2 species diversity has provided humans with so many essential things 3 there are a number of ways to help save endangered species line paragraph eg line 1 2 paragraph 1

Slide tiếng anh 10 unit 6 an excursion _reading _Tua Chua high school

Slide tiếng anh 10 unit 6 an excursion _reading _Tua Chua high school

Ngày tải lên : 26/05/2015, 17:00
... interesting At first, we wanted to travel to Thay Pagoda because it is only over 20 kilometers away, and we could go on a day excursion However, only today we have learnt that the caves near Thay Pagoda ... read Task 1: Expected answer Set the scene You are going to read a letter from Lan to her friend, Minh about her excursion to a cave near Ha noi Read the letter and the tasks that follow Thay ... Pagoda are closed until after Tet So we are visiting the ones near Huong Pagoda instead A night campfire on a two-day trip will be a great event in our schooldays! To make the trip cheap, we are...
  • 29
  • 1.6K
  • 0
Báo cáo khoa học: " A case report of pseudoprogression followed by complete remission after proton-beam irradiation for a low-grade glioma in a teenager: the value of dynamic contrast-enhanced MRI" pptx

Báo cáo khoa học: " A case report of pseudoprogression followed by complete remission after proton-beam irradiation for a low-grade glioma in a teenager: the value of dynamic contrast-enhanced MRI" pptx

Ngày tải lên : 09/08/2014, 10:20
... Associations among Magnetic Resonance Spectroscopy, Apparent Diffusion Coefficients, and Image-Guided Histopathology with Special Attention to Radiation Necrosis Neurosurgery 20 04, 54 :11 11- 111 9 ... 54 :11 11- 111 9 Terakawa Y, Tsuyuguchi N, Iwai Y, Yamanaka K, Higashiyama S, Takami T, Ohata K: Diagnostic accuracy of 11 C-methionine PET for differentiation of recurrent brain tumors from radiation ... medulloblastoma recurrence or progression after conventional chemotherapy Cancer 20 07, 11 0 :15 6- 63 13 Spreafico F, Gandola L, Marchiano A, Simonetti F, Poggi G, Adduci A, Clerici CA, Luksch R, Biassoni...
  • 5
  • 425
  • 0
Tài liệu Implementing an Operator In the following exercise, you will complete another Microsoft Windows doc

Tài liệu Implementing an Operator In the following exercise, you will complete another Microsoft Windows doc

Ngày tải lên : 21/01/2014, 15:20
... Code and Text Editor window, implement a version of operator== that accepts a Minute as its left-hand operand and an int as its right-hand operand Don't forget that the return type of this operator ... requires a mat ching operator "!=" to also be defined There is a still an error The problem is that you have implemented a version of operator== but have not implemented its required operator!= partner ... Implement a version of operator!= that accepts a Minute as its left-hand operand and an int as its right-hand operand The completed operator should look exactly like this: struct Minute { public static...
  • 3
  • 378
  • 0
The graphs below show the types of music albums purchased by people in Britain according to s3x and age doc

The graphs below show the types of music albums purchased by people in Britain according to s3x and age doc

Ngày tải lên : 07/07/2014, 12:20
... also drops off after the age of 35 with an even sharper fall from age 45 onwards, a pattern which is the opposite to the classical music graph You should spend about 20 minutes on this task ... 20 % of the population continuing to buy pop CDs after the age of 45 The interest in rock music reaches its peak among the 25 to 34 year olds, though it never sells as well as pop Interest also ... than men buy pop music, the rock market is dominated by men with 30 % buying rock, compared to 17 % of women From the first graph we see that interest in pop music is steady from age 16 to 44 with...
  • 2
  • 639
  • 0
Exercise 1: Choose the best answer for each sentence below. ppt

Exercise 1: Choose the best answer for each sentence below. ppt

Ngày tải lên : 01/08/2014, 11:22
... her acceptance A to wait B waiting C wait D waited 12 Don’t be afraid of _ that animal A touch B touches C touching D to touch 13 I am accustomed to _ on my own A living B to live C live ... _ to John ask him _ us? A speaking / to help B to speak / help C speak / help D speaks / to help 15 I’ll begin _ this novel later A read B to reading C reading D to read 16 Please stop ... have C having D had 11 He is expecting _ a trip to Ha Long Bay A make B to make C making D made 12 I regret _ you that you fail the test A to tell B telling C tell D told 13 Is there anything...
  • 10
  • 2.5K
  • 9
Complete the second sentence so that means the same as the first

