1 my birthday is on may 25th a date of birth b party c meeting d dates
Giáo án tiếng việt 3 tuần 1 bài tập viết ôn chữ hoa a
Ngày tải lên :
20/09/2015, 20:42
... - Tìm chữ hoa c tên riêng - A,< /b> V, D - GV viết mẫu ( v a < /b> viết v a < /b> nh c lại - HS quan sát c ch viết chữ ) - HS viết chữ V, A,< /b> D b ng b Viết từ ứng d ng ( tên riêng ) - Gọi HS đ c từ ứng d ng - ... Vừ A < /b> D nh thiếu - Vừ A < /b> D nh niên người d n t c Hmông, anh d ng hi sinh kháng chiến c Luyện viết c u ứng d ng - HS tập viết b ng : Vừ A < /b> D nh - Gọi HS đ c câu ứng d ng - GV giúp HS hiểu c u t c ... t c ngữ Anh em thể chân tay Rách lành đùm b c, d hay đỡ đần HD viết vào TV - HS tập viết b ng : Anh, Rách - GV nêu yêu c u viết - GV nh c nhở HS ngồi tư - HS viết vào Chấm, ch a < /b> - GV chấm 5,...
- 3
- 537
- 0
Giáo án tiếng việt 3 tuần 1 bài tập viết ôn chữ hoa a 2
Ngày tải lên :
26/11/2015, 22:29
... d ng Chữ V, D: d ng Chữ Vừ A < /b> D nh: d ng C u ứng d ng: lần - HS viết vào - Đối với HS giỏi viết đủ d ng tập viết - GV chấm s a < /b> C Củng c , d n d : Luyện viết thêm phần nhà Chuẩn b Ôn chữ hoa Ă, ... ứng d ng: anh em thân thiết, gắn b với chân với tay, l c phải yêu thương, đùm b c - HS tập viết b ng chữ Anh , Rách Hoạt động 2: Hướng d n viết vào - GV nêu yêu c u: viết c chữ nhỏ Chữ A:< /b> d ng ... ứng d ng: Vừ A < /b> D nh tên thiếu niên người d n t c Hmông, anh hy sinh để b o vệ c n c ch mạng - HS tập viết b ng c) Luyện viết c u ứng d ng: - HS đ c câu ứng d ng - GV giúp HS hiểu nội dung c u...
- 2
- 443
- 0
Giáo án tiếng việt 3 tuần 1 bài tập viết ôn chữ hoa a 3
Ngày tải lên :
26/11/2015, 22:29
... Chấm –chư a < /b> Củng c ́: Nh c nội dung Tổng kết: Nhận xét, d ̣n dò ...
- 2
- 300
- 0
Giáo án tiếng việt 3 tuần 1 bài tập viết ôn chữ hoa a 4
Ngày tải lên :
26/11/2015, 22:29
... b c, d hay đỡ đần Hs viết b ng chữ: Anh, Rách PP: Th c hành Hs nêu tư ngồi viết, c ch c m b t, để - Gv nêu yêu c u + Viết chữ A:< /b> d ng c nhỏ + Viế chữ V, D: d ng c nhỏ + Viế chữ Vừ A < /b> D nh: d ng ... chiến chống Pháp để b o vệ c n c ch mạng Hs nh c lại - Gv yêu c u Hs viết vào b ng Hs tập viết b ng • Luyện viết c u ứng d ng Hs đ c câu ứng d ng: - Gv giải thích c u t c ngữ: anh em gia đình ... d ng c nhỏ + Viết c u t c ngữ: lần Hs viết vào - Gv theo d i, uốn nắn - Nh c nhở em viết nét, độ cao khoảng c ch chữ * Hoạt động 3: Chấm ch a < /b> - M c tiêu: Giúp cho Hs nhận lỗi sai để ch a < /b> lại cho...
- 3
- 328
- 0
Giáo án tiếng việt 3 tuần 1 bài tập viết ôn chữ hoa a 5
Ngày tải lên :
26/11/2015, 22:29
... d ng: Vừ A < /b> D nh vào b ng GV s a < /b> lỗi cho HS c) Hướng d n viết c u ứng d ng - HS đ c: Vừ A < /b> D nh - Lắng nghe - C m từ c chữ: Vừ, A,< /b> D nh - Chữ hoa: V, A,< /b> D chữ h cao li rưỡi, chữ lại cao li - B ng ... người anh d ng hi sinh kháng chiến chống th c d n Pháp để b o vệ c n c ch mạng - Từ ứng d ng bao gồm chữ ? chữ ? - Trong từ ứng d ng, chữ c chiều cao ? - Khoảng c ch chữ chừng ? - Yêu c u HS ... đùm b c lẫn - HS lắng nghe - C u ứng d ng chữ c chiều cao - C c chữ A,< /b> h,y, R,l, d, đ, cao li rưỡi, chữ t cao li rưỡi, chữ nào? lại cao li - Yêu c u HS viết Anh, Rách vào b ng - HS viết b ng...
