Bài tập tổng hợp nhóm A1-17, A2-17, A3-17

The TaqMan probe assays used in this study allowed the detection of as little as 0.001% level of both species in the experimental meat mixtures, prepared by mixing chicken and turkey mea[r]

C:

Fo

od

Chemistr

y

Detection of Chicken and Turkey Meat in Meat Mixtures by Using Real-Time PCR Assays

Zulal Kesmen, Ahmet E Yetiman, Fikrettin S¸ahin, and Hasan Yetim

Abstract: In this study, TaqMan-based real-time Polymerase Chain Reaction (PCR) techniques were developed for the detection of chicken and turkey meat in raw and heat-treated meat mixtures Primers and TaqMan probe sets were designed to amplify 86 bp and 136 bp fragments for the chicken and turkey species, respectively, on the mitochondrial NADH dehydrogenase subunit gene In the results, it was possible to detect each species at the level of 0.1 pg template DNA with the TaqMan probe technique without any cross-reactivity with nontarget species (bovine, ovine, donkey, pork, and horse) while the detection level was pg template DNA using conventional PCR The TaqMan probe assays used in this study allowed the detection of as little as 0.001% level of both species in the experimental meat mixtures, prepared by mixing chicken and turkey meat with beef at different levels (0.001% to 10%) In conclusion, TaqMan probe assays developed in this research are promising tools in the specific identification and sensitive quantification of meat species even in the case of heat-treated meat products, and suitable for a rapid, automated, and routine analysis

Keywords: conventional PCR chicken, real-time PCR, species identification, TaqMan probe, turkey

Introduction

Food labelling regulations require accurate declaration of meat species on the labels of meat products Several of the analytical methods that have been developed to verify labelling statements regarding meat species rely mainly on protein and DNA anal-ysis However, protein-based methods including immunological assays (Kang’ethe and others 1986; Andrews and others 1992; Ansfield and others 2000), electrophoretical (Cota-Rivas and Vallejo-Cordoba 1997; Skarpeid and others 1998; ăOzgen-Arun and Ugur 2000), and chromatographic techniques (Chung and others 1998; Wissiack and others 2003) have limited success in cooked meat products In the recent past, DNA molecules have been used as target compounds for species identification due to their high stability and unique variability which allow the differ-entiation of closely related species Among DNA-based methods, Polymerase Chain Reaction (PCR) is an effective technique that is highly accurate and relatively fast The conventional qualita-tive PCR method has a satisfactory performance in the qualitaqualita-tive detection of meat species that are undesirable by consumers for health (for example, allergic reactions) reasons, ethnic, or religious values (Kesmen and others 2007) However, the need for methods that give quantitative results has arisen following the introduction of labelling obligations made by Authorised Food Control Agen-cies especially within the last decade Morever, quantification is also necessary for the detection of intentional adulteration of meat products or accidental contamination in the production line

Real-time PCR has demonstrated the highest improvement among PCR-based methods in recent years In real-time PCR, the exponential amplification of target-specific DNA is monitored

MS 20110728 Submitted 6/14/2011, Accepted 11/2/2011 Authors Kesmen, Yetiman, and Yetim are with Food Engineering Dept., Faculty of Engineering, Erciyes Univ., 38039 Kayseri, Turkey Author S¸ahin is with Bioengineering Dept., College of Engineering, Yeditepe Univ., 34755 Istanbul, Turkey Direct inquiries to author Kesmen (E-mail: zkesmen@erciyes.edu.tr).

by an increased fluorescence signal (Holland and others 1991) If the species under study is present in the matrix, a specific signal can be observed As well as meeting the need for quantitative deter-mination in meat species, this technique also has other advantages like higher sensitivity and specifity, a larger dynamic range of de-tection and less carry-over contamination risk (Rojas and others 2011; Yusop and others 2011)