Complete the second sentence so that means the same as the first

Ngày tải lên : 23/08/2015, 07:24
... increasing number of cars has caused serious air pollution Air pollution has been caused by the creasing number of cars 30 “ What does it mean to you?” Rosemary asked me Rosemary wanted to know what ... come 27 He offered ma a glass of wine “Would you like a glass of wine?”, he said 28 They changed their plan because the weather was bad Due to bad weather, they changed their plan 29 The increasing ... work 20 “Don’t walk on the grass”, the gardener said to us The gardener told us not to walk on the grass 21 Somebody repaired her car yesterday She had her car repaired 22 You must see the manager...
  • 2
  • 1.1K
  • 2
after you by jojo moyes epub1988358206 pdf

after you by jojo moyes epub1988358206 pdf

Ngày tải lên : 25/08/2016, 11:30
... back again a few days later.’ I lean against the door to prop it open These lavatories never smell any better by the evening ‘And anyway, personally, I think there are worse things that can happen ... beam scanning the dark for some vanished miscreant in a local park Somewhere in the distance a siren Always a siren ‘Won’t take much to make this feel like home,’ the estate agent had said I had ... need anything? Are you comfortable? What can I get you?’ She talks so fast that I cannot answer ‘We came as soon as they said Treena’s looking after Granddad He sends his love Well, he sort of made...
  • 834
  • 387
  • 0
Báo cáo y học: "Placenta Percreta-Induced Uterine Rupture Diagnosed By Laparoscopy in the First Trimester"

Báo cáo y học: "Placenta Percreta-Induced Uterine Rupture Diagnosed By Laparoscopy in the First Trimester"

Ngày tải lên : 25/10/2012, 10:56
... hemoperitoneum: uterine rupture at weeks gestational age J Emerg Med 20 07 ;33 :28 5-7 http://www.medsci.org Int J Med Sci 20 11 , 8 10 11 12 13 14 15 16 17 18 19 427 Schrinsky DC, Benson RC Rupture of ... rupture of unscarred uterus in early pregnancy a rare entity Acta Obstet Gynecol Scand 20 00;79: 4 31 -2 Matsuo K, Shimoya K, Shinkai T, et al Uterine rupture of cesarean scar related to spontaneous abortion ... pregnant uterus: a review Obstet Gynecol Surv 19 78 ;33 : 21 7- 32 Helkjaer PE, Petersen PL [Rupture of the uterus in the 11 th week of pregnancy] Ugeskr Laeger 19 82; 14 4 :38 36-7 Singh A, Jain S Spontaneous...
  • 4
  • 503
  • 0
Can you read UNIT 1 LOP 5

Can you read UNIT 1 LOP 5

Ngày tải lên : 29/09/2013, 17:10
... töø coù vaàn -at, -an, -ap Friday, October 20 10 st Let’s Read ( cont) Can you read ? The fat cat is in the hat The can and the fan are on the van The cap and the map are on my lap Practice in ... books to page Listen and point to the pictures on page The fat cat is in the hat The can and the fan are on the van The cap and the map are on my lap This is a fat cat Learn by heart and rewrite ... The cap and the map are on my lap This is a fat cat Learn by heart and rewrite the sentences on page Do the WB B/8 ...
  • 19
  • 462
  • 0
An analysis of nouns formed by suffixes in english   a case study of the textbook solutions   pre intermedite

An analysis of nouns formed by suffixes in english a case study of the textbook solutions pre intermedite

Ngày tải lên : 14/12/2013, 16:45
... data of the survey for English non-majors at Haiphong Private University 21 68 70 64 60 56 60 50 50 46 42 44 40 40 46 44 34 36 34 32 28 30 22 28 20 16 12 10 0 18 d 18 16 10 10 b c 20 16 20 32 30 ... 40 40 30 30 30 30 30 30 b 30 30 20 20 c 20 20 10 10 10 10 10 a d 10 10 0 00 00 00 00 10 There are 10 English lecturers who take part in this survey 40% of the lecturers teach level 3, 50% of them ... exclusively to female humans and animals Eg:  Lion (Noun): a large powerful animal of the cat family that hunts in group and lives in parts of Africa and southern Asia  Lioness (Noun): a female lion 15 ...
  • 63
  • 988
  • 3
Tài liệu Báo cáo khoa học: Modulation of a-synuclein aggregation by dopamine in the presence of MPTP and its metabolite pptx

