Bahamas, Caribbean Islands and southern Mexico, Central and South America to Argentina [ 122 ] By studying botanical characteristics ... countries as Netherlands, China, Taiwan, Thailand The above results show that the world has had a lot of research work on orchid plants, in general and on the genera of Cattleyas, Dendrobium and Oncidium, ... Lan Cattleya, Dendrobium , Oncidium orchids are very suitable the climate in Southern areas as of its all - year-round warm weather, great sun radiation and long appropriate sunlight for plant...
... (5'TG AAAACTGAACAAAAGAC3') together with oneofthe reverse primers S1OLIGO3' (CTAAACTAACATAAGGG C3') or degenerate3' -2 (5'CCATAAGTAACATAAGGG CAA3') [14,16] The RT reaction for synthesis of cDNA ... bronchitis In: Swayne DE (ed.), A Laboratory Manual forthe Isolation andIdentificationof Avian Pathogens, 4th ed pp 169-173, American Association of Avian Pathologists, Georgia, 1998 Gharaibeh SM ... isolates using the QIAamp MinElute Virus Spin Kit (QIAGEN, USA) Amplification ofthe S1 gene by RT-PCR was performed using oneofthe forward primers S1OLIGO5' (5'TGA AAACTGAACAAAAGA3') or NEWS1OLIGO5'...
... the ability ofa branch to export carbon Figure presents the changes with age in the annual carbon balance CBY of each branch, andthe average for all branches The average behaviour of branches ... and SAsun We assumed that SAsun hasthe same photosynthetic rate as a needle area illuminated bya radiation intensity of Edir/SAsun + Idif , and that SAshade hasa photosynthetic rate equal to ... from one branch to another, although there could be some important differences Maximal value of CBY was not reached at the same age for all the branches (4-6) Forthe same age, the ability of some...
... amongst Canadian family practitioners, who manage the bulk of care for these patients [2] Unfortunately, there remains a large gap between ideal and actual care provided to such patients, making them ... active, andto ensure there is a history with the physician, patients must have at least one visit between 12 and 36 months prior tothe data upload date The EMR data for all remaining physicians are ... using achievable benchmarks for physician feedback: a randomized controlled trial JAMA 20 01, 28 5 (22 ) :28 71 -28 79 32 Sniehotta FF: Towards a theory of intentional behaviour change: plans, planning, and...
... sign rank tests used for matched, and Mann Whitney U for unmatched, data Chi square analyses were used to compare categorical data and all analyses were undertaken using SPSS version 12 [10] or ... that permitted the distribution of citrate also sanctioned the distribution of other injecting paraphernalia (for example, spoons and water), although the distribution of other paraphernalia ... 20 of heroin normally prepared and because packaging a smaller amount would be unfeasible Injectors liked the idea of single use sachets which were also deemed to decrease theriskof contamination...
... Border Kuala Lumpur Kota Kinnabalu Melaka Pulau Langkawi Singapore Genting Highlands Thailand Hong Kong Kuala Lumpur Thailand Cambodia Thailand Penang Langkawi Kuala Lumpur Singapore Pulau Langkawi ... independence to Dr Mahathir; the Mahathir Years and Mahathir’s Aftermath This both acknowledges the significance of Mahathir to Malaysian political history and sets the context for Chapter four The tourism ... ofthe Malay language, the Malay royalty andthe special position ofthe Malays out ofthe political arena.’ Any challenge to these issues was deemed to be treason .20 However, the issue is more...
... features ofthe data and descriptive statistics 5.1 The dataset The data used in this paper are drawn from the China Stock Market and Accounting Research (CSMAR) Database and China Center for ... of market value of tradable stocks, book value of non-tradable stocks, and market value of net debt Tobin's Q: ratio of market value of total assets to book value of total assets Return on assets ... (ROA): ratio of net income to total assets Leverage: ratio ofthe sum of short-term and long-term debt to total assets A Guariglia, J Yang / Journal of Corporate Finance 36 (20 16) 111130 129 Cash:...
... was applied as a reference to combine the SLAs into LGAs MapInfo 9.0 was used as a platform to perform the data linkage, transfer and spatial display Population data in total, by gender and age ... Brisbane City had 163 SLAs in 20 01), and in rural and remote areas that make up the majority of Queensland territory, each LGA is also an SLA The LGA information, including name, code and area (km ... 24 -years for youth and adolescents, 25 to 44-years for young adults, 45 to 64-years for middle-aged adults, and ≥65-years for elderly) at a LGA level, were also collected from CDATA Data analysis...
... Antibacterial and antifungal activities of trappin -2 22 23 24 25 26 27 28 29 30 31 K Baranger et al and pre-elafin (trappin -2) expressed in Pichia pastoris Eur J Biochem 27 1, 23 70 23 78 Latge JP (20 01) The ... Effect of NaCl and heparin on the antibacterial and antifungal activities of trappin -2 The antimicrobial and antifungal activities of trappin -2 are probably due to its cationic nature (net charge ... heparin-Sepharose affinity chromatogra- FEBS Journal 27 5 (20 08) 20 08 20 20 ª 20 08 The Authors Journal compilation ª 20 08 FEBS 20 11 Antibacterial and antifungal activities of trappin -2 K Baranger et al A fumigatus...
