1 a member of the egf cfc family
Báo cáo Y học: Properties of group I allergens from grass pollen and their relation to cathepsin B, a member of the C1 family of cysteine proteinases pdf
... with the recombinant allergen after affinity purification using the mAb IG12 [18 ] The natural allergen Phl p was also found to be capable of degrading a synthetic substrate at a papaincleavage site ... Mutagenesis of His104 to Val was performed by PCR using the primer phlp1s (5¢-ACC CGGGAGGAGGAATCCCCAAGGTCCCCCCCG-3¢) with phlp1-Has (5¢-TACGTACGCGGCGATGGGCTCC TCG-3¢), and phlp1as2 (5¢-AGAATTCTCAGTCCTT ... supernatant containing rPhl p N showed strong degradation of the full-length allergen and accumulation of a truncated 15 -kDa fragment at about pH 4.5 (Fig 3A) This sharp band lacked the N-terminal...
- 10
- 535
- 0
Báo cáo khoa học: The proapoptotic member of the Bcl-2 family Bcl-2 / E1B-19K-interacting protein 3 is a mediator of caspase-independent neuronal death in excitotoxicity pot
... primer 5¢-GAGAATTC TCG CAG AGC GGG GAG GAG AAC-3¢ and antisense primer 5¢-AT GGATCC TCA AAA GGT ACT AGT GGA AGT TG-3¢ The PCR product was ligated to pGEM-T (Promega) by T -A cloning After the resulting ... Journal 278 (2 011 ) 13 4 14 2 ª 2 010 The Authors Journal compilation ª 2 010 FEBS Z Zhang et al independently of caspase activation, and that inhibition of BNIP3 by RNAi increased neuronal viability and ... Canadian Council on Animal Care guidelines and were approved by the Animal Care Committee at the University of Manitoba Animals were anesthetized with intraperitoneal 74 mgÆkg )1 sodium pentobarbital...
- 9
- 388
- 0
Báo cáo Y học: Characterization of a Saccharomyces cerevisiae NADP(H)-dependent alcohol dehydrogenase (ADHVII), a member of the cinnamyl alcohol dehydrogenase family pptx
... the genomic DNA from the S cerevisiae S288C strain using the oligonucleotides 5¢GGCGAGCTCAAAATGCTTTACCCAGAAAAATT TGAGG-3¢ and 5¢GGCTCTAGACTATTTATGGAA TTTCTTATC-3¢ that introduced SacI and XbaI ... deletion of ADH6 and ADH7 genes Agarose gel of genomic DNA of the yeast strains BJ 216 8: ADH6 ADH7, lanes and 2; BJ18: adh6D ADH7, lanes and 4; BJ05: ADH6 adh7D, lanes and 6; and BJ1805: adh6D adh7D, ... Relative activity Oxidation Relative activity Cinnamaldehyde Phenylacetaldehyde Benzaldehyde Coniferaldehyde Veratraldehyde Anisaldehyde Vanillin Propanal Butanal Pentanal Hexanal Heptanal Octanal...
- 8
- 378
- 0
Báo cáo y học: "Balance between survivin, a key member of the apoptosis inhibitor family, and its specific antibodies determines erosivity in rheumatoid arthritis" ppt
... mortality of patients with rheumatoid arthritis J Rheumatol 2000, 27:2283-2284 30 Kamihira S, Yamada Y, Hirakata Y, Tomonaga M, Sugahara K, Hayashi T, Dateki N, Harasawa H, Nakayama K: Aberrant expression ... MR, Haemel AK, Wood GS: Apoptosis and melanoma: molecular mechanisms J Pathol 2003, 19 9:275-288 Hasunuma T, Kayagaki N, Asahara H, Motokawa S, Kobata T, Yagita H, Aono H, Sumida T, Okumura K, ... pathogenesis of experimental arthritis [13 ,14 ] Survivin is a 14 2-amino-acid protein that belongs to the IAP family, and it inhibits the activity of caspase 3, caspase 7, and caspase 9, but not of the...
- 10
- 505
- 0
Báo cáo khoa học: Extrinsic proteins of photosystem II An intermediate member of the PsbQ protein family in red algal PS II ppt
... Evol 51, 382–390 20 Nikaido, I., Asamizu, E., Nakajima, M., Nakamura, Y., Saga, N & Tabata, S (2000) Generation of 10 ,15 4 expressed sequence tags from a leafy gametophyte of a marine red alga, Porphyra ... Ishikawa, A. , Kawashima, K., 28 29 30 31 Kimura, T., Kishida, Y., Kohara, M., Matsumoto, M., Matsuno, A. , Muraki, A. , Nakazaki, N., Shimpo, S., Sugimoto, M., Takazawa, M., Yamada, M., Yasuda, M ... with a calculated molecular mass of 16 386 Da Blast analysis with the GenBank database showed a significant homology of the 20-kDa protein gene with a cDNA clone, AV34507 from a marine red alga Porphyra...