Tài liệu Báo cáo khoa học: Modulation of a-synuclein aggregation by dopamine in the presence of MPTP and its metabolite pptx

Ngày tải lên : 14/02/2014, 19:20
... on 1- methyl-4-phenyl -1 ,2, 3, 6-tetrahydropyridine FEBS Journal 27 8 (20 11 ) 16 88 16 98 ª 20 11 The Authors Journal compilation ª 20 11 FEBS 16 97 Modulation of a- synuclein aggregation 29 30 31 32 33 34 ... aggregation Modulation of a- synuclein aggregation 17 18 19 20 21 22 23 24 25 26 27 28 by intracellular nitrative insult J Neurosci 21 , 80 53 80 61 Norris EH, Giasson BI, Hodara R, Xu S, Trojanowski JQ, ... were withdrawn at different time intervals FEBS Journal 27 8 (20 11 ) 16 88 16 98 ª 20 11 The Authors Journal compilation ª 20 11 FEBS 16 89 Modulation of a- synuclein aggregation P N Jethva et al and analysed...
  • 11
  • 754
  • 0
Tài liệu Do you qualify for the disabilityelement of Working Tax Credit? pdf

Tài liệu Do you qualify for the disabilityelement of Working Tax Credit? pdf

Ngày tải lên : 15/02/2014, 14:20
... registered as blind or partially sighted on a register maintained by, or on behalf of, a Health and Social Services Board • You cannot see to read 16 point print at a distance greater than 20 ... for a period of 28 weeks immediately preceding that day (see Note on page 12 ) Or Have received ESA for a period of 14 0 qualifying days, with the last day of receipt falling within the 56 days ... page 12 ) and your disability is likely to last for at least six months or the rest of your life and your gross earnings are at least 20 % less than they were before the disability began, with a...
  • 12
  • 407
  • 0
Tài liệu Báo cáo khoa học: Reversible tetramerization of human TK1 to the high catalytic efficient form is induced by pyrophosphate, in addition to tripolyphosphates, or high enzyme concentration ppt

Tài liệu Báo cáo khoa học: Reversible tetramerization of human TK1 to the high catalytic efficient form is induced by pyrophosphate, in addition to tripolyphosphates, or high enzyme concentration ppt

Ngày tải lên : 18/02/2014, 12:20
... NaPP-MgCl2 NaP-MgCl2 57.5 ± 2. 7a (5) 11 5 ± 4.5 (5) 10 1 95.5 10 0 11 8 52. 7 93 98 1 03 48.9 16 .4 0. 51 0.68 0.79 0.64 0.66 21 .3 0.95 0.90 0. 73 14 .2 0.75 1. 04 0.97 0.98 1. 02 0.99 0.77 1 . 31 0.97 0. 92 ... forms of human cytosolic thymidine kinase with FEBS Journal 27 6 (20 09) 5 71 580 ª 20 08 The Author Journal compilation ª 20 08 FEBS 579 Enzymatic regulation of human TK1 13 14 15 16 17 18 19 20 580 ... 0.04 0. 01 0.04 0. 01 0. 01 0.08 0.08 0 .14 0. 12 (10 ) (10 ) (3) (3) (3) (3) (3) (2) (2) (2) (2) 0 .1 0.8 Values are means ± SEM, with the number of independent experiments in parentheses b Phosphate donor...
  • 10
  • 647
  • 0
Tài liệu Báo cáo khoa học: The Ets transcription factor ESE-1 mediates induction of the COX-2 gene by LPS in monocytes doc

Tài liệu Báo cáo khoa học: The Ets transcription factor ESE-1 mediates induction of the COX-2 gene by LPS in monocytes doc

