2 3 dioxygenase and regulatory t cells

Báo cáo y học: "Indoleamine 2,3-dioxygenase-expressing dendritic cells are involved in the generation of CD4+CD25+ regulatory T cells in Peyer''''s patches in an orally tolerized, collagen-induced arthritis mouse model" ppt

Ngày tải lên : 09/08/2014, 10:22

... (5'-CACTGTACCAGTGCAGTAG -3' ) and antisense (5'-ACCATTCACACACT CGTTAT -3' ) primers, and using Foxp3 sense (5'-CAGCTGCCTACAGTGCCCCTAG -3' ) and antisense (5'CATTTGCCACGAGTGGGTAG -3' ) primers PCR products ... George TC, Norment A, Viney JL: Mucosal CD8α+ DC, with a plasmacytoid phenotype, induce differentiation and Page 10 of 10 (page number not for citation purposes) 22 23 24 25 26 27 28 29 30 31 32 33 ... regulatory effects on T cells that are mediated by tryptophan depletion and by the production of metabolic byproducts collectively known as kynurenines [16 ,21 ,22 ] Demonstrating the concomitant induction...

10
473
0

báo cáo hóa học:" In vitro generation of cytotoxic and regulatory T cells by fusions of human dendritic cells and hepatocellular carcinoma cells" docx

Ngày tải lên : 18/06/2014, 15:20

... caspase -3 [36 ,37 ] The fusion cells could prime naive T cells to differentiate into CTL with lytic activity against the HCC cells (Figure 3A and 3B) After hr coculture of the HCC cells with healthy ... http://www.translational-medicine.com/content/6/1/51 Figure The ability of vaccination with autologous FCs to stimulate T cells The ability of vaccination with autologous FCs to stimulate T cells ... Translational Medicine 20 08, 6:51 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 Celluzzi CM, Mayordomo JI, Storkus WJ, Lotze MT Jr, Falo LD: Peptide-pulsed dendritic cells induce antigen-specific...

19
459
0

báo cáo khoa học: "Upregulated expression of indoleamine 2, 3-dioxygenase in CHO cells induces apoptosis of competent T cells and increases proportion of Treg cells" pptx

Ngày tải lên : 10/08/2014, 10:21

... 5’AGATCTGCCACCATGGCACACGCTATGGAAAAC3’, and antisense 5’-GTCGACTTAACCTTCCTTCAAAAGGGATTTC -3 The PCR products were inserted into the pMD19 -T Simple Vector (Takara) using TA-cloning procedures, and ... Representative FACS scatter plots of CD3 +T cells apoptosis 72 h after culture with 20 0 U/ml human recombinant IL -2 (B) Representative FACS scatter plots of CD3 +T cells apoptosis 72 h after co-culture ... of the Foxp3 and b-actin gray scale ratios in CD3+ T cells cocultured with IDO+ CHO cells, CD3+ T cells and CD3+ T cells co-cultured with CHO/EGFP cells were 0.5567 ± 0. 127 1, 0. 32 8 3 ± 0.1 530 and...

10
299
0

Tài liệu Báo cáo Y học: A novel meta-cleavage dioxygenase that cleaves a carboxyl-groupsubstituted 2-aminophenol Puriﬁcation and characterization of 4-amino-3-hydroxybenzoate 2,3-dioxygenase from Bordetella sp. strain 10d doc

Ngày tải lên : 21/02/2014, 01:21

... C content of deoxyribonucleic acid by 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 high-performance liquid chromatography Int J Syst Bacteriol 39 , 159–167 Moss, C.W & Guerrant, G.O (19 83) Separation ... smaller than that of well-known extradiol dioxygenases, such as catechol 2, 3- dioxygenase [2] , protocatechuate 2, 3- dioxygenase [31 ], protocatechuate 4,5 -dioxygenase [ 32 ] and 2- aminophenol 1,6 -dioxygenase ... acid, except for protocatechuate 2, 3dioxygenase, which has, with this substrate, 4.5% of the activity of 4-amino -3- hydroxybenzoate 2, 3- dioxygenase Protocatechuate 2, 3- dioxygenase oxidizes the primary...