Many applications are based on intercalating fluorescent dyes like SYBR Green (Walker and others 2003; L ´opez-Andreo and others 2006; Mart´ın and others 2009) This method requires the greatest sequence specificity due to the fact that these types of dyes bind to all double-stranded DNA present, including any nonspe-cific PCR products and the primer–dimer complex Therefore the real-time quantitative PCR procedure for species identification is generally based on the use of a TaqMan fluorogenic probe (Hird and others 2005; Rodriguez and others 2005; Kesmen and others 2009; K ăoppel and others 2011) This method utilizes an addi-tional primer, which is also bound specifically to the target DNA sequence during the annealing step This primer is an oligonu-cleotide with both a reporter fluorescent dye and a quencher dye attached The accumulation of specific PCR products is detected by hybridization and cleavage of a double-labelled fluorogenic probe during the amplification reaction

There are numerous PCR-based techniques available to iden-tify precisely the origin of poultry meat Some of these techniques include the restriction fragment length polymorphism (RFLP) of PCR products of mitochondrial 12S rRNA gene (Girish and others 2007), specific PCR (Rodr´ıguez and others 2003; Mane and others 2009), random amplified polymorphic DNA-PCR (RAPD-PCR) fingerprints (Calvo and others 2001; Saez and oth-ers 2004), and actin gene-related polymerase chain reaction (Hop-wood and others 1999) Generally, these methods offer qualitative or semi-quantitative measurement

Although numerous studies, based on real-time PCR, have been devoted to the identification of red meat animal species, studies for detecting poultry species are rare For example, Dooley and

C

C:

Fo

od

Chemistr

y

others (2004), Tanabe and others (2007), and Jonker and oth-ers (2008) detected chicken and turkey species with the TaqMan probe method by using the mitochondrialcytbgene and Laube and others (2007) used the interleukin-2 precursor gene to identify of these species To our knowledge, in poultry meat identification, there have been no reports on the use of real-time PCR analysis of the mitochondrial NADH dehydrogenase subunit (ND2) gene, which has sufficient degrees of mutation in many plants and an-imals Therefore, the aim of this study was to develope real-time PCR assays, by using mitochondrial ND2 gene variability, for the more reliable and sensitive detection of chicken and turkey meat in raw and heat-treated meat mixtures

Materials and Methods

Preparation of meat mixtures

Tissue from the skeletal muscle of chicken (Gallus gallus), turkey (Meleagris gallopavo) horse (Equus caballus), donkey (Equus asinus), pork (Sus scrofa domesticus), cattle (Bos taurus), and sheep (Ovis aries) were used Binary meat mixtures, containing chicken and turkey meat ranging from 0.001% to 10% levels (corresponding range of 0.001 to 10 ng target DNA), were prepared within a beef mixture To eliminate errors that usually occur during blending, beef was added to the mixture at a level of approximately 50% in each batch and blended for to obtain a thoroughly ho-mogeneous meat mixture each time when the target meats were diluted in the mixtures Patties of approximately 20 g were pre-pared at every level of the binary mixtures and were subjected to different heat treatments at 100, 150, and 200◦C for 30 in the oven after being covered with aluminium foil Afterwards, DNA isolation was carried out on the raw and oven-cooked samples

DNA isolation

To obtain a representative specimen, approximately 10 to 15 g raw and oven-cooked patty samples and pure meats from each species investigated were sampled in screw-top grinding jars and then powdered by using a mixer mill (Restch MM400, Germany) with a vibrational frequency of 30 Hz for after storing at –80 ◦C overnight The DNA was extracted from 25 mg of the powdered samples using a commercial kit (Qiagen, Hilden, Germany) according to manufacturer’s protocol and the DNA concentration was measured by the spectrophotometric method (Heptinstall and Rapley 2002)

Oligonucleotide primers and probes

Chicken and turkey specific primers and probe sets were de-signed using the mitochondrial ND2 (NADH dehydrogenase sub-unit 2) gene DNA sequence following the alignment of available sequences from the GenBank database with Clustal W (version 1.8) (Higgins and others 1992) (Figure 1) In addition, common sense and antisense primers and a probe set that was common to both mammalian and poultry were used to amplify a conserved region of 74 bp of the 16 sRNA gene to act as a control of am-plificability and false negativity on the PCR results (Kesmen and others 2009) Primers and probes, labelled 5-carboxyfluorescein (FAM) and fluorescent quencher (TAMRA), were purchased from Metabion (Martinsried, Germany)