Ngày tải lên : 19/02/2014, 17:20
... transcriptional regulation of cyclooxygenase -2 expression by CpG DNA: role of NF-kappaB and p38 J Biol Chem 27 8, 22 5 63 22 5 73 15 Teruyama K, Abe M, Nakano T, Iwasaka-Yagi C, Takahashi S, Yamada S & Sato ... 5¢-CAGTCTTATAAAAACCAA GGTTCTCTCGGTTAGCGACC -3 ; (c) COX -2 promoter Ets site #3, 5¢-GACGAAATGACTGTTTCTTTGAGCC TTTTCGTACCCC -3 ; (d) COX -2 promoter Ets site #4, 5¢-AGGGGAGAGGAGGGTTAAATTTGTGGGGGGTA CGAAAAGGCGG -3 ; ... For hGAPDH forward, 5¢-CAAAGTTGTCATG 16 84 F T Grall et al GATGACC -3 ; reverse, 5¢-CCATGGAGAAGGCTGGG G -3 , which will amplify 19 5 bp of human GAPDH For Cox2 forward, 5¢-TTCAAATGAGATTGTGGGAAAA TTGCT -3 ;...
  • 12
  • 519
  • 0
Tài liệu Báo cáo khoa học: "Sentence Disambiguation by a Shift-Reduce Parsing Technique" pot

Tài liệu Báo cáo khoa học: "Sentence Disambiguation by a Shift-Reduce Parsing Technique" pot

Ngày tải lên : 21/02/2014, 20:20
... the top of the stack and replaces them with a new element for instance, removing an N P and a V P from the top of the stack and replacing them with an S The state of the parser is also updated ... accordance with the shift-reduce table at each stage The combination of the stack, input, and state of the parser will be called a configuration and will be notated as, for example, Right Association ... table mentioned above is generated automatically from a context-free grammar by the standard algorithm [Aho and Johnson, 19 74] The parsing alogrithm differs, however, from the standard LALR (1) ...
  • 6
  • 396
  • 0
Tài liệu Báo cáo Y học: The binding of lamin B receptor to chromatin is regulated by phosphorylation in the RS region ppt

Tài liệu Báo cáo Y học: The binding of lamin B receptor to chromatin is regulated by phosphorylation in the RS region ppt

Ngày tải lên : 22/02/2014, 04:20
... Biochem 12 0 , 1 53 15 9 30 Inagaki, M., Kawamoto, S., Itoh, H., Saitoh, M., Hagiwara, M., Takahashi, J & Hidaka, H (19 86) Naphthalenesulfonamides as calmodulin antagonists and protein kinase inhibitors ... 15 16 17 18 19 20 21 22 23 24 25 26 27 LAP 210 proteins alter lamina assembly, envelope formation, nuclear size, and DNA replication efficiency in Xenopus laevis extracts J Cell Biol 14 4, 10 83 10 96 ... capable of associating with chromatin J Cell Sci 11 0, 6 43 6 51 10 Gant, T.M., Harris, C .A & Wilson, K.L (19 99) Roles of LAP2 proteins in nuclear assembly and DNA replication: truncated 11 12 13 14 15 ...
  • 11
  • 563
  • 0
Báo cáo khoa học: Suppression of a cold-sensitive mutant initiation factor 1 by alterations in the 23S rRNA maturation region pdf

Báo cáo khoa học: Suppression of a cold-sensitive mutant initiation factor 1 by alterations in the 23S rRNA maturation region pdf

Ngày tải lên : 06/03/2014, 00:21
... GTCGGATC CGCGGATCAGGTGGGGATGTATTA; rnc5¢I comp, GGCAGTGGATGATGGGGTTCATGCGATACC; rnc3¢O SalI, TGCGTCGACATTTGCCGCAATAGTGTCAACA; and rnc3¢I comp, TGAACCCCATCATCCACTGCCAG GTCAGCG The deletion was constructed ... traces) Finally, when traces of the rnc lesion strain (JB69Drnc) were examined, it was apparent that there FEBS Journal 27 8 (20 11 ) 17 45 17 56 ª 20 11 The Authors Journal compilation ª 20 11 FEBS 17 49 ... follows: era_F_NcoI, CGACCATGGCGAAC AGGCGTTGAAAAAAC; and era_R_SalI, CGAGTCGA CAGCCTTCCATCGGAGTTACT The resulting vector 17 54 Selection of second-site rRNA suppressors of cold-sensitive IF1 A direct...
  • 12
  • 439
  • 0

Xem thêm