1 1 as a fixed point of a contraction
Báo cáo khoa học: "Evaluation of the fullerene compound DF-1 as a radiation protector" doc
... C60(OH)24 was previously evaluated as a protector of radiation and compared to amifostine in rats[27] This study evaluated histologic measures of radiation damage but did not evaluate lethality A recent ... survival analysis was performed in the MRC5, DU145, and MiaPaCa-2 cell lines DF -1 was delivered at 10 μM and 10 0 μM final concentration immediately prior to irradiation As shown in figure 1, DF -1 ... repeated three times and statistical analysis was done using a student's t-test Data are presented as mean ± SD A probability level of P < 0.05 was considered significant Statistical analyses of...
- 9
- 384
- 0
Báo cáo hóa học: "Research Article Convergence Theorems for the Unique Common Fixed Point of a Pair of Asymptotically Nonexpansive Mappings in Generalized Convex Metric Space" pptx
... convex Banach space,” Journal of the London Mathematical Society, vol 18 , no 1, pp 15 1 15 6, 19 78 Z Gu and Y Li, “Approximation methods for common fixed points of mean nonexpansive mapping in Banach ... 2067–20 71, 2009 Y.-X Tian, “Convergence of an Ishikawa type iterative scheme for asymptotically quasi-nonexpansive mappings,” Computers & Mathematics with Applications, vol 49, no 11 -12 , pp 19 05 19 12, ... Banach spaces,” Fixed Point Theory and Applications, vol 2008, Article ID 4 715 32, pages, 2008 W Takahashi, A convexity in metric space and nonexpansive mappings I,” Kodai Mathematical Seminar Reports,...
- 6
- 336
- 0
Báo cáo hóa học: " CONVERGENCE THEOREMS FOR A COMMON FIXED POINT OF A FINITE FAMILY OF NONSELF NONEXPANSIVE MAPPINGS" pdf
... 21, A1 357 A1 359 (French) C H Morales and J S Jung, Convergence of paths for pseudocontractive mappings in Banach spaces, Proc Amer Math Soc 12 8 (2000), no 11 , 3 411 –3 419 J G O’Hara, P Pillay, and ... extend and improve the corresponding results of O’Hara et al [8], Takahashi et al [11 ], and hence Bauschke [1] to more general Banach spaces and to the class of nonself -maps Preliminaries Let ... Soc 12 5 (19 97), no 12 , 36 41 3645 W Takahashi, T Tamura, and M Toyoda, Approximation of common fixed points of a family of finite nonexpansive mappings in Banach spaces, Sci Math Jpn 56 (2002),...
- 9
- 179
- 0
Báo cáo khoa học: "Combination therapy with docetaxel and S-1 as a first-line treatment in patients with advanced or recurrent gastric cancer: a retrospective analysis" docx
... 15 .2 11 .5 - 19 .0 0.4 91 м median 12 .8 7 .1 - 18 .4 Age Gender male 13 .2 9.8 - 14 .8 Female 16 .8 10 .7 - 22.8 0 -1 15.2 12 .0 18 .5 м2 7.6 - 16 .5 Advanced 15 .2 11 .7 - 18 .8 Recurrent 12 .1 9 .1 - 15 .1 differentiated ... Takagane A, Akiya T, Takagi M, Miyashita K, Nishizaki T, Kobayashi O, Takiyama W, Toh Y, Nagaie T, Takagi S, Yamamura Y, Yanaoka K, Orita H, Takeuchi M: S -1 plus cisplatin versus S -1 alone for ... Fluorouracil versus combination of irinotecan plus cisplatin versus S -1 in metastatic gastric cancer: a randomised phase study Lancet Oncology 2009, 10 :10 63 -10 69 Koizumi W, Narahara H, Hara T, Takagane...
- 7
- 407
- 0
Báo cáo y học: "Latent Membrane Protein 1 as a molecular adjuvant for single-cycle lentiviral vaccines" pot
... of California San Diego has filed patent applications for the use of LMP1 and LMP1-CD40 as vaccine adjuvants, naming GWS and RSK as inventors Page 11 of 12 Received: February 2 011 Accepted: 18 ... class of adjuvant for use in recombinant vaccine strategies In addition, LMP1 and LMP1 chimeras could be used as viral vector vaccine adjuvants or adjuvants for DNA or RNA based vaccines Use of ... at MOI Gupta et al Retrovirology 2 011 , 8:39 http://www.retrovirology.com/content/8 /1/ 39 Page of 12 A Plasma Membrane Plasma Membrane LMP1 LMP1 19 0 (LMP1) 220 (CD40) N N CD40 Cytoplasm Cytoplasm...