7
490
0

Báo cáo khoa học: The role of residue Thr249 in modulating the catalytic efﬁciency and substrate speciﬁcity of catechol-2,3-dioxygenase from Pseudomonas stutzeri OX1 ppt

Ngày tải lên : 30/03/2014, 10:20

... this substitution is 14 A from the catalytic iron atom, it is likely that the active sites of the two C2,3Os are structurally identical and that the crystal structure of P putida MT2 C2,3O (PDB accession ... that control the substrate speciﬁcity of P stutzeri C2,3O offers an opportunity to develop molecular strategies aimed at adjusting the active site pocket of C2,3O to control the products of the ... positioning of catechols in the active site of C2,3O The available data suggest that the two structures (Fig 2A,B) repre- Thr249 in catechol -2, 3- dioxygenase function sent the catalytically competent...

14
411
0

báo cáo hóa học:" Generation in vivo of peptide-specific cytotoxic T cells and presence of regulatory T cells during vaccination with hTERT (class I and II) peptide-pulsed DCs" pot

Ngày tải lên : 18/06/2014, 15:20

... CD14(+) monocytes to generate dendritic cells for cancer http://www.translational-medicine.com/content/7/1/18 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 immunotherapy: A phase I study Journal ... Vaccination time point (V) PSA Post-response (μg/L) Vaccination time point (V) Percentage reduction N004 N010 N010 L0 03 L005 L005 23 20 27 98 32 1 8 23 2 465 639 V0 V1 V3 V7 V2 V4 20 30 121 8 24 39 20 6 429 ... Cytotoxicity of In Vivo Generated T Cells T2 -cytotoxicity Cumulative cytotoxicity results for all patient samples show that after two cycles of vaccination (the time point associated with the...

23
439
0

Báo cáo y học: "A paragon of self-tolerance: CD25+CD4+ regulatory T cells and the control of immune responses" pps

Ngày tải lên : 09/08/2014, 01:23

... apparently FOXP3–) after anti-CD3/anti-CD28 stimulation [36 ] It remains to be determined whether this simply represents an expansion to detectability of the tiny Foxp3+GITR+CD25–CD4+ population ... 18: 7 23 - 737 21 22 Bluestone JA, Abbas AK: Natural versus adaptive regulatory T cells Nat Rev Immunol 20 03, 3 :25 3 -25 7 Nishizuka Y, Sakakura T: Thymus and reproduction: sex-linked dysgenesia of the ... essential role for Scurfin in CD4+CD25+ T regulatory cells Nat Immunol 20 03, 4: 33 7 -3 42 26 Hori S, Nomura T, Sakaguchi S: Control of regulatory T cell development by the transcription factor Foxp3...

7
576
0

Báo cáo y học: "Regulating the immune system: the induction of regulatory T cells in the periphery Jane H Buckner1 and Steven F Ziegler2" pot

Ngày tải lên : 09/08/2014, 01:24

... adaptive regulatory T cells Nat Rev Immunol 20 03, 3 :25 3 -25 7 Fontenot JD, Gavin MA, Rudensky AY: Foxp3 programs the development and function of CD4+CD25+ regulatory T cells Nat Immunol 20 03, 4 :33 0 -33 6 ... death, TR cells lead to the induction of T regulator (Tr1) cells and Th3 cells, which feed back to inhibit inflammation, and the TR cells inhibit proliferation of antigen-specific and bystander ... gamma, and no IL -2 or IL-4 [ 13 ,22 ] CD4+ T cells with this phenotype are referred to as Tr1 cells Available online http://arthritis-research.com/content/6/5 /21 5 In spite of the fact that Tr1 cells...

8
478
0

Báo cáo y học: "The potential of human regulatory T cells generated ex vivo as a treatment for lupus and other chronic inflammatory diseases" pot

Ngày tải lên : 09/08/2014, 03:24

... helminth infection is mediated by Th3/ Tr1-type cytokines IL-10 and transforming growth factor-beta but not by a Th1 to Th2 shift Int Immunol 20 00, 12: 6 23 - 630 31 Zeller JC, Panoskaltsis-Mortari ... suppressive activities In parallel, other groups have observed that TGF-β inhibits the differentiation of T cells to Th1 or Th2 subsets [36 ,37 ] The initial observation that TGF-β is an IL -2- dependent differentiation ... regulatory CD4+ cells by repeatedly stimulating with the antigen in the presence of IL-10 [ 23 26 ], or using immature antigen-presenting cells that lack potent costimulatory activity [27 ] These regulatory...

