... ratio ˜ Uw of the actual number of users of word w (Uw ) over ˜ the expected number of users of w (Uw ), and DT = Tw ˜ is calculated analogously fo the actual/expected Tw ˜ ˜ number of threads ... in one of the Germanand English CELEX wordlists are automatically classified as such This improved classifier results over tokens and types, as seen in Table in the comparison of token and type ... sequences of two prefixes and/ or three suffixes Our list of affixes was built 136 from commonly-affixed stems in the MZEE corpus and a German grammar (Fagan, 2009) Compound-cutting Nominal and adjectival...
... approximation of how much a dictionary user can understand of the lexical content of the newspaper text In the case of non-related lemmas, one of them is usually much more frequent (as with avto and avt), ... institution was supported by grants from the Ministry of Education, Science and Sport of the Republic of Slovenia and from the DAAD (DAAD Doktorandenstipendium im Rahmen des gemeinsamen Hochschulsonderprogramms ... Not covered lemmas and lemma sets least one of the alternative lemmas is unmarked, the underlying word form will be counted as covered Tables and show parts of the sorted result of the marking procedure...
... six classes of cytosolic GSTs in insects [2] The majority of GSTs are in the Delta and Epsilon classes, and the remaining enzymes are in the Omega, Sigma, Theta and Zeta classes The German cockroach ... by Edman degradation and from reported GST sequences of N lugens, Bo mori and M sexta [17–19] The 50 lL PCR reaction mixture contained 20 ng of first-strand cDNA, 0.5 nmol of forward primer [5¢CTGCCCGGATCTGCTCCCTGC(A ... sequence of DDS(L ⁄ I)YP(K ⁄ Q), appeared to be closely related to the peptide DDSLYPK identified previously in Delta class GSTs of Manduca sexta and D melanogaster [19,24] The deduced sequences of...
... Iceland, Faroe Islands, and Norway between 2002 and 2005 [64, 65,69] and from eggs of the common eider (Somateria mollissima) from Iceland and three Norwegian sites (37 to 450 ng/g lw) in 2003 and ... mutually agreed procedure of the ESB [50] and the laboratory Details of the analytical method and instrumentation are included in Additional file Standards and reagents Native standards (BDE congeners ... Neugebauer2, and Christa Schröter-Kermani3 Fraunhofer Institute for Molecular Biology and Applied Ecology (Fraunhofer IME), Schmallenberg 57377, Germany Eurofins GfA Lab Service GmbH, Hamburg 21079, Germany...
... border to clean up the edges of the selected area of color ߜ Smooth: When you click with the Magic Wand to make a selection of an area of color, you might see all kinds of tiny 1- or 2-pixel areas ... again, and repeat a number of times to create a series of paw prints marching into the distance Figure 8-14: The many faces of transformations The mask-related selection commands At the bottom of ... terms as you read about the various tools and commands with which you make selections Both feathering and anti-aliasing make the edges of your selections softer by using partially transparent or...
... and all associated documentation are proprietary and copyrighted products Worldwide rights of ownership rest with Computers and Structures, Inc Unlicensed use of the program or reproduction of ... trademark of Microsoft Corporation Adobe and Acrobat are registered trademarks of Adobe Systems Incorporated DISCLAIMER CONSIDERABLE TIME, EFFORT AND EXPENSE HAVE GONE INTO THE DEVELOPMENT AND DOCUMENTATION ... bridge spans 60 feet, and has a width and height of 12 feet each The supports are rollers at one end, and pins at the other The trusses and cross members are to be constructed of 2L4X4’s, while the...
... and all associated documentation are proprietary and copyrighted products Worldwide rights of ownership rest with Computers and Structures, Inc Unlicensed use of the program or reproduction of ... trademark of Microsoft Corporation DISCLAIMER CONSIDERABLE TIME, EFFORT AND EXPENSE HAVE GONE INTO THE DEVELOPMENT AND DOCUMENTATION OF SAP2000 THE PROGRAM HAS BEEN THOROUGHLY TESTED AND USED ... title of the window reads YZ Plane @ X=24 This same title also occurs on the left-hand side of the status bar at the bottom of the SAP2000 window Click the roof level beam on the left side of the...
... areas of cost and capacity rather than performance There are two components of disk performance: transfer bandwidth and access time Although both of these factors are improving, the rate of improvement ... us to understand the effects of random access patterns and locality, both of which can be exploited to reduce the cost of cleaning The simulator models a file system as a fixed number of 4-kbyte ... on disk and in terms of how much of the data written to the log they represent More than 99% of the live data on disk consists of file data blocks and indirect blocks However, about 13% of the...
... generation and recognition are used to communicate between humans and machines Rather than using your hands and eyes, you use your mouth and ears This is very convenient when your hands and eyes ... very specialized audience State -of- the-art researchers need this kind of detailed mathematics to understand the theoretical implications of the work A basic premise of this book is that most practical ... -Simulation and modeling FIGURE 1-1 DSP has revolutionized many areas in science and engineering A few of these diverse applications are shown here Chapter 1- The Breadth and Depth of DSP in many...
