1 concerning soft tissue healing and response to surgery

Báo cáo y học: "Differential expression, function and response to inflammatory stimuli of 11β-hydroxysteroid dehydrogenase type 1 in human fibroblasts: a mechanism for tissue-specific regulation of inflammation" pps

Ngày tải lên : 09/08/2014, 08:22

... Endocr Rev 19 99, 20:435-459 Available online http://arthritis-research.com/content/8/4/R108 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 Yudt MR, Cidlowski JA: The glucocorticoid receptor: coding ... co-expression of 11 β-HSD1 and vWF in endothelial cells 11 β-HSD, 11 β-hydroxysteroid dehydrogenase type 1; vWF, von Willebrand factor The predominant GR isoform, GRα, is ubiquitously expressed and mediates ... ATCTTGGCCTTGTCGCGGCTCTT IL-6 Assay on demand Hs0 017 413 1_m1 (ABI) 11 β-HSD1, 11 β-hydroxysteroid dehydrogenase type 1; C/EBP, CCAAT/enhancer binding protein; GR, glucocorticoid receptor; H6PDH, hexose6-phosphate...

10
438
0

báo cáo hóa học:" Impact of HIV-1 viral subtype on disease progression and response to antiretroviral therapy" pot

Ngày tải lên : 20/06/2014, 08:20

... subtype: 3 31 (IQR = 19 6-5 01) cells/mm versus 250 (IQR = 10 0-449) in subtype A (p = 0.02), 250 (IQR = 14 1- 413 ) in subtype C (p = 0. 01) , 249 (IQR = 30-508) in subtype D (p = 0.04), and 297 (IQR = 11 3-386) ... associated with HIV -1 subtype B’ and E infection among 210 4 patients in Thailand AIDS 19 99, 13 (14 ) :19 63-9 Easterbrook et al Journal of the International AIDS Society 2 010 , 13 :4 http://www.jiasociety.org/content /13 /1/ 4 ... (19 96-2008) J Int AIDS Soc 2009, 12 (1) :1- 11 41 Parkin NT, Schapiro JM: Antiretroviral drug resistance in non-subtype B HIV -1, HIV-2 and SIV Antivir Ther 2004, 9 (1) :3 -12 42 Montes B, Vergne L, Peeters...

9
399
0

Báo cáo y học: "Human rheumatoid arthritis tissue production of IL-17A drives matrix and cartilage degradation: synergy with tumour necrosis factor-α, Oncostatin M and response to biologic therapies" ppt

Ngày tải lên : 09/08/2014, 14:22

... 9202.64 ± 8806. 31 ng/mg of tissue to 16 , 711 .80 ± 15 ,535.07 ng/mg of tissue (P < 0.05), 19 , 510 .08 ± 18 ,2 61. 87 ng/mg of tissue (P = 0.066) and 40,884.073 ± 3,56 21. 206 ng/mg of tissue (P < 0. 01) , respectively ... read and approved the final manuscript Acknowledgements 17 18 19 20 This work was supported by the Health Research Board, Ireland References 10 11 12 13 14 15 16 Arend WP, Dayer J: Cytokines and ... 0.0 21 ng/ml, 7.7 pg/ml, 0.009 ng/ml, 0.08 ng/ml and 4. 91 pg/ ml The ELISA standard ranges were 10 ng/ml to 0 .15 6 ng/ml, 5000 pg/ml to 78 pg/ml, 0.002 ng/ml to 0.045 ng/ml, 10 ng/ ml to 0 .15 6...

12
261
0

Tài liệu Báo cáo khoa học: Post-translational modiﬁcation of the deubiquitinating enzyme otubain 1 modulates active RhoA levels and susceptibility to Yersinia invasion pptx

