... remains unclear Researchers need greater and clearer guidance on how best to plan, resource, and facilitate their dissemination activities Page of 8 10 11 12 13 Additional material Additional ... with national and international government ministers, local NHS commissioning agencies, National Institute of Health and Clinical Excellence (NICE) Appraisal Committees (and European equivalents), ... sample of 536 potential participants Page of Table Reasons for disseminating the findings of research Reason Raise awareness of findings N (%) 21 6 (93) Influence policy 19 8 (85) Influence practice...
... 0. 01 0. 01 0. 01 0 . 14 0 . 14 Panel C: Random walk test for idiosyncratic risk (Ang et al 20 06) AC 0.39 0.30 0 .26 0. 21 0 .18 Q-statistic 29 .33 49 .80 66.65 80 .16 92. 04 10 3.69 11 4 .27 12 3.66 15 1 . 24 15 9.39 ... value of only 3.03 42 , and the standard deviation of GARCH beta is about one time bigger than that of OLS beta The mean of logarithm value of market capitalization (in million) is 5.6 346 , and 42 ... volatility in asset pricing has been largely ignored inthe literature This is hardly surprising, given that the traditional capital asset pricing model (CAPM; Sharp, 19 64; Lintner, 19 65; Black,...
... mối liên quan đơn giản tin cậy β tỷ suất sinh l i suốt giai đoạn 19 41 - 1965 Có 25 năm chọn l m mẫu nghiên cứu trước mô hình SLB Black, Jensen, Scholes (19 72) Fama MacBeth (19 73) Ngay cho giai đoạn ... Sharpe-Lintner-Black Black, Jensen, Scholes 19 72, Fama MacBeth 19 73, gần Chan Chen 19 88, kiểm định xa thích hợp Chúng kiểm tra vai trò quy mô β TSSL trung bình sàn chứng khoán NYSE n a kỷ 19 41 - 1990, ... Nhưng bảng AIV khác biệt kết cho 19 41 - 1965 19 6 619 90 la gạt Cân mạnh mẽ TSSL trung bình β hồi quy đơn khoảng thời gian 19 41 - 1965 10 năm đầu, 19 41 - 1950 Điều giai đoạn bảng AIV mà phát sinh l i trung...
... will assign the names phoenix and chimaera, all connected via a local area network (LAN) Let's also assume that hydra also hasa local inkjet printer connected to it, lp, and a disk share named ... was designed for small local area networks (LANs), and it let each machine claim a name (up to 15 characters) that wasn't already in use on the network By a "small LAN," we mean fewer than 25 5 ... a single Samba properties file: smb.conf In addition, if you want to get an idea of what each ofthe daemons are doing, Samba hasa program called smbstatus that will lay it all on the line Here...
... promoter via the bipartite EtsAP1 element Mol Endocrinol 11 , 11 29 11 44 40 Robinson, M.J & Cobb, M.H (19 97) Mitogen-activated protein kinase pathways Curr Opin Cell Biol 9, 18 0 18 6 41 Selvamurugan, N ... cells, c-Fos, Fra -1, and JunD ofthe AP -1 family and Ets -1, Ets -2 and Elf -1 ofthe Ets family are expressed constitutively (Fig 3A, and data not Fra -1 and the 2G SNP (Eur J Biochem 27 0) 4 21 9 shown) ... DNA hasthe AP -1 site at )16 02 bp and the sequence 5¢-GGAA-3¢ at )16 07 bp, conferring a consensus ETS site Fra -1 and the 2G SNP (Eur J Biochem 27 0) 4 21 7 Fra -1 has been implicated inthe regulation...
... genes in skeletal and cardiac myocytes Mol Cell Biol 28 , 65 21 6535 42 8 6 A Ray et al 23 Ray B K, Murphy R, Ray P & Ray A (20 02) SAF -2, a splice variant of SAF -1, acts as a negative regulator of transcription ... essential for cytokine-mediated transcriptional induction ofthe serum amyloid A gene in nonhepatic cells Mol Cell Biol 16 , 15 84 15 94 Ray BK, Shakya A & Ray A (20 07) Vascular endothelial growth factor ... CCATTCCAGgtgagtag 84 ctccgcagGCCGCGCCG 8 51 CTTCTCCCGgtgtgcac 40 3 gtccccagGCCGGATCA 64 AATGTGAGgtaggaag 27 7 ctcctcagAAATGTGAG 17 2 CAACAAAGgtacatgc 13 35 ctgtgcagGTACTGGTG 10 28 utilized for the primer...
... polymerase -1 Nat Cell Biol 3, 10 35 10 42 Kraus WL (20 08) Transcriptional control by PARP -1: chromatin modulation, enhancer-binding, coregulation, and insulation Curr Opin Cell Biol 20 , 29 4 3 02 ... increase ofthe cytosolic Ca2+ concentration and finally nuclear translocation of mitogen-activated protein kinase kinase ⁄ extracellular regulated protein kinase with cell cycle activation [ 34] ... effects of PARP -1 activation in endothelial, muscle and glial cells, as well as in infiltrating leukocytes, are different from those FEBS Journal 27 6 (20 09) 36 45 ª 20 08 The Authors Journal compilation...