- 4
- 293
- 0
Giáo án tiếng việt 3 tuần 1 bài tập viết ôn chữ hoa a 6
Ngày tải lên :
26/11/2015, 22:29
... Kiểm tra c : - 3' + Kiểm tra chuẩn b HS + Nêu yêu c u tiết Tập viết lớp D y mới: a < /b> Giới thiệu b i: 1-< /b> 2' b Hướng d n viết b ng con: 10< /b> - 12< /b> ' * Luyện viết chữ hoa: GV đ a < /b> chữ mẫu: A < /b> - GV hướng d n ... viết chữ A < /b> - viết mẫu A < /b> - GV đ a < /b> tiếp chữ V, chữ D - HS nhận xét độ cao, c u tạo - HS viết b ng A < /b> - Nêu c u tạo độ cao chữ V D - GV hướng d n viết chữ * Luyện viết từ ứng d ng:- HS đ c từ ứng d ng, ... phải biết thương yêu đùm b c lẫn - HS nhận xét độ cao, khoảng c ch chữ c u - Trong c u ứng d ng từ viết hoa? - GV hướng d n viết chữ khó Anh, Rách c Hướng d n HS viết vở: 15< /b> -17< /b> ' - Nêu yêu c u...
- 2
- 355
- 2
Tài liệu Freedom of Expression on the Internet - A study of legal provisions and practices related to freedom of expression, the free flow of information and media pluralism on the Internet in OSCE participating States ppt
Ngày tải lên :
18/02/2014, 00:20
... The Canadian Radio-television and Telecommunications Commission (CRTC) is < /b> an independent public organization that regulates and supervises the Canadian broadcasting and telecommunications systems ... of < /b> their broadband services; ii No blocking Fixed broadband providers may < /b> not block lawful content, applications, services, or non-harmful devices; mobile broadband providers may < /b> not block lawful ... affected by non-transparent traffic management, content and services’ discrimination or impeding connectivity of < /b> devices.” 13< /b> 9 According to the CoE Declaration, 13< /b> 3 13< /b> 4 13< /b> 5 13< /b> 6 13< /b> 7 13< /b> 8 13< /b> 9 Ibid.,...
- 238
- 2.7K
- 0
Estimating the Internal Rate of Return on an MBA: A Comparison of the Return from Top-Ranked & Second-Tier Programs potx
Ngày tải lên :
31/03/2014, 01:20
... human capital development, the determination of < /b> quality of < /b> academic programs, and the basics of < /b> capital budgeting Specific interest centers on < /b> the economic value of < /b> an MBA and how that value varies ... exacerbates the fact that payback does not incorporate nor consider cash-flows beyond the payback period The Wall Street Journal [2009] followed a < /b> similar approach in an evaluation of < /b> accelerated MBA ... income of < /b> $75,000 when entering an MBA program and graduated with a < /b> job offer of < /b> $75,000, then the MBA has produced no additional income In fact, the student has been economically disadvantages due...
- 10
- 626
- 0
Dutch and English on the Hudson A Chronicle of Colonial New York doc
Ngày tải lên :
31/03/2014, 18:20
... but he always wore wide boots and wide breeches and a < /b> coat adorned with an abundance of < /b> buttons, the whole topped by a < /b> broad-brimmed hat adorned with buckles and feathers and seldom removed in ... established a < /b> colony called "Swannendael," which was destroyed by the Indians in 16< /b> 32 Myndert Myndertsen established his settlement on < /b> the mainland behind Staten Island, and his manor extended ... Hudson, had sailed through the East River, and putting boldly across Long Island Sound, had discovered the Housatonic and Connecticut rivers He also discovered and gave his own name to Block Island...