- 8
- 349
- 0
Platelet function and Isoprostane biology. Should Isoprostanes be the newest member of the Orphan-ligand family? potx
... platelet aggregation FEBS Lett 19 98, 435 :11 5 -11 8 Page 13 of 13 10 9 Takahara K, Murray R, FitzGerald GA, Fitzgerald DJ: The response to thromboxane A2 analogues in human platelets Discrimination ... transduction and pharmacology Pharmacol Ther 2008, 11 8 :18 -35 Page 12 of 13 69 Bhagwat SS, Hamann PR, Still WC, Bunting S, Fitzpatrick FA: Synthesis and structure of the platelet aggregation factor ... and thromboxanes in anaphylactic reactions Adv Prostaglandin Thromboxane Res 19 76, 1: 495-5 01 112 Basu S: Metabolism of 8-iso-prostaglandin F2alpha FEBS Lett 19 98, 428:32-36 11 3 Catella F, Healy...
- 13
- 391
- 0
Báo cáo y học: "Development of mental health first aid guidelines on how a member of the public can support a person affected by a traumatic event: a Delphi study" doc
... to the child that they cannot keep The first aider should ensure that that they or another adult are available to take care of the child The first aider should tell the child that they or another ... communicating with the traumatised person The first aider should speak clearly and avoid clinical and technical language The first aider should communicate with the person as an equal, rather than as ... sorts of traumas, such as sexual assault or violent crime, and generally directed the reader to appropriate authorities and support organisations There were also a large number of pamphlets and fact...
- 15
- 342
- 0
the subsidy regulations and vietnam’s position as a member of the wto
... in Agriculture, 2003, P160 -16 5 22 The Canada – Dairy, report of the Panel, supra n 19 , para 4. 310 and Canada – Aircraff, report of the Panel, supra n 36, para 5.27 18 Fel! Använd fliken Start ... classed as financial contributions even though they are not within the strict meaning of the term. 21 In a debate of Canada over two dispute cases, Canada – Dairy and Canada – Aircraft it was ... payment can be a financial 16 Article 1. 1 (a) (i) SCM 17 Article 1. 1 (a) (ii) SCM 18 Article 1. 1 (a) (iii) SCM 19 (Article 1. 1 (a) (iv) SCM 17 Fel! Använd fliken Start om du vill tillämpa Heading för texten...
- 59
- 314
- 0
Báo cáo y học: "Klassevirus 1, a previously undescribed member of the family Picornaviridae, is globally widespread" potx
... (LG 011 8: 5'-ATGGCAACCCTGTCCCTGAG-3' and LG 011 7 5'-GGAAACCCAACCACGCTGTA-3') and Page of (page number not for citation purposes) Virology Journal 2009, 6:86 (LG 011 9: 5'-GCTAACTCTAATGCTGCCACC-3' and ... strains using partial sequence fragments Sequence Fragment Klasse-stl1 Klasse-bar1 Klasse-mel1 Klasse-stl1 3D 10 0% 97% 96% Klasse-slt1 2C 10 0% 87% 10 0% 91% 96% Klasse-bar1 3D 10 0% 97% Klasse-bar1 ... under the age of who were admitted to the Royal Children's Hospital, Melbourne, Victoria, Australia with acute diarrhea between 19 78 and 19 99 For a portion of these samples (70), RNA was extracted...
- 7
- 328
- 0
Báo cáo khoa học: " Klassevirus 1, a previously undescribed member of the family Picornaviridae, is globally widespread" pptx
... (LG 011 8: 5'-ATGGCAACCCTGTCCCTGAG-3' and LG 011 7 5'-GGAAACCCAACCACGCTGTA-3') and Page of (page number not for citation purposes) Virology Journal 2009, 6:86 (LG 011 9: 5'-GCTAACTCTAATGCTGCCACC-3' and ... strains using partial sequence fragments Sequence Fragment Klasse-stl1 Klasse-bar1 Klasse-mel1 Klasse-stl1 3D 10 0% 97% 96% Klasse-slt1 2C 10 0% 87% 10 0% 91% 96% Klasse-bar1 3D 10 0% 97% Klasse-bar1 ... under the age of who were admitted to the Royal Children's Hospital, Melbourne, Victoria, Australia with acute diarrhea between 19 78 and 19 99 For a portion of these samples (70), RNA was extracted...