... several apartment buildings a shower b demolish c ambush d transfer b 31 There are three kinds of solar eclipses: one is total, another is annular, andathe another is partial b the partial ... out between us a come together b gather together c get together d meet together > b 50 The ball went towards a passing boat It went ofa passing boat a forwards b forward c in the direction ... popular summer resort area a Martha’s Vineyard is b is where Martha’s Vineyard c Martha’s Vineyard d is Martha’s Vineyard > d 28 "What is wood used for? " "It is used for chairs and tables a make...
... mutant CLEC -2 N19 2A, 5'-TTGAGTTTTTGGCCGATGGAAAAGG-3' (sense) and 5'-TCCTTTTCCATCGGCCAAAAACTCA3' (antisense) for mutant CLEC -2 E18 7A, 5'-GTTTTTGGAAGATGGAGCCGGAAATATGAATTGTG-3' (sense) and 5'-AATTCATATTTCCGGCTCCATCTTCCAAAA3' ... 5'-AATTCATATTTCCGGCTCCATCTTCCAAAA3' (antisense) for mutant CLEC -2 K19 0A, 5'-GCAACATTG TGGAATATATTGCGGCGCGCACCCATCTGATTC-3' (sense) and 5'-GCGCCGCAATATATT CCACAATG-3' (antisense) for mutant CLEC -2 K15 0A ... "TTCAAGAGA" and an antisense shRNA sequence followed bya pol III terminator sequence The shRNA was constructed by annealing shRNA137sense_BamHI: 5'GATCCGCGAAGATGAT GTGGTGACTTTCAAGAGAAGTCACC ACATCATCTTCGTTTTTTACGCGTG3'...
... quần thể, Allee a qui luật phân bố quần tụ (aggregation) b) Qui luật quần tụ (nguyên tắc Allee) Quan hệ cá thể quần thể quan hệ hỗ trợ quan hệ đấu tranh (trực tiếp hay gián tiếp) Mối quan hệ sinh ... nhân thiên tai, dịch bệnh hay hoạt động ngời (nh trờng hợp năm 1859 nhập 12 đôi thỏ châu Âu vào trại chăn nuôi Victoria, năm sau số lợng chúng tràn ngập lãnh thổ hai vùng Quinslan nam úc, đến ... sâu (Anthonomus agrandis) Texaz chịu chi phố độ ẩm tơng đối, nhiệt độ độ mây vào tháng tháng Nhìn chung, động vật, thời giannhạy cảm thờng trùng với m a sinh sản vào giai đoạn sơ sinh Ngoài ra,...
... edge ofthe bed and handed her a cracker Emily took it and looked at it fora while before taking a tiny bite “You‟re going to have to better than that.” “If it stays down, I‟ll take another,” ... away,” she said again “If you need me, just call,” he told her as he left hesitantly Chevalier stepped into the ante-chamber and told Anna to leave Emily alone, then went down to his office and ... chuckling She took another bite and then sighed, “Please go away.” He looked at her and raised an eyebrow, “What if I say no?” She glared at him and he again found the restraint notto laugh “You‟re...
... Metaphor foremotions +HAPPY-AS-UP+ metaphor Metaphor for aspects of anger ex Myspiritsrose Metaphor for anger cause of anger Metaphor for aspects of romanticlove Metaphor for aspects of sexualdesire ... regarded as metaphorical, lies in the fact that they deviate from the standard, most straightforward realization ofa command by means ofthe imperative mood Their metaphorical nature can be made ... process (a verb, fail, and its participants, He + the exam) is not realized by means ofa clause, but rather by means of another type of form, such as a noun phrase, as in theexample at hand In...
... gia chủ thể QHQT quan trọng 18 Các vấn đề tranh luận • Quốc gia chủ thểthể (Unitary Actor) hoạt động QHQT mình? • Quốc gia chủ thể có lý trí (Rational Actor) sách đối ngoại? • Vai trò Quốc gia ... BÀI 2: CHỦ THỂ QHQT KHÁI NIỆM VÀ PHÂN LOẠI CHỦ THỂ QHQT QUỐC GIA 2. 1 Khái niệm Quốc gia 2.2 Chủ quyền Quốc gia 2. 3 Lợi ích Quốc gia 2. 4 Vai trò chủ thể QHQT quốc gia 2. 1 Khái niệm Quốc gia (State) ... (Intergovernmental Organization - IGO) - TCQT tư (private) có thành viên cá nhân nhóm Trên góc độ QHQT, TCQT phi phủ (International Nongovernmental Organization - INGO) 25 TCQT liên phủ (IGO) UN NATO EU WTO...