Ngày tải lên : 16/02/2014, 15:20

... y4 1. 0 10 18. 51 b17 ++ 12 55.5 b 21 ++ 953.5 b16 ++ 877.5 y7 0.5 10 92 .1 b18 ++ 9 61. 9 b16 ++ 418 .1 y3 pY 12 30.6 y20 ++ 290 .1 y2 11 91. 1 y10 13 13 .1 y 21 ++- 97 17 22.7 b14 25 kDa 18 51. 0 b15 400 B 16 06.8 ... 290 .17 y2 17 5 .13 y1 10 49.9 y18++ 11 92.62 y10 13 55.69 y 11 1426.69 y12 678.35 y 11+ + 211 .16 b2 985.52 y17++ 15 39.86 y13 25 kDa 200 400 600 16 99.89 y14 10 77.60 y9 800 10 00 12 00 14 00 16 00 18 14.83 y15 ... OTUB1 α-PDI PDI Input α-FLAG YpkA FLAG IP α-HA OTUB1 S16E S18E Y26E S16E S16E S18E S18E Y26E OTUB1 Ctrl YpkA wt C91S P < 0.0 01 B Infection (relative to control) 2.4 2.2 2.0 1. 8 1. 6 OTUB1 - 1. 4 1. 2...

16
654
0

Tài liệu Preparedness and Response to a Mass Casualty Event Resulting from Terrorist Use of Explosives pdf

Ngày tải lên : 19/02/2014, 03:20

... 9 10 11 11 11 11 12 12 12 13 13 13 14 14 14 14 15 15 16 16 16 CHAPTER FOUR: Patient Distribution Introduction Levels of Patient Distribution Effective and Controlled Distribution 17 17 17 18 CHAPTER ... preventers of and responders to an MCE They should be integrated into bombing terrorism preparedness and response Planning a medical response to an MCE must be comprehensive and community based, and clear ... capabilities and resources, coordinate the flow of casualties, maintain mutual communication and understanding, and lead the public messages 10 Interim Planning Guidance for Preparedness and Response to...

36
478
0

Individual Preparedness and Response to Chemical, Radiological, Nuclear, and Biological Terrorist Attacks - A Quick Guide potx

Ngày tải lên : 15/03/2014, 15:20

... 15 213 RAND URL: http://www.rand.org/ To order RAND documents or to obtain additional information, contact Distribution Services: Telephone: ( 310 ) 4 51- 7002; Fax: ( 310 ) 4 51- 6 915 ; Email: order@rand.org ... RAND Published 2003 by RAND 17 00 Main Street, P.O Box 213 8, Santa Monica, CA 90407- 213 8 12 00 South Hayes Street, Arlington, VA 22202-5050 2 01 North Craig Street, Suite 202, Pittsburgh, PA 15 213 ... RAND, MR -17 31- SF, 2003 This study was conducted within RAND’s Public Safety and Justice program RAND Public Safety and Justice conducts research and analysis that helps inform policymakers and...

35
326
0

Báo cáo khoa học: " The effects of ectomycorrhizal status on carbon dioxide assimilation capacity, water-use efficiency and response to transplanting in seedlings of Pseudotsuga menziesii (Mirb) Franco" docx

Ngày tải lên : 09/08/2014, 03:25

... at 22.0 ± -1 0.5°C air temperature, 10 .6 ± 1. 0 Pa·kPa leafto-air water vapour molar fraction difference, 400 μmol·m photosynthetic photon flux -1 ·s -2 -1 density (400-700 nm) and 350 ± μmol·mol ... treatments TtP and Tt took place only from d 11 , and recovery of g was also observed in treatment LI alterations in the photosynthetic demand for CO while the supply function (related to stomatal conductance) ... whether differences for A between treatments and A changes in response to transplanting were due to chloroplastic or to stomatal factors (Jones, 19 85) Previous measurements made on conifers (unpublished...

13
437
0

Báo cáo y học: "Serum levels of autoantibodies against C-reactive protein correlate with renal disease activity and response to therapy in lupus nephritis" pps

Ngày tải lên : 12/08/2014, 11:22

... http://arthritis-research.com/content /11 /6/R188 Table Renal BILAG response and the anti-dsDNA/anti-CRP status demonstrated BILAG response

9
284
0

Báo cáo y học: " Cough in adult cystic fibrosis: diagnosis and response to fundoplication" ppt

Ngày tải lên : 13/08/2014, 08:20

... 7.20 11 .20 4.00 15 5.00 16 0.00 13 2.00 17 8.00 97.00 78 .10 29.90 28.30 45.80 14 .10 Page of (page number not for citation purposes) Cough 2009, 5 :1 http://www.coughjournal.com/content/5 /1/ 1 in FEV1 and ... of 21. 2 during the day and 4.8 at night. [15 ] Spirometry Forced expiratory volume in one second (FEV1) increased from a mean of 1. 03L (± 0.32) to 1. 17L (± 0. 41) , P = 0.04 (95%CI = to 0.25), and ... Pressure 15 –30 mmHg % of time pH > Reflux Episodes NL < 50 DeMeester Score NL < or = 14 .7 49 27 57 22 28 M F M F M 1. 08 0.77 0. 61 0.97 1. 40 3.20 1. 89 1. 78 1. 84 3.70 6.00 9.00 23.00 10 .00 14 .00 15 .20...