- 7
- 583
- 0
Tài liệu Báo cáo khoa học: Crystal structure of the catalytic domain of DESC1, a new member of the type II transmembrane serine proteinase family pptx
... structure of the catalytic domain of DESC1 Scheme Domain organization of human DESC1 membrane region The extracellular part of DESC1 consists of a 12 0-amino acid SEA domain followed by the C-terminal ... 473–483 Kataoka H, Uchino H, Asada Y, Hatakeyama K, Nabeshima K, Sumiyoshi A & Koono M (19 97) Analy- Crystal structure of the catalytic domain of DESC1 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 ... type because of the presence of an Ala rather than a Ser at position 19 0 The S1 specificity pockets of the TTSPs belong to the Ala190-type (DESC1, hepsin) and serine190-type (matriptase and enteropeptidase)...
- 13
- 588
- 0
Báo cáo khoa học: Epl1, the major secreted protein of Hypocrea atroviridis on glucose, is a member of a strongly conserved protein family comprising plant defense response elicitors potx
... L14T53P106R00046 L12T11P105R09908 L14T53P106R00046 L12T11P105R09908 L14T53P106R00046 L12T11P105R09908 L14T53P106R00046 L12T11P105R09908 L14T53P106R00046 L12T11P105R09908 L14T53P106R00046 L12T11P105R09908 ... nodorum and Sp1 of Leptosphaeria maculans) or human allergens and pathogenesis-related proteins (As-CG of Coccidioides immitis, Aca1 of Antrodia camphorata and Aspf13 of Aspergillus fumigatus) It ... scanning of the epl1 signal, normalized to that of the 18 S rRNA The values are shown relative to the highest value a faint signal was detected after 15 h and 30 h, whereas under carbon starvation,...
- 14
- 494
- 0
Báo cáo khoa học: O-MACS, a novel member of the medium-chain acyl-CoA synthetase family, specifically expressed in the olfactory epithelium in a zone-specific manner doc
... octanoate; C10, decanoate, C12, dodecanoate, C16, palmitate, BA, benzoate The data are means ± SD of triplicate assays transcripts for the SA and MACS1 genes are present only in the RE area of the ... H., Ioka, R.X., Kamataki, A. , Magoori, K., Takahashi, S., Sakai, J & Yamamoto, T.T (20 01) Molecular identification and characterization of two mediumchain acyl-CoA synthetase, MACS1 and the Sa gene ... long-chain acyl-CoA synthetase (mVLACS), human long-chain acyl-CoA synthetase (hLACS1), mouse mediumchain acyl-CoA synthetase proteins (mSA, mMACS1, mKS, and mKS2), mouse acetylCoA synthetase (mAceCS1),...
- 10
- 393
- 0
Báo cáo khóa học: Functional properties of the protein disulfide oxidoreductase from the archaeon Pyrococcus furiosus A member of a novel protein family related to protein disulfide-isomerase doc
... effect on the structure of the protein, far-UV CD spectra were recorded Reduced/denatured 3 :1 C146 C146 – C149 9 :1 C146 /14 9 C146 /14 9 C149 C149/38 1: 1 C146 C146 C149 C149 3 :1 C146 /14 9 C146 /14 9 C149/35 ... horikoshii; Pa, P abissi; Ss, S solfataricus; St, S tokodaii; Ap, Aeropyrum pernix; Ta, Thermoplasma acidophilum; Tv, Thermoplasma volcanium; Fa, Ferroplasma acidarmanus; Tm, Thermotoga maritima; Aa, Aquifex ... presence of unlabeled ATP, indicating that ATP and the analog 8-azido-ATP recognize the same binding site The ATPase activity of PfPDO was demonstrated The hydrolysis of ATP was linear for up to 30 at...
- 12
- 506
- 0
Báo cáo khoa học: Characterization of ubiquitin-like polypeptide acceptor protein, a novel pro-apoptotic member of the Bcl2 family pptx
... Lanes and contain an aliquot from the anti-PU1 a nity chromatography purification step; lanes and contain an aliquot from the hydroxylapatite purification step; lanes and 2, silver-stained; lanes ... which aa 10 4 11 1 of Bcl-G are covalently linked by an isopeptide bond to aa 67–72 of Ubi-L, and aa 10 4 12 4 are linked by an isopeptide Table Assignments for peptide fragments from a Staphylococcus ... Sequence Bcl-G 897.0 930 .1 1283.9 13 97.0 15 99.0 2065.2 215 2.8 2350 .1 897 .1 930 .1 1283.5 13 96.6 15 98.7 2065.4 215 3.3 2349.8 318 –325 208– 215 17 3 18 4 11 2 12 4 305– 317 288–304 12 5 14 2 81 10 0 KILGISHE QIISKIVE...