- 12
- 219
- 0
Báo cáo y học: "High mobility group box protein-1 (HMGB-1) as a new diagnostic marker in patients with acute appendicitis" potx
... literature have yet evaluated an association between HMGB -1 and AA HMGB1 (previously designated HMG1 or amphoterin) [12 ] is not a new protein It was discovered > 30 years ago as a nuclear DNA-binding ... TNF -a, IL- 1a, IL-1b, IL-1RA, IL-6, IL-8, MIP- 1a and MIP-1b, thereby promoting chronic inflammation [17 ,18 ] HMGB1 has been suggested to serve as a proinflammatory cytokine [19 ] and it has many ... 10 1:296-3 01 16 Abraham E, Arcaroli J, Carmody A, et al: HMG -1 as a mediator of acute lung inflammation J Immunol 2000, 16 5:2950-2954 17 Scaffidi P, Misteli T, Bianchi ME: Release of chromatin protein...
- 6
- 369
- 0
Báo cáo toán học: " Fixed point of generalized weakly contractive mappings in ordered partial metric spaces" docx
... (2 010 ) [5] Karapinar, E: Generalizations of Caristi Kirk’s theorem on partial metric spaces Fixed Point Theory Appl 2 011 (4) (2 011 ) doi :10 .11 86 /16 87 -18 122 011 -4 [6] Latif, A, Al-Mezel, SA: Fixed point ... = a1 p(x, y) + a2 p(f x, x) + a3 p(f y, y) + a4 p(f y, x) + a5 p(f x, y), a1 , a2 > 0, ≥ for i = 3, 4, 5, and, if a4 ≥ a5 , then a1 + a2 + a3 + a4 + a5 < 1, and if a4 < a5 , then a1 + a2 + a3 ... = a1 p(x, y) + a2 p(f x, x) + a3 p(f y, y) + a4 p(f y, x) + a5 p(f x, y), a1 , a2 > 0, ≥ for i = 3, 4, 5, and, if a4 ≥ a5 , then a1 + a2 + a3 + a4 + a5 < 1, and if a4 < a5 , then a1 + a2 + a3 ...
- 23
- 294
- 0
Báo cáo hóa học: "APPROXIMATION COMMON FIXED POINT OF ASYMPTOTICALLY QUASI-NONEXPANSIVE-TYPE MAPPINGS BY THE FINITE STEPS ITERATIVE SEQUENCES" pdf
... quasi-nonexpensive mappings, asymptotically nonexpensive mappings, asymptotically quasi-nonexpensive mappings, and asymptotically nonexpensive type-mappings are all special cases of asymptotically ... [11 ] K.-K Tan and H K Xu, Approximating fixed points of nonexpansive mappings by the Ishikawa iteration process, Journal of Mathematical Analysis and Applications 17 8 (19 93), no 2, 3 01 308 [12 ] ... Shahzad and A Udomene, Approximating common fixed points of two asymptotically quasinonexpansive mappings in Banach spaces, Fixed Point Theory & Applications 2006 (2006), Article ID 18 909, 10 pages...
- 8
- 156
- 0
Báo cáo toán học: " Fixed point theorems for contraction mappings in modular metric spaces" pptx
... many branches of mathematical analysis Banach contraction principle has been extended in many different directions, see [2 10 ] The notion of modular spaces, as a generalize of metric spaces, was introduced ... Ser I 15 (3–4), 202– 218 (19 61) [13 ] Yamamuro, S: On conjugate spaces of Nakano spaces Trans Amer Math Soc 90, 2 91 311 (19 59) [14 ] Luxemburg, WAJ: Banach function spaces Thesis, Delft, Inst of Techn ... metric spaces Comput Math Appl 62, 19 69 19 78 (2 011 ) [10 ] Sintunavart, W, Kumam, P: Common fixed point theorems for generalized J H-operator classes and invariant approximations J Inequal Appl 2 011 ,...
- 21
- 418
- 0
báo cáo hóa học: " Fixed point results for contractions involving generalized altering distances in ordered metric spaces" pptx
... Nashine et al Fixed Point Theory and Applications 2 011 , 2 011 :5 http://www.fixedpointtheoryandapplications.com/content/2 011 /1/ 5 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 ... is regular Nashine et al Fixed Point Theory and Applications 2 011 , 2 011 :5 http://www.fixedpointtheoryandapplications.com/content/2 011 /1/ 5 Page 10 of 16 (ii) T and S are weakly increasing with ... identity mapping Page 11 of 16 Nashine et al Fixed Point Theory and Applications 2 011 , 2 011 :5 http://www.fixedpointtheoryandapplications.com/content/2 011 /1/ 5 On the other hand, taking x = and y =...