- 91
- 440
- 0
22. There is only a chair ............... leg was broken. a. whose b. which c. when d. that a 23. potx
Ngày tải lên :
18/06/2014, 17:20
... house a < /b> in / of < /b> b on < /b> / of < /b> c in / from d on < /b> / from c Test 37 Pronunciation a < /b> meat b heat c defeat d learn d a < /b> hard b bath c partner d hazard d a < /b> long b strong c obey d log c a < /b> cock b clock c slope ... b which c what d whom b Test 36 Pronunciation a < /b> burden b burglar c surprise d during d a < /b> tumour b humour c studio d bump d a < /b> hear b year c bear d near c a < /b> leap b cheap c pear d peach c a < /b> ... have changed my < /b> mind and am going to Vietnam instead of < /b> China a < /b> altered my < /b> decision b decided c made up my < /b> minds d come to a < /b> conclusion a < /b> 14< /b> Fruit is < /b> good you and it isn't expensive Danang...
- 43
- 575
- 0
báo cáo hóa học: " Turkish version of impact on family scale: a study of reliability and validity" doc
Ngày tải lên :
18/06/2014, 19:20
... of < /b> data collection and analysis, wrote the first draft SE made substantial contributions to conception and design, worked in all stages of < /b> data collection, performed the statistical analysis ... to be utilized with confidence in NB designed the study, worked in all stages of < /b> data collection and analysis IES made substantial contributions to conception and design, worked in all stages of < /b> ... visual analogue scale (VAS) anchored with negligible disability to total disability The physiotherapist who carried out the evaluation of < /b> disability had specialized in pediatric rehabilitation and...
- 7
- 385
- 0
Báo cáo sinh học: " High Chromosome Number in hematological cancer cell lines is a Negative Predictor of Response to the inhibition of Aurora B and C by GSK1070916" potx
Ngày tải lên :
18/06/2014, 22:20
... GSK1070 916< /b> Additional material Additional file 1:< /b> Additional Table S1 Response Data for treatment of < /b> cells with GSK1070 916< /b> Response is < /b> designated through evaluation of < /b> Cell Cycle Analysis (FACs), ... 2009, 8 :18< /b> 08 -18< /b> 17 14< /b> Adams ND, Adams JL, Burgess JL, Chaudhari AM, Copeland RA, Donatelli CA, Drewry DH, Fisher KE, Hamajima T, Hardwicke MA, et al: Discovery of < /b> GSK1070 916< /b> , a < /b> potent and selective ... inhibitor of < /b> Aurora B/ C kinase J Med Chem 2 010< /b> , 53:3973-40 01 < /b> 15 Anderson K, Lai Z, McDonald OB, Stuart JD, Nartey EN, Hardwicke MA, Newlander K, Dhanak D, Adams J, Patrick D, et al: Biochemical characterization...
- 10
- 618
- 0
o cáo hóa học:" High Chromosome Number in hematological cancer cell lines is a Negative Predictor of Response to the inhibition of Aurora B and C by GSK1070916" ppt
Ngày tải lên :
20/06/2014, 04:20
... GSK1070 916< /b> Additional material Additional file 1:< /b> Additional Table S1 Response Data for treatment of < /b> cells with GSK1070 916< /b> Response is < /b> designated through evaluation of < /b> Cell Cycle Analysis (FACs), ... 2009, 8 :18< /b> 08 -18< /b> 17 14< /b> Adams ND, Adams JL, Burgess JL, Chaudhari AM, Copeland RA, Donatelli CA, Drewry DH, Fisher KE, Hamajima T, Hardwicke MA, et al: Discovery of < /b> GSK1070 916< /b> , a < /b> potent and selective ... inhibitor of < /b> Aurora B/ C kinase J Med Chem 2 010< /b> , 53:3973-40 01 < /b> 15 Anderson K, Lai Z, McDonald OB, Stuart JD, Nartey EN, Hardwicke MA, Newlander K, Dhanak D, Adams J, Patrick D, et al: Biochemical characterization...
- 10
- 665
- 0
Báo cáo khoa học: "Gamma-ray irradiation stimulates the expression of caveolin-1 and GFAP in rat spinal cord: a study of immunoblot and immunohistochemistry" pot
Ngày tải lên :
07/08/2014, 18:21
... tuo deirrac saw noitaidarrI noitaidarrI )ASU( senilediug HIN eht ni dnuof sa ,erac dna esu lamina yrotarobal rof selpicnirp detpecca yllanoitanretni eht htiw ecnadrocca ni detcudnoc saw hcraeser ... retemotisned resal gninnacs a < /b> htiw derusaem saw sisylana tolb nretseW yb deniatbo dnab hcae fo ytisned ehT )ASU ,amgiS( ydobitna nitca ateb-itna lanolconom htiw deborper erew hcihw ,senarbmem eht ... saw sdroc lanips lamron eht ni )worra ,der ,B( PAFG dna )worra ,neerg ,A(< /b> 1-< /b> niloevac fo noitazilacol-oC )IP yad( star detaidarri dna lamron fo sdroc lanips eht ni PAFG dna 1-< /b> niloevac fo ecnecseroulfonummi...