6
408
0

Báo cáo y học: "The role of regulatory T cells in antigen-induced arthritis: aggravation of arthritis after depletion and amelioration after transfer of CD4+CD25+ T cells" doc

Ngày tải lên : 09/08/2014, 06:22

... RR, Toes RE: R300 20 21 22 23 24 25 26 27 28 29 30 31 32 33 CD25+ cell depletion hastens the onset of severe disease in collagen-induced arthritis Arthritis Rheum 20 03, 48:14 52- 1460 Bardos T, ... of Treg cells [37 ] With this in mind, it could be interesting to investigate whether the accumulated Treg cells in patients with arthritis function properly in vivo and whether these patients ... http://arthritis-research.com/content/7 /2/ R291 anti-αEβ7-biotin and streptavidin-PE The stained cells were enriched with anti-FITC and anti-PE MicroBeads, using the AutoMACS separation unit (Miltenyi Biotech) Thereafter, the...

11
440
0

Báo cáo y học: "β Transforming growth factor-β-induced regulatory T cells referee inflammatory and autoimmune diseases" potx

Ngày tải lên : 09/08/2014, 06:22

... abnormalities have been attributed, at least partly, to defective production and function of TGF-β [ 12, 66] In contrast to strong suspicions, few data yet exist as to whether the uncontrolled T and ... regulatory T cells by oral antigen administration J Immunol 20 01, 167: 424 5- 425 3 30 Khalil N: TGF-beta: from latent to active Microbes Infect 1999, 1: 125 5- 126 3 31 Oklu R, Hesketh R: The latent ... co-cultured with TCR-activated CD4+CD25– responder T cells, there is a rapid engagement of this intracellular signaling pathway that is consistent with TGF-β as the link between these two cells and the...

7
311
0

Báo cáo y học: "Role of regulatory T cells in experimental arthritis and implications for clinical use" potx

Ngày tải lên : 09/08/2014, 06:23

... C: Isolation and functional characterization of regulatory CD25brightCD4+ T cells from the target organ of patients with rheumatoid arthritis Eur J Immunol 20 03, 33 :21 5 -22 3 Cao D, van Vollenhoven ... before treatment with anti-TNF-α were unable to suppress proinflammatory cytokine secretion from activated T cells and monocytes After anti-TNF-α treatment the ‘hibernated’ peripheral blood CD4+CD25+ ... treatment decreases the infiltrate in joints Furthermore, RA patients relapse shortly after withdrawal of anti-TNF-α [19] and thus, despite the dampening of joint inflammation and the reinstatement...

3
336
0

Báo cáo y học: "Regulatory T cells in systemic lupus erythematosus: past, present and future" pot

Ngày tải lên : 09/08/2014, 13:22

... Fas-intact MRL mice display 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 TCR-mediated hyperproliferation due to intrinsic threshold defects in activation J Immunol 20 05, 174:5100-5109 Monk ... intact in cultures without antigen-presenting cells The functional activity of both patient and healthy control Tregs, however, was decreased in the presence of the patient’s antigen-presenting ... induce Foxp3+CD4+ and/ or Foxp3+CD8+ regulatory T cells that produce transforming growth factor beta and suppress the development of lupus [ 32 - 37 ] The tolerogenic peptides generate tolerogenic transforming...

9
295
0

Báo cáo y học: "Japanese Encephalitis Virus wild strain infection suppresses dendritic cells maturation and function, and causes the expansion of regulatory T cells" doc

Ngày tải lên : 11/08/2014, 21:21

... replication DCs infected with P3 attenuated allostimulatory activities to T cells To test whether P3 infection will impair the ability of DCs to activate allogeneic naïve T cells, the direct effect ... allogeneic immature human dendritic cells J Exp Med 20 00, 1 92: 121 3- 122 2 30 Tarbell KV, Yamazaki S, Steinman RM: The inter-actions of dendritic cells with antigen-specific, regulatory T cells that suppress ... 11 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 alloantigen-specific Foxp3+ CD25+ CD4+ regulatory T cells by dendritic cells during the mixed leukocyte reaction Proc Natl Acad Sci USA 20 06,...