- 16
- 257
- 0
Tài liệu Báo cáo khoa học: Mammalian Gup1, a homolog of Saccharomyces cerevisiae glycerol uptake/transporter 1, acts as a negative regulator for N-terminal palmitoylation of Sonic hedgehog doc
... Petersburg, FL, USA) followed by PCR with Taq DNA polymerase (Promega, Madison, WT, USA) using the primers 5¢-CACACTACACTGGGAAGCAGAGACTCCAGC-3¢ and 5¢-AGCTGGCCCAGCAGCCATACACAGTTAAAG3¢ The cDNA was subcloned ... buffer, and the eluted samples were subjected to western blot analysis as described above The authors thank Drs Masato Yasui, Sadakazu Aiso and Masaaki Matsuoka for support; Dr Andrew P McMahon ... 275, 10 995 11 0 01 Tanaka Hall TM, Porter JA, Beachy PA & Leahy DJ (19 95) A potential catalytic site revealed by the 1. 7Angstrom crystal structure of the amino-terminal signalling domain of Sonic...
- 14
- 499
- 0
Báo cáo khoa học: Alternative splicing: regulation of HIV-1 multiplication as a target for therapeutic action docx
... A1 , hnRNP E1 ⁄ E2 hnRNP A1 ASF ⁄ SF2 hnRNP A1 UUAGGACAUAUAGUUAGCCCUAGG unknown UGGGU CUAGACUAGA CCAGUAGAUCCUAGACUAGA GAAGAAGCGGAGACAGCGACGAAGA AGAUCCAUUCGAUUAG unknown UAGUGAAUAGAGUUAGGCAGGGA ... cells Proc Natl Acad Sci USA 91, 7 311 –7 315 32 Kamata M, Nitahara-Kasahara Y, Miyamoto Y, Yoneda Y & Aida Y (2005) Importin-alpha promotes passage through the nuclear pore complex of human immunodeficiency ... GAAGAAGAA UAGAAGAAGAA 4995–5 017 [5, 12 , 38, 40] 5362–5366 5428–5437 5 418 –5437 5558–5582 8047–8062 [48, 41, 15 , 17 , 8] A3 A5 A7 ISS ESE3 The HIV -1 encoded proteins Tat, which acts as a transactivator...
- 10
- 434
- 0
báo cáo hóa học:" Engagement of patients in religious and spiritual practices: Confirmatory results with the SpREUK-P 1.1 questionnaire as a tool of quality of life research" ppt
... relevant covariate for any of the five forms of SpR practice • Disease itself has an impact on NoP (and a minor impact on HuP and USP), while the duration of disease has no impact on the forms of ... 090 '15 7 1. 000 1. 000 056 1. 000 400 ** 465 ** 1. 000 - .16 7 311 ** 055 1. 000 16 6 5 81 ** 216 329 * 1. 000 1. 000 410 ** 1. 000 227 268 * 1. 000 083 313 * 16 4 1. 000 -.030 396 ** 15 3 015 1. 000 Bivariate ... http://www.hqlo.com/content/3 /1/ 53 Table 2: Mean values of the items from SpREUK-P 1. 1 and reliability parameters Factors and Items P2 P20 P19 P1 P13 P14 P 11 P15 P10 P16 P7 P4 P8 P6 P5 P23 P22 P24 P25 P26 P3 P17 P18 P9...
- 11
- 425
- 0
Báo cáo hóa học: " A DISCRETE FIXED POINT THEOREM OF EILENBERG AS A PARTICULAR CASE OF THE CONTRACTION PRINCIPLE" pptx
... there is also a variant of the BCP for self-maps of a non-Archimedean metric space proved by Prieß-Crampe [10 ] (also see Petalas and Vidalis [9]) It turns out that, in general, the contraction ... able to obtain only some particular cases of the contraction principle via a discrete argument Finally, we discuss a variant of ET given by Rus [11 ] (cf Remarks 2 .1 and 4.3) Proof of Eilenberg’s ... no 1, 17 9 18 6 , General solutions of two functional inequalities and converses to contraction theorems, Bull Polish Acad Sci Math 51 (2003), no 2, 14 7 15 6 C Petalas and T Vidalis, A fixed point...
- 6
- 268
- 0
Báo cáo y học: "A comparative study of the inhibitory effects of interleukin-1 receptor antagonist following administration as a recombinant protein or by gene transfer." pps
... situations, such as that reported in Figs and 5, the importance of maintaining the local level of IL-1Ra became dramatically apparent, as were the advantages of gene transfer as a means of protein ... inhibition was extrapolated to a concentration of approximately 230 ng/ml IL-1Ra and complete inhibition at approximately 800 ng/ml This translated to IL-1Ra : IL -1 ratios of approximately 46 : and 16 0 ... cellular level, the advantage of gene transfer as a means of drug delivery arises from the sustained availability of IL-1Ra that this method permits Materials and method Materials Ham’s F12 medium, Dulbecco’s...