- 7
- 272
- 0
Báo cáo khoa học: Identification of a copper-repressible C-type heme protein of Methylococcus capsulatus (Bath) A member of a novel group of the bacterial di-heme cytochrome c peroxidase family of proteins docx
... processing would lead to a mature protein of 732 amino acids with a theoretical molecular mass of 78 kDa A search in the PROSITE database of protein families and domains [12 ] with MCA2590 revealed two ... column The RNA was dissolved in 50 lL of RNase-free water and the A2 60 and A2 80 values were determined The RNA quality and quantity was determined with the Agilent 210 0 Bioanalyser and the 210 0 ... RT-PCR analyses revealed that this regulation takes place at the transcriptional level The concomitant regulation of SACCP and MopE is also in accordance with the possibility that the MCA2590 and...
- 12
- 392
- 0
Báo cáo Y học: A functionally conserved member of the FTZ-F1 nuclear receptor family from Schistosoma mansoni doc
... (abolition of the signal) Response element SmFTZ-F1 SF -1 TCA AGGTCA ACA AGGTCA CCA AGGTCA GCA AGGTCA TGA AGGTCA TTA AGGTCA TAA AGGTCA TCT AGGTCA TCG AGGTCA TCC AGGTCA TCA GGGTCA TCA AGGTCC TCA ... laevis FF 1a (XlFF 1a; U050 01) , Rana rugosa FTZF 1a (RrFTZ-F 1a; AB035498), R rugosa FTZ-F1b (RrFTZ-F1b; AB035499), D rerio FF 1a (DrFF 1a; AF 014 926), R norvegicus FTZ-F1b1 (RnFTZ-F1b1; AB 012 960), R norvegicus ... tree of the FTZ-F1 family The SmFTZ-F1 protein is a member of the FTZ-F1 family, but clusters with D melanogaster DHR39 The C and E domains of FTZ-F1 family members and mouse GCNF1 were aligned...
- 12
- 541
- 0
Unit 1: A day in the life of. Listening
... Listen and order these pictures WHILE-LISTENING Listen again and decide whether the statements are True (T) or False (F) Mr Lam lives in District Mr Lam usually gets up early After Mr Lam gets ... District Mr Lam’s first passengers are two pupils Mr Lam has lunch at home with his family After lunch Mr Lam immediately goes back to work T F POST-LISTENING V HOMEWORK - T asks ss to remember the story ... WARM UP Game: JUMBLED WORDS CCLOY CYCLO RIEDV DRIVE TALLS DOFO FOOD STALL NSSEGERPA PASSENGER PRE-LISTENING WHO IS HE? - He gets up very early - He has got a cyclo - He usually has meals...
- 10
- 12,613
- 39
Unit 1-A day in the life of...
... events, the climax, and the conclusion of the story Unit 1: A day in the life of Period 4: Writing Task 2.Task 2: Format of a narrative Climax Events Conclusion Unit 1: A day in the life of Period ... Read the passage and find all the verbs that are used in past simple and the connectors in the story Simple past Regular verbs land stare announce Irregular verbs take begin S + Ved landed stared ... Unit 1: A day in the life of Last year, I spent Period 4: Writing at a my summer holidays seaside town The hotel was modern and Task comfortable I had a wonderful holiday until the fire Task Task...
- 20
- 2,807
- 5
Gián án Ụnit 1: A day in the life of...
... answers and find the winner Arrangeme nt T - whole class KEY: Get up have breakfast clean the floor learning 5.phoning 6.cooking have lunch 8.take a nap 9.sulf the internet 10 watch TV 11 go to the ... t call on some ss and ask them about their activities: T: Lan, what time you often get up? Lan:: I often get up at 6.oo T: Phong, what you often in the afternoon? Phong: I go to school T: Hoa, ... lead in: - It is Linh’sdaily routine -Do you have a daily routine? -is it same or different from Linh? 5ms 2.Pre-task: BRAIN STORM -ask ss think about some their activities in a day in m -after...
- 3
- 2,111
- 12
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25