Real-time PCR assay

The TaqMan PCR reaction was performed in a final volume of 25μL using 12.5μL of Quantitect Probe PCR mix (Qiagen),

100 ng template DNA, 0.4μM of each primer, and 0.15μM of the TaqMan probe Amplifications were performed on a Line Gene II PCR device (Bioer Technology Co., Hangzhou, China) and a thermal cycling protocol of 95 ◦C for 15 followed by 40 cycles with 15 s denaturation at 95 ◦C, and annealing/elongation at 60◦C was applied Reactions were replicated at least twice per experiment and experiments were replicated times to verify the results

PCR primers specificity and sensitivity test

The specificity of each species specific primer was confirmed by the amplification of 100 ng of chicken, turkey, horse, donkey, pork, bovine, and ovine genomic DNA, and a negative control without DNA Each assay was tested against DNA from all seven species, that is, against its target species and the remaining species to confirm assay specificity In sensitivity tests of the specific primers and probes, PCR amplifications were examined between specific primers and 10-fold serial dilutions of DNAs isolated from the meat of each target species ranging from 100 to 0.0001 ng/μL water The standard curves for both detection systems were con-structed by using the ct value obtained from the corresponding DNA concentration

Conventional PCR protocol

The PCR amplification reaction was performed in a 50μL vol-ume containing 100 ng template DNA, 25μL commercial PCR master mix (Qiagen), and 0.8μM of each primer After an initial denaturation step at 94◦C for 10 min, 40 thermal cycles were car-ried out (Line Gene II PCR) as follows: melting at 94◦C for 50 s, annealing at 53 and 55◦C for chicken and turkey, respectively, ex-tension at 72◦C for min, with a final elongation step at 72◦C for 10 The products of PCR amplification were electrophoreti-cally determined on a 2.5% agarose gel containing ethidium bro-mide (0.5μg/mL) in 1XTAE buffer (Tris–Acetate–EDTA buffer) and visualized by UV transillumination

Results

In this study, conventional PCR and real-time PCR assays, based on the amplification of fragments of the mitochondrial ND2 gene, were developed and evaluated for the detection and quantification of chicken and turkey meat in raw and heat-treated meat mixtures Species specific primers and TaqMan probes were designed, and amplification conditions were optimized by using these primers and probes

Specificity of the TaqMan probe systems

The specificity of both detection systems were tested for common and commercial meat species; chicken, turkey, pork, horse, donkey, bovine, and sheep The primers generated species specific fragments of 80 and 137 bp length for chicken and turkey, respectively, whereas no cross-reaction was obtained with any of the nontarget species DNA (Table 1) The common primer–probe system amplified a 74 bp fragment and calculated ct values of 15.98, 16.10, 15.61, 15.03, 18.14, 15.78, and 18.57 from horse, donkey, pork, bovine, ovine, chicken, and turkey mitochondrial DNAs, respectively

Sensitivity and linearity of taqman probe system

C:

Fo

od

Chemistr

y

values compared with the logarithm of the target DNA concen-tration to test linearity (Figure 2) The correlation between the variables, ct and logarithm of template DNA concentrations of chicken and turkey, gave determination coefficient values of 0.9965 and 0.9944, respectively These results indicate that the presence of a linear relationship between the ct values and DNA concentrations, in the range of 100 ng to 0.0001 ng for each species tested For both primer–probe systems, the amplification curves were apparently observed even in the level of 0.0001 ng DNAs of target species (corresponds to 0.0001%) when the high-quality DNA template (highly pure and non-degrade) was used (Table 1) The efficiency of the primer–probe system developed specifically for the chicken and turkey species were 109% and 110%, respec-tively As is well known, an acceptable range to determine the efficiency of the PCR reaction (Efficiency=–1+10[−1/slope]), which is a function of the standard curve slope, is between 90% and 110%