- 9
- 421
- 0
báo cáo khoa học: "A non-healing corneal ulcer as the presenting feature of type 1 diabetes mellitus: a case report" pps
... stroma A morphometric analysis Arch Ophthalmol 19 89, 10 7 :15 20 -15 23 Sakamoto A, Sasaki H, Kitagawa K: Successful treatment of diabetic keratopathy with punctal occlusion Acta Ophthalmol Scand 2004, ... exclude undiagnosed diabetes mellitus Case presentation A 24-year-old southeast Asian woman was admitted with a history of a white spot on the right cornea and increasing discomfort On examination, ... and was found to be 23mmol/L A blood gas analysis showed a pH of 7.38, a partial pressure of carbon dioxide (pCO2) of 44.7mmHg, and a partial pressure of oxygen (pO2) of 89.5 mmHg She was transferred...
- 14
- 305
- 0
Báo cáo y học: "Subacute herpes simplex virus type 1 encephalitis as an initial presentation of chronic lymphocytic leukemia and multiple sclerosis: a case report" doc
... panel HA Ab (IgM) Non-reactive HBcAb (IgM) and HBsAg Non-reactive HC Ab Non-reactive LCMV IgG and IgM Ab titer
- 7
- 403
- 0
Báo cáo y học: "Characterization of the HIV-1 RNA associated proteome identifies Matrin 3 as a nuclear cofactor of Rev function" ppsx
... RIPA buffer (50 mM Tris-Cl; pH 7.5, 1% NP-40, 0.05% SDS, 15 0 mM CGAGATCCGTTCACTAATCGAATG B GGATTAACTGCGAATCGTTCTAGC C CGAGATCCGTTCACTAATCGAATG BA1 (b-actin) CATGTGCAAGGCCGGCTTCG BA4 (b-actin) GAAGGTGTGGTGCCAGATTT ... Retrovirology 2 011 , 8: 61 doi :10 .11 86 /17 42-4690-8-60 Cite this article as: Kula et al.: Characterization of the HIV -1 RNA associated proteome identifies Matrin as a nuclear cofactor of Rev function ... siGENOME SmartPool (UAGAUGAACUGAGUCGUUA, GACCAGGCCAGUAACAUUU, ACCCA GUGCUUGAUUAUGA, CCAGUGAGAGUUCAUUU AU), siGENOME Non-Targeting siRNA Pool #1 Either HeLa cells or 293T cells were transfected...
- 15
- 470
- 0
Báo cáo y học: " APOBEC3G-UBA2 fusion as a potential strategy for stable expression of APOBEC3G and inhibition of HIV-1 replication" pot
... U and M plasmid was 5'-ATCCAAGACGGAATTCGTTTTCCTGATTCTGGAG-3' The UBA2 gene fragment was amplified from plasmid pcDNA3.1HHR2 3A by PCR The 5' primer used was 5'ATCCAAGACGGAATTCACGCCGCAGGAGAAAGAAGCTATAG-3'; ... 5'ATCCAAGACGGAATTCACGCCGCAGGAGAAAGAAGCTATAG-3'; the 3' primer for the APOPEC3G-UBA2 fusion was 5'-ATCGTACTCGAAGCTTCTAACTCAGGAGGAAGTTGGCAG-3'; and the 3' primer for the APOPEC3G-UBA2* fusion was 5'-ATCGTACTCGAAGCTTCTAACTCAGagcGAAGTTGGCAG-3' ... defects caused by loss of the proteasome-interacting factors Rad23 and Rpn10 of Saccharomyces cerevisiae Genetics 19 99, 15 3 (1) :69-79 Hiyama H, Yokoi M, Masutani C, Sugasawa K, Maekawa T, Tanaka K,...
- 13
- 254
- 0
Báo cáo y học: "Ku protein as a potential human T-cell leukemia virus type 1 (HTLV-1) Tax target in clastogenic chromosomal instability of mammalian cells" ppt
... Claudio Friso and Renzo Mazzaro (Department of Biology, Padua) for technical assistance in the preparation of figures, members of the Jeang laboratory for critical reading of manuscript, and Anthony ... Biophys Acta 19 99, 14 30 :11 9 -12 6 Herceg Z, Wang ZQ: Functions of poly (ADP-ribose) polymerase (PARP) in DNA repair, genomic integrity and cell death Mutat Res 20 01, 477:97 -11 0 Ariumi Y, Masutani M, ... studies have shown that upon DNA damage, PARP -1 (a nuclear enzyme which catalyzes the polyADP-ribosylation of target proteins in response to DNA damage) and Ku proteins are rapidly activated and compete...
- 10
- 356
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008