- 6
- 374
- 0
Báo cáo khoa học: "Deletions of neuraminidase and resistance to oseltamivir may be a consequence of restricted receptor specificity in recent H3N2 influenza viruses" doc
Ngày tải lên :
12/08/2014, 04:21
... were 5'-AATACGACTCACTATAAGCAAAAGCAGG, complementary to the 3' end of < /b> viral RNA and 5'-CGGAATTCAATACGACTCACTATAAGTAGAAACAAGG for the 5' end The PCR conditions were 94° for 20 sec, anneal at 30° ... (Wisconsin-like) Neu5Acα2–6Gal 1< /b> 4GlcNAc Neu5Acα2–6GalNAc 1< /b> 4GlcNAc 9OAcNeu5Acα2–6Gal 1< /b> 4GlcNAc Neu5Acα2–6GalNAc in any context A/< /b> OK/483/08 (Brisbane-like) Neu5Acα2–6Gal 1< /b> 4GlcNAc 1< /b> 3Gal 1< /b> 4GlcNAc 1Data previously ... to the 3' end and M13 5' AACAGCTATGACCAT for the 5' end, as well as M13 5' GTTTTCCCAGTCACGAC complementary to 3' end and M13 5' CAGGAAACAGCTATGAC for the 5' end Glycan Array analysis Viruses were...
- 15
- 281
- 0
Báo cáo y học: " HIV-1 Rev oligomerization is not obligatory in the presence of an extra basic domain" doc
Ngày tải lên :
13/08/2014, 09:21
... http://www.retrovirology.com/content/2 /1/< /b> 39 rich linker The rev coding region from pcrevM4 was amplified using the primer pairs tcgaagctagtcgacatctcctatg / cggggtaccgcctccttctttagctcc (PCR A)< /b> and cggggtaccggaatggcaggaagaagc ... region from pcrev and pcrevM4 using the primer pair catgccatggcaggaaga agcggag / ccgctcgagttctttagttcctgactccaa [1,< /b> 29] The PCR products were cloned into the NcoI-and XhoI-digested pCMV/myc/nuc ... gag CRS RRE A3< /b> .9 Figure A,< /b> Schematic diagram of < /b> wild type and Rev mutants A,< /b> Schematic diagram of < /b> wild type and Rev mutants The location of < /b> the M4 mutations are indicated by arrows The Rev basic...
- 8
- 316
- 0
Báo cáo y học: "Impaired glucose and nutrient absorption in critical illness: is gastric emptying only a piece of the puzzle" docx
Ngày tải lên :
13/08/2014, 19:20
... Critical Care Vol 13< /b> No Dive Decreased intestinal absorption in ICU patients may < /b> conceivably be multifactorial; gut mucosal atrophy and decreased splanchnic perfusion have been described extensively ... HA, Van Oostayen JA, Frölich M, Biemond I, Lamers CB, Masclee AA: Dose-dependent inhibition of < /b> postprandial gallbladder motility and plasma hormone secretion during acute hyperglycemia Scand ... simultaneous administration of < /b> probe substances that respond in a < /b> similar way to variables such as extracellular fluid volume or renal clearance enables calculation of < /b> urinary excretion ratios,...
- 2
- 279
- 0
A study on intonation as a means of conveying deontic modality in English
Ngày tải lên :
10/08/2015, 19:47
... features of < /b> deontic modality will be described in turns to find out how intonation can convey deontic modality Secondly, an investigation was made into the intonation and the deontic modality in order ... Vietnamese, unpublished M .A < /b> thesis Anna Papafragou, 2000., Modality: Issues in the semantics-pragmatics interface, ELSEVIER Barbara Bradford, 19< /b> 88., Intonation in Context, Student's book, Cambridge ... intonation as a < /b> means of < /b> conveying deontic modality in English Chapter Three focuses on < /b> a < /b> number of < /b> mistakes existed on < /b> the process of < /b> studying English intonation, especially conveying deontic...
- 4
- 523
- 2