6
325
0

Báo cáo y học: "Association between inflammatory mediators and response to inhaled nitric oxide in a model of endotoxin-induced lung injury" docx

Ngày tải lên : 13/08/2014, 11:23

... to 9.5) IL-8 (ng/ml) 2.0 (0 to 63) 11 7 (10 8 to 12 7)* 11 6 (10 4 to 12 6)* 31 (27 to 46) 39 (19 to 52) (2 to 21) Nitrates (nmol/ml) 211 (16 2 to 309) 15 1 (13 9 to 17 4)* 13 5 (11 4 to 17 2)* 13 3 (11 9 to ... (9 71 to 1, 708)* 387 (355 to 15 13)* 1, 028 (868 to 1, 5 31) * 1, 224 (333 to 1, 562)* TXB2 (pg/ml) 687 (5 81 to 793 3 ,11 0 (2, 617 to 3,546)* 2,824 (2 ,12 0 to 3,287)* 2,409 (2 ,12 9 to 3 ,11 0)* 4 ,10 3 (1, 5 21 to ... 2 ,10 7 (1, 648 to 2,430)* 3 ,15 0 (8 91 to 4,002)* 6-keto-PGF1α (pg/ml) 294 (260 to 518 ) 749 (548 to 17 78) 1, 3 01 (899 to 1, 658)* 732 ( 613 to 13 41) 973 ( 716 to 1, 504)* 464 (332 to 7 71) 877 (534 to 1, 747)*...

8
363
0

Báo cáo y học: "Routine versus needs-based MRI in patients with prolonged low back pain: a comparison of duration of treatment, number of clinical contacts and referrals to surgery" pdf

Ngày tải lên : 13/08/2014, 14:20

... Osteopathy 2 010 , 18 :19 http://www.chiroandosteo.com/content /18 /1/ 19 least on an 11 -point Numeric Rating Scale, (2) duration of present symptoms from to 12 months, and (3) age above 18 years Information ... improved patient outcomes and is cost-effective in other clinical settings Page of 5 10 11 12 13 14 15 16 17 18 19 Author details Research Department, Spine Centre of Southern Denmark, Østre Hougvej ... Osteopathy 2 010 , 18 :19 http://www.chiroandosteo.com/content /18 /1/ 19 clinic, or it could be due to other procedural differences at the two time points To test this more precisely, would require a randomised...

5
351
0

Báo cáo khoa học: The autophagic response to nutrient deprivation in the hl-1 cardiac myocyte is modulated by Bcl-2 and sarco⁄endoplasmic reticulum calcium stores ppt

Ngày tải lên : 07/03/2014, 09:20

... Beclin1 Beclin1 Bcl2BD FM Vector Beclin1 Beclin1 Bcl2BD MKH B Beclin1 Vector Beclin1 Bcl2 -BD MKH + i Fig Beclin regulation of autophagic response HL -1 cells were cotransfected with GFP–LC3 and ... switches autophagy to apoptosis Nat Cell Biol 8, 11 24 11 32 62 Duchen MR (2000) Mitochondria and calcium: from cell signalling to cell death J Physiol 529, 57–68 Bcl-2 and calcium control of autophagy ... starvation using transgenic mice expressing a ﬂuorescent autophagosome marker Mol Biol Cell 15 , 11 01 11 11 Bcl-2 and calcium control of autophagy 20 Tanida I, Minematsu-Ikeguchi N, Ueno T & Kominami...