... Social phobia and disruptive social anxiety are features of the lives of many thousands of people But exactly what is social phobia? What causes it? What is its nature and what kinds of treatments ... key concepts and methods and a substantive body of research, this book aims to answer these questions and clarify social phobia by means of critical discussions and examination of evidence It ... clinicians, and students in clinical and health psychology and psychiatry AR I E L ST R AV Y N S K I is Professor of Clinical Psychology in the Department of Psychology at the University of Montreal...
... These samples, and samples of fresh unsulfided and sulfided catalyst, were characterized by nitrogen adsorption and SEM The results of textural characterization by nitrogen adsorption of the catalyst ... related to the intensity of emission of the characteristic Ka line of each element White corresponds to a high concentration of a given element, and black to the absence of this element, while ... Fig SEM-EDX maps of distribution of elements: red mud after h run time The brightness of every pixel of the EDX maps, B, can be quantified on a scale of (black) to (maximum degree of brightness)...
... chamber of the injection pump with the pressure chamber, is a type of solenoid valve that turns ON/OFF (opens and closes) in accordance with the signals from the engine ECU When the coil of the ... 2 Operation of ECD-V3 Pump 2-1 Fuel Suction and Injection The mechanism for the suction and pumping/distribution of the fuel is basically the same as for the ... provide high levels of precision, quick response, and pressure resistance, as well as a large spill volume There are two types of solenoid spill valves: the pilot valve type, and the direct-acting...
... perceptions and interprofessional relationships (5) Best practices and standardization of care Participants reported that standardizing care within professions may facilitate opportunities for interprofessional ... Treatment and prognosis; (3) Chest pain as a chronic, multifactorial, or comorbid condition; (4) Interprofessional coordination of care; (5) Best practices and standardization of care; and (6) ... multidisciplinary focus group composed of both chiropractic and medical professionals The goals of the focus group were to explore the attitudes and experiences of medical and chiropractic clinicians regarding...
... eligible trials: authors’ name, year of publication, country of origin, type of cancer, sample size, number of polymorphisms tested and results of the study Studies were divided into two categories ... interpretation of potential misleading sources of literature-bias The existence of such type of bias in genetic association studies might lead to incorrect 497 conclusions about the usefulness of certain ... (GSTM1 and GSTT1) and lung cancer outcome Cancer Invest 2006;24:497-501 498 24 Goto I, Yoneda S, Yamamoto M, Kawajiri K Prognostic significance of germ line polymorphisms of the CYP1A1 and glutathione...
... case of MZ with mirror-imaging of AC in the literature In this case, we describe the second case of MZ with mirror-imaging of AC and discuss the possible clinical implications First, Helland and ... diameter of 63×40×26 mm (b) & (c) MRI of twin A shows a left middle cranial fossa cystic lesion with low and high signal intensities on T1- and T2-weighted images (d), (e) & (f) Brain CT and T 1and ... such as handedness, hair whorl direction, tooth patterns, unilateral eye and ear defects, and even tumor locations and un-descended testicles However, only an extremely small series of cases...
... middle of the orbit (vertical line) with a smooth superior margin and with an absence of the sinus septa (Fig 1) Materials and methods We designed a retrospective study consisting of images of 410 ... Unilateral absence of the frontal sinus; on the left, the absence of frontal sinus; axial view (A), coronal view (B), and sagittal view (C) The frequency of bilateral and unilateral agenesis of the sinuses ... relationships also depend upon the extent of pneumatization [11] The extent of pneumatization results in the individual size and shape of the frontal sinus An absence of pneumatization in the frontal...
... first pass of signal-noise ratio ofand a minimum peak threshold of 20% of all spectra This process was completed with a second pass of peak selection at 0.2% of the mass window, and the estimated ... cancer [28, 42] and so on [29] The initial serum proteome profiles of CRC were generated by using the combination of MALDI-TOF MS and WCX magnetic beads as well as pattern recognition software in ... examination of the colon remains to be the gold standard for diagnosis, which is however invasive, unpleasant and carries associated risk of morbidity and mortality Identification of high-risk...
... less developed Because of the relatively low standard of living and low level of social economical development, there is not enough attention paid to children's vision and refractions in Western ... adhered to the provisions of the Declaration of Helsinki for research The Bureau of Education and Bureau of Health in Yongchuan District approved the implementation of this study Eye Examination ... refraction distributions of all age groups were expressed as mean ± standard deviation (SD) and median values of diopter for both eyes Since the refraction distributions of left eyes and right eyes were...
... fragility and oxidative damage of erythrocytes of zinc-deficient rats J Nutr 1997; 127: 1290–1296 Lajos N, Miki N, Sandor S Protein and non-protein sulfhydryls and disulfides in gastric mucosa and ... spectrophotometric method [20] A mixture of 200 μL of 8% sodium dodecyl sulfate, 200 μL of 0.9% thiobarbituric acid and 1.5 ml 20% acetic acid was prepared 200 μL of RBCs lysate and 1.9 ml distilled water ... the volume of ml After boiling for h, the mixture was cooled, and ml of n-butanol and pyridine (15:1) solution was added to it This mixture was then centrifuged at 5000 rpm for 15 and the absorbance...