Real-time PCR analysis of meat species in meat mixtures

No statistically significant difference was found in the ct values of raw and heat-treated meat mixtures in either the chicken or turkey specific real-time PCR systems Heat treatment and temperature did not have any significant effect on ct values in either species (Table 2) The average ct values of raw and heat-treated mixtures containing chicken meat at the level of 0.001%, 0.01%, 0.1%, 1%, 10% were determined as follows: 30.77, 28.31, 26.17, 23, and 20.45, respectively, and for turkey they were 34.43, 32.40, 28.34, 26.29, and 22.37 The ct values corresponding to the DNA concentration of the target species showed a linear change in all raw and heat-treated meat mixtures, and for all samples the correlation coefficient changes were between 0.986 and 0.996

Results of conventional PCR

The agarose gel images of PCR products, obtained from con-ventional PCR reactions carried out with chicken and turkey spe-cific PCR primers, are shown in Figure and The sensitivity of primers specific to both species was tested in all dilution levels,

from 0.0001% to 100%, of DNAs of the target species Con-sequently, it was determined that the specific primer sets could detect both species up to the level of 0.001% (0.001 ng DNA in water) without nonspecific reaction with other tested species In all the raw and heat-treated samples prepared from binary meat mixtures, chicken and turkey species were detected up to the level of 0.01% In the conventional PCR method, heat processing up to 200◦C did not have any effect on detection limit

Discussion

The use of the real-time PCR method in food analysis in recent years has concentrated especially the on quantitative detection of the origins of vegetal and animal tissues in complex food mix-tures (Palmieri and others 2009; K ăoppel and others 2011) In this context, the TaqMan probe method in the real-time PCR tech-nique is a very powerful techtech-nique in terms of both specifity and sensitivity in species detection The specifity of this method pri-marily depends on the specifity of the primer and probe used Table 1–Specifity and sensitivity test results obtained with the species specific primer–probe sets.

Average ct value±SD DNA

Species concentration (ng) Chicken Turkey

Target species 0.0001 36.64±0.59 37.82±0.41 0.001 33.95±0.24 35.38±0.32 0.01 30.78±0.43 32.50±0.54 0.1 27.62±0.61 29.64±0.44 24.7±0.35 26.24±0.26 10 21.9±0.47 22.02±0.39

Chicken 100 17.52±0.34 40.00

Turkey 100 40.00 19.75±0.21

Horse 100 40.00 40.00

Donkey 100 40.00 40.00

Pork 100 40.00 40.00

Bovine 100 40.00 40.00

Ovine 100 40.00 40.00

CT of 40 indicates no amplification

Species CF CP CR Chiken

Horse Donkey Pork Bovine Ovine

Turkey

tatctcctataacccacaactcactattctcaccttcatcctctacacaattatgacctcaactgtattcctatccctag a cc.agta ac ta a a a.a.a.at.aa.t tt a a actc aa a ctat.tat c.g ct.agtg c ac tg a a a.a.a.ac.aa.t tt a a actc aa a ctgt.tat c.g at.ac.a c a accata a ct.a.a.c.ac.aa.t tc.ca a act.g.aa a ctat.aat c.g ac.ac.a accata at.g a.a a ta t.tc t a tt.c ca taccatat.tatagcc.at t.acta t accata ac.a a.a.c.a ta.t t.tc t a ct.t ca tac.ctat.tatagcc.a c tat cg t.tt c tgcat.g tt c.a a aa ca t at acccagatc

TF TP

Chiken Horse Donkey Pork Bovine Ovine

Turkey

a g a c t c a a g aa.c ctcc tcctctact.c.acact.t c.ctc.ca.a ac t c acc.c.a cta ct a a.ct.a ca tcctctacc.c.acact.t c.ctcaca.a ac g c a.c.cca cta cc a.ca.ct.g a tc.gcaacc.c.act.t.t.cc tc.cata ac t cg.ca.c.caagccta g.aa.c a c aa tccac.acc.ctac.ctgt t tcaca.a at c ta.a.cc.tccta tc.tgcca.t ca tc.ac.aca.ccac.ct.t t tcaca.a at g c ca.a.caattctag.cc.ca a.c aa aaagtcctg.aactctcaa.aatactcatct ca acacctatacttaatgcaactataatacttgcactcctatctc