... hypoxia-inducible factor 1alpha by insulin and interleukin-1beta involves the phosphatidylinositol 3-kinase pathway FEBS Lett 5 12 , 15 7 16 2 Fukuda R, Hirota K, Fan F, Jung YD, Ellis LM & Semenza GL (20 02) Insulin-like ... oxygenase -1 ina phosphatidylinositol 3-kinase-dependent manner J Biol Chem 27 8, 13 898 13 9 04 Martin D, Rojo AI, Salinas M, Diaz R, Gallardo G, Alam J, De Galarreta CM & Cuadrado A (20 04) Regulation of ... ina number of animal models of organ transplantation, including kidney [10 ], liver [11 ], heart [ 12 ] and small bowel [13 ], by virtue ofthe products ofthe reaction it catalyzes [ 14 ] Bilirubin...
... et al Duplicated crabp1 genes in zebrafish A B Exon Intron 24 aa Exon Intron 60 aa Exon 5 828 bp 23 aa 60 aa 60 aa 38 aa 60 aa 16 aa 12 22 bp 38 aa 22 77 bp 60 aa 511 bp 16 aa 747 0 bp 345 3 bp 5 54 ... bp 23 aa 16 aa 38 aa 6 815 bp 19 59 bp 23 aa Exon 326 2 bp 7 629 bp 23 aa Intron 38 aa 16 aa 4 313 bp 38 aa 29 25 bp 16 aa 4 328 bp Fig Alignment ofthe amino acid sequences ofthe fish and mammalian ... detected at relatively high levels inthe CNS of adult rats Am J Physiol Endocrinol Metab 28 2, E6 72 E678 Haskell GT, Maynard TM, Shatzmiller RA & Lamantia AS (20 02) Retinoic acid signaling at sites of...
... b-actin a Antisense primer (5¢)3¢) GenBank acc no AGAAGGCGCTGAAGGAGAAGGA ATGGGCCAATGTCCGCAGTGATGTC GAACCCTAAGGCCAACCGTGAAAAGAT CCAGCATGCCGAGGGAGTGA GGTGGCCTCTGATGCTTGCGTCGTCT ACCGCTCGTTGCCAATAGTGATG ... fat these multilocular cells completely disappear as the animals age These results also indicated a higher content of transgenic UCP1 in unilocular adipocytes in subcutaneous than in epididymal ... Bouillaud, F & Ricquier, D (19 94) In vitro interactions between nuclear proteins and uncoupling protein gene Ó FEBS 20 02 10 11 12 13 14 15 16 17 18 19 20 21 promoter reveal several putative transactivating...
... products as a novel marker of oxidative stress in uremia Kidney Int 19 96, 49 :13 04 -13 13 21 Shahin AA, Anwar S, Elawar AH, Sharaf AE, Hamid MA, Eleinin AA, Eltablawy M: Circulating soluble adhesion molecules ... (Sigma, St Louis, MO, USA) ina well and then added 20 lof acetic acid The absorbance ofthe reaction mixture was immediately read at 340 nm against a blank consisting of 20 0 lof phosphate-buffered ... patients (33 women and men), with a mean age of 57 ± 12 years and a mean disease duration of ± 4. 5 years ( 21 patients had a disease duration of less than years) The clinical and laboratory data...
... (panel B) and active TGF 1 (panel A) was maintained across all groups The substantial levels of latent TGF- 1in female rats at baseline and after CYP was accompanied by only minor levels of active ... http://www.journal-inflammation.com/content/6 /1/ 23 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 Perrella MA, Jain MK, Lee ME: Role of TGF-beta in vascular development and vascular reactivity Miner Electrolyte Metab 19 98, 24 :13 6 - 14 3 ... (endothelial NOS and neuronal NOS) as well as potentially from the stress to the animal from handling and transport to metabolic cage from animal facility These results may indicate an interplay among...
... p-values 1- 6 11 53 ± 10 3.0 11 25 ± 79.0 11 52 ± 10 2. 0 0.38b, 0 .49 c 7 - 12 13 75 ± 80.5 12 82 ± 82. 5 13 32 ± 72. 5 0 .23 7d 13 -18 15 45 ± 10 0.0 13 09 ± 89.0 15 49 ± 95.5 0. 016 d 19 - 24 15 92 ± 94. 5 12 02 ± 10 2. 5 14 97 ... with a sensitive cell line on the basis of activation of an integrated β-galactosidase gene J Virol 19 92, 66 :22 32- 223 9 11 Sharma PL, Chatis PA, Dogon AL, Mayers DL, McCutchan FE, Page C, Crumpacker ... Atlanta VA Medical Center DR is involved in HIV clinical research since past 20 years CC is Professor of Medicine at Harvard Medical School and has published several key papers inthe area of...