14
444
0

Báo cáo khoa học: Identiﬁcation and characterization of 1-Cys peroxiredoxin from Sulfolobus solfataricus and its involvement in the response to oxidative stress pdf

Ngày tải lên : 07/03/2014, 12:20

... 2, pUC19 and 10 mM DTT; lane 3, pUC19 and lM FeCl3; lane 4, pUC19, 10 mM DTT, and lM FeCl3; lane 5, pUC19, 10 mM DTT, lM FeCl3, and 50 lgÆmL )1 rBcp2; lane 6, pUC19, 10 mM DTT, lM FeCl3, and 50 ... thioredoxin reductase and thioredoxin) (Fig 1) Two archaeal Prxs from Aeropyrum pernix APE2278 [10 ] and Pyrococcus horikoshii PH1 217 [11 ,12 ] have A H2O 1- Cys Prx 1- Cys Prx H2O2 Sp OH 722 Identiﬁcation ... °C When necessary 10 0 lgÆmL )1 ampicillin, or 50 lgÆmL )1 kanamycin and 33 lgÆmL )1 chloramphenicol were added to the medium to maintain plasmids FEBS Journal 273 (2006) 7 21 7 31 ª 2006 The Authors...

11
565
0

Báo cáo khoa học: Cas utilizes Nck2 to activate Cdc42 and regulate cell polarization during cell migration in response to wound healing docx

Ngày tải lên : 23/03/2014, 03:20

... involvement of the Grb2, p130cas, and Nck adaptor proteins Mol Cell Biol 17 , 17 02 17 13 FEBS Journal 277 (2 010 ) 3502–3 513 ª 2 010 The Authors Journal compilation ª 2 010 FEBS Cas ⁄ Nck2 regulates ... cis-Golgi matrix protein, GM130 J Cell Biol 13 1, 17 15 17 26 28 Feller SM (20 01) Crk family adaptors-signalling complex formation and biological roles Oncogene 20, 6348–63 71 29 Chodniewicz D & Klemke ... CrkII to activate Rac1 to form cell protrusions and elongation for promotion of cell migration during wound healing FEBS Journal 277 (2 010 ) 3502–3 513 ª 2 010 The Authors Journal compilation ª 2 010 ...

12
355
0

báo cáo hóa học:" Validation of a HLA-A2 tetramer flow cytometric method, IFNgamma real time RT-PCR, and IFNgamma ELISPOT for detection of immunologic response to gp100 and MelanA/MART-1 in melanoma patients" doc

Ngày tải lên : 18/06/2014, 15:20

... Negative 10 0 10 1 10 2 CD8 FITC KW 0 312 03.009 10 3 10 4 10 0 0.62% 10 1 10 2 CD8 FITC KW 0 312 03. 012 10 3 10 4 10 0 1. 30% 10 1 10 2 CD8 FITC KW 0 312 03. 015 10 3 10 4 10 0 2.50% 10 1 10 2 CD8 FITC KW 0 312 03. 018 10 3 10 4 ... Recovery %CV 12 /12 10 0,000 10 4,508 15 ,676 12 /12 10 5% 15 % 10 ,000 9,032 1, 174 12 /12 90.3% 13 % 1, 000 942 19 8 12 /12 94.2% 21% 10 0 80 27.2 12 /12 80% 34% 10 10 NA 8 /12 NA NA 1 NA 3 /12 NA NA 10 0,000 93,334 ... to MART -1 peptide Flu TIL1235/PBMC MART -1 PHA Mean SD Mean SD Mean SD PBMC only 28.2 51. 7 1. 1 0.5 366.3 516 .5 1/ 50000 36 .1 1 01. 3 1. 8 1. 1 16 2.2 14 2.6 1/ 20000 56.8 11 3.8 3 .1 1.8 16 1 .1 145 .1 1 /10 000...

25
639
0

Báo cáo sinh học: "Peritoneal carcinomatosis from ovarian cancer: chemosensitivity test and tissue markers as predictors of response to chemotherapy" doc

Ngày tải lên : 18/06/2014, 19:20

... BRCA1 0.80 (0.027 -12 .4) 2.60 (0-87.4) 0.52 (0.027-2.0) 1. 73 (0.20-6.47) 1. 9 (0 .11 -12 .4) 3.0 (0-87.4) 0.04 0.59 ERCC1 1. 50 (0.47 -15 .0) 2.30 (0.7-7.02) 1. 4 (0.47 -15 .0) 0.93 GSTP1 1. 75 (0 .15 -45.0) 1. 47 ... Res 19 85, 45:5436-54 41 Arienti et al Journal of Translational Medicine 2 011 , 9:94 http://www.translational-medicine.com/content/9 /1/ 94 10 11 12 13 14 15 16 17 18 19 20 21 22 23 Weisenthal LM, ... 2007, 18 :10 93 -11 01 doi :10 .11 86 /14 79-5876-9-94 Cite this article as: Arienti et al.: Peritoneal carcinomatosis from ovarian cancer: chemosensitivity test and tissue markers as predictors of response...