TR

C:

Fo

od

Chemistr

y

In previous studies where the PCR technique was used in meat and meat products, target regions were generally selected from mitochondrial DNA (mtDNA) because mtDNA has many more advantages than nuclear DNA for species detection studies in meat products For example, mtDNA has many copies within each cell when compared to nuclear mtDNA (Alberts and others 1994) Since mtDNA is transferred to an individual maternally, ambigui-ties caused by heterozygote genotypes are generally not a problem (Hayashi and Walle 1985) In addition, mtDNA is more resistant to fragmentation by heat when compared to nuclear DNA, and

relatively higher mutation rate of mitochondrial genes is adequate for the differentiation of even closely related species (Kocher and others 1989) In general,cytb(Dooley and others 2004; Hird and others 2005), D-loop (Monteil-Sosa and others 2000), 12S rRNA (Rodriguez and others 2005; Girish and others 2007; Mart´ın and others 2009), and 16S rRNA (Sawyer and others 2003) genes have been used in species detection on mitochondrial DNA However, in this study, the mitochondrial ND2 gene was used in the design of a species specific primer and TaqMan probes for the detection of chicken and turkey species because the mutation degree of this

y = -3,1264x + 24,461

R2 = 0,9965

Log ( DNA Concentration [ng])

Ct

a Chicken

b Turkey

y = -3,1139x + 25,936 R² = 0,9944

Log ( DNA Concentration [ng])

Ct

Figure 2–Standard curve showing the ct values in relation to the concentration of initial target gene copies, obtained by a serial 10-fold dilution of each species (ranged from 0.0001 to 100 ng DNA) a) Total of 10-fold dilution series of chicken DNA b) Total of 10-fold dilution series of turkey DNA

Table 2–Results of the experimental raw and heat-treated meat mixtures.

Average ct value±SD Target The ratio of target species in

species the binary mixture (%) Raw samples 100◦C 150◦C 200◦C

C:

Fo

od

Chemistr

y

gene is sufficient for specific primer and probe design (Herman 2001; Kesmen and others 2009) The differentiation of chicken from turkey meat is challenging since they are closely related species and have a high degree of sequence homology However, in this study, chicken primer had base differences in each sense and antisense primer and 10 base differences in the probe when compared to the turkey sequences Similarly, the turkey primer had 13 base differences in the sense primer, base differences in the antisense primer, and base differences in the probe when compared to the chicken sequences Therefore, no cross-reaction was observed and highly specific detection was carried out thanks to the high specifity of the primer and probe designed A com-mon meat-specific PCR system was used to detect mammalian and poultry species on the basis of a region of the 16 sRNA gene to exclude probable false negative results Thus, the amplification control TaqMan probe system served for the purpose of checking

the quality of the nucleic acids extracted and could be applied prior to the specific detection of chicken and turkey Using the common primer probe system, specific for mammals and poultry, the DNA of all species studied could be amplified and clearly detected

In the results of the sensitivity test, which was carried out using a series of DNA dilutions from the chicken and turkey species, in different concentrations varying between 0.0001% to 100% in water, both species were detected at the level of 0.0001% (0.0001 ng DNA/μL water) with TaqMan probe technique How-ever, in the conventional PCR method, the detection limit was found to be 10 times lower (0.001%) than the real-time PCR method When reaction components or conditions are optimized to detect lower levels, non-specific reactions with other tested ani-mal species occur As DNA concentration decreases, band intensity also decreases; this situation enables semiquantitative detection by

Figure 3–The result of PCR specificity and sensitivity test and conventional PCR analysis of raw and heat-treated samples for the specific chicken primers: M: Marker, H: Horse, D: Donkey, P: Pork, B: Bovine, S: Sheep, T: Turkey, D1-D6: 10-fold dilution of chicken DNA in water (D1: 100 ng DNA,