11
252
0

Báo cáo y học: " CD39+ Regulatory T cells suppress generation and differentiation of Th17 cells in human malignant pleural effusion via a LAP-dependent mechanism" pps

Ngày tải lên : 12/08/2014, 13:22

... by the other groups [15 ,22 -24 ] that Tregs can differentiate into Th17 cells In the animal studies, the development and differentiation of Th17 cells was described to be linked to that of Tregs ... found that the purified CD39 + CD4 + CD25 high T cells were almost FOXP3 positive and were almost CD 127 negative, indicating that these T cells were Tregs The most important finding in the present ... (Figure 3) , suggesting that these proinflammatory cytokines might affect the generation and differentiation of Tregs or /and Th17 cells in MPE To evaluate the contribution of cytokines to the numbers...

10
440
0

Báo cáo y học: "Isolated receptor binding domains of HTLV-1 and HTLV-2 envelopes bind Glut-1 on activated CD4+ and CD8+ T cells" pot

Ngày tải lên : 13/08/2014, 09:21

... CB: Activated Akt promotes increased resting T cell size, CD28-independent T cell growth, and development of autoimmunity and lymphoma Eur J Immunol 20 03, 33 (8) :22 23 -22 32 Rathmell JC, Vander ... not recognize endogenous Glut-1 on these cells Notably, the ability of HTLV-1 and HTLV -2 derived RBDs to bind to parental and transfected 29 3T cells correlated with the data obtained using the ... transporters transfection of the GlutAntibody Antibody and HRBD binding following transfection of the Glut-1 and Glut -3 glucose transporters (A) 29 3T cells were transfected with Glut-1 or Glut -3 expression...

9
283
0

Báo cáo y học: "Signatures of human regulatory T cells: an encounter with old friends and new" pdf

Ngày tải lên : 14/08/2014, 16:21

... AGG GTC TCC GCG GGG TCA CAT -3' TNFRSF1B 5'-GTA GCC TTG CCC GGA TTC TGG -3' 5'-ACC CTG CCC CTG CTC TGC TA -3' TRAF1 5'-GGG GCA TAA ACT TTC CTC TTC C -3' 5'-TTT GGG GTT ATA CAT TGC TCA GTG -3' LGALS3 ... CTLA4 5'-TGC AGC AGT TAG TTC GGG GTT GTT -3' 5'-CTG GCT CTG TTG GGG GCA TTT TC -3' CCR7 5'-TGG CCT GCA GGA AAC ACC -3' 5'-GGG AGA CTT CTT GGC TTG GTG AG -3' RPS9 5'-CGC AGG CGC AGA CGG TGG AAG C -3' 5'-CGA ... S100A4 is hypothesized to control tetramerization of TP 53, leading to its nuclear translocation [ 32 , 33 ] TP 53 can activate the extrinsic apoptotic pathway through the induction of TNF receptor family...

18
389
0

Báo cáo sinh học: " Protection against the allergic airway inflammation depends on the modulation of spleen dendritic cell function and induction of regulatory T cells in mice" docx

Ngày tải lên : 14/08/2014, 19:22

... from the peripheral blood were detected by flow cytometry After autologous CD4+ and CD8+ T cells were stimulated with the targeted DCs, the Wang et al Genetic Vaccines and Therapy 20 10, 8 :2 http://www.gvt-journal.com/content/8/1 /2 ... and Foxp3+Tregs prevents the generation and activation of Th2 effector cells as a novel pathway of regulation of type immunity in asthma Competing interests The authors declare that they have ... Tregs in the further studies Wang et al Genetic Vaccines and Therapy 20 10, 8 :2 http://www.gvt-journal.com/content/8/1 /2 A great number of studies have shown that the targeting of antigens to DC...

8
258
0

Tài liệu Lab 4.2.3 Suspending and Disconnecting Telnet Sessions docx

Ngày tải lên : 11/12/2013, 14:15

... routers Ping the serial interface of the Birmingham router If the ping is not successful, return to Step and troubleshoot the configuration Step Telnet to a remote router a Enter telnet router-name ... Step Look at the interfaces on the remote router a Enter show interface at the router prompt b Are both the serial and the FastEthernet interfaces up? _ Step Suspend the current Telnet ... IP host tables were configured Otherwise, enter the IP address at the router prompt to connect to a remote router Enter the password cisco to enter the router b What prompt did the router display?...

4
544
4