7
435
0

báo cáo hóa học: " Brain microvascular pericytes are immunoactive in culture: cytokine, chemokine, nitric oxide, and LRP-1 expression in response to lipopolysaccharide" ppt

Ngày tải lên : 19/06/2014, 22:20

... non-amyloid angiopathies: FAD-PS -1 (P 117 L) mutation and CADASIL Immunohistochemical and ultrastructural studies Folia Neuropathol 2007, 45 :19 2-204 doi :10 .11 86 /17 42-2094-8 -13 9 Cite this article as: Kovac ... cultures with 0 .1 and ug/ml LPS resulted in significant release of pro-inflammatory cytokines such as IL-1a, TNF-a, IL-3, IL-9 and IL -13 (4 h, h and 24 h) and anti-inflammatory cytokines such as ... authors declare that they have no competing interests Received: 17 August 2 011 Accepted: 13 October 2 011 Published: 13 October 2 011 References Neuwelt E, Abbott NJ, Abrey L, Banks WA, Blakley B,...

9
512
0

o cáo hóa học:" Peritoneal carcinomatosis from ovarian cancer: chemosensitivity test and tissue markers as predictors of response to chemotherapy" doc

Ngày tải lên : 20/06/2014, 04:20

... BRCA1 0.80 (0.027 -12 .4) 2.60 (0-87.4) 0.52 (0.027-2.0) 1. 73 (0.20-6.47) 1. 9 (0 .11 -12 .4) 3.0 (0-87.4) 0.04 0.59 ERCC1 1. 50 (0.47 -15 .0) 2.30 (0.7-7.02) 1. 4 (0.47 -15 .0) 0.93 GSTP1 1. 75 (0 .15 -45.0) 1. 47 ... Res 19 85, 45:5436-54 41 Arienti et al Journal of Translational Medicine 2 011 , 9:94 http://www.translational-medicine.com/content/9 /1/ 94 10 11 12 13 14 15 16 17 18 19 20 21 22 23 Weisenthal LM, ... 2007, 18 :10 93 -11 01 doi :10 .11 86 /14 79-5876-9-94 Cite this article as: Arienti et al.: Peritoneal carcinomatosis from ovarian cancer: chemosensitivity test and tissue markers as predictors of response...

7
320
0

Chapter 094. Soft Tissue and Bone Sarcomas and Bone Metastases (Part 1) pot

Ngày tải lên : 07/07/2014, 02:20

... chromosomal translocation t(X ;18 )(p 11; q 11) involving a nuclear transcription factor on chromosome 18 called SYT and two breakpoints on X Patients with translocations to the second X breakpoint (SSX2) ... of the Rb -1 locus (chromosome 13 q14) in patients with inherited retinoblastoma is associated with the development of osteosarcoma in those who survive the retinoblastoma and of soft tissue sarcomas ... Soft tissues include muscles, tendons, fat, fibrous tissue, synovial tissue, vessels, and nerves Approximately 60% of soft tissue sarcomas arise in the extremities,...

5
299
0

Báo cáo y học: "Synergistic role of c-Myc and ERK1/2 in the mitogenic response to TGF-1 in cultured rat nucleus pulposus cells" ppsx

Ngày tải lên : 09/08/2014, 01:22

... inhibitors: positive and negative regulators of G1-phase progression Genes Dev 19 99, 13 :15 01- 1 512 Page 11 of 12 (page number not for citation purposes) Arthritis Research & Therapy Vol 10 No Nakai et ... http://arthritis-research.com/content /10 /6/R140 Figure Effects of inhibitors and transforming growth factor 1 (TGF 1) on cell cycle progression Effects of inhibitors and transforming growth factor 1 (TGF 1) on cell cycle ... 2000, 14 :25 01- 2 514 Morgan DO: Principles of CDK regulation Nature 19 95, 374 :13 1 -13 4 Sherr CJ: G1 phase progression: cycling on cue Cell 19 94, 79:5 51- 555 Sherr CJ, Roberts JM: CDK inhibitors:...

12
535
0