D2: 10 ng DNA, D3: ng DNA, D4: 0.1 ng DNA, D5: 0.01 ng DNA, D6: 0.001 ng DNA), R1-R5: raw samples, A1-A5: Heat-treated samples at 100◦C, B1-B5:

Heat-treated samples at 150◦C, C

1-C5: Heat-treated samples at 200◦C, (1: chicken 100%+beef 0%;2: chicken 10%+beef 90%;3: chicken 1%+

beef 99%;4: chicken 0.1%+beef 99.9%;5: chicken 0.01%+beef 99.99%)

Figure 4–The result of PCR specificity and sensitivity test and conventional PCR analysis of raw and heat-treated samples for the specific turkey primers: M: Marker, H: Horse, D: Donkey, P: Pork, B: Bovine, S: Sheep, C: Chicken, T1-T6: 10-fold dilution of turkey DNA in water (D1: 100 ng DNA, D2: 10 ng DNA,

D3: ng DNA, D4: 0.1 ng DNA, D5: 0.01 ng DNA, D6: 0.001 ng DNA), R1-R5: Raw samples, A1-A5: Heat-treated samples at 100◦C, B1-B5: Heat-treated

samples at 150◦C, C

1-C5: Heat treated samples at 200◦C, (1: turkey 100%+beef 0%;2: turkey 10%+beef 90%;3: turkey 1%+beef 99%;4: turkey

C:

Fo

od

Chemistr

y

comparing standard concentrations of DNA with samples’ band intensities

No statistically significant difference was found in the ct values obtained from the heat-treated samples compared to raw samples In the real-time PCR method, the chicken and turkey species could be detected in all samples subjected to 100, 150, and 200◦C at the level of 0.001% Since the regions amplified with primers designed specifically for chicken and turkey were shorter than 150 bp, therefore, they were considered not to be affected by heat treatment On the other hand, since the internal temperature did not rise above 100 ◦C in the oven-cooked samples under normal atmosphere conditions, it was considered that even if a temperature up to 200◦C was applied, DNA would not suffer much damage In addition, if heat processing is applied under pressure (in autoclave), the damage is estimated to be more and ct values are expected to rise The ct values detected in nearly all raw and heat-treated mixtures were to ct lower than that of the values attained for the equivalent levels of DNA dilutions in water (Table 1)

In the conventional PCR method, chicken and turkey species in raw and heat-treated meat mixtures were detected up to the level of 0.01% While the heat processing did not have any neg-ative effect on the detection of chicken and turkey species, the detection limit was 10 times lower than that of the real-time PCR method The presence of undeclared species below 0.1% in meat products is generally considered to be the result of accidental con-tamination because it is not economical Therefore, the detection limits obtained using both conventional PCR and real-time PCR are efficient enough to detect accidental contamination but since the conventional PCR method is not quantitative, it can not iden-tify meat species adulteration by either accidental or intentional practice

As a result, species specific real-time PCR assays developed in this study showed a high linearity over a wide range of tem-plate concentrations that enables a consistent and precise deter-mination of target DNA within all tested meat mixtures Purity of nucleic acid templates is particularly important for real-time PCR, since contaminants can interfere with fluorescence detec-tion Therefore, in this study, a commercial DNA isolation kit was used to minimize errors that may have arisen from DNA isola-tion By the isolation method, where DNA is attached to a silica matrix, both PCR inhibitors and impurities that result in false positive results by causing probe degradation during the real-time PCR assay were considered to be substantially removed In this study, commercial master mix was used in real-time PCR and conventional PCR reactions So, not only the time was saved and but also the accuracy, repeatability, and its suitability for the routine analysis were increased while the standardization was simplified

Conclusions

In this study, we developed real-time PCR techniques, for the specific and quantitative detection of chicken and turkey species in raw and heat-treated meat mixtures Species specific primer–probe sets were designed by using variability of the ND2 gene on mito-chondrial DNA for both species The detection limit in raw and heat-treated meat samples for both species using the conventional PCR technique was 10 times lower than that of the real-time PCR technique

Heat-treatment up to 200 ◦C did not have any negative ef-fect on the detection of either species That the internal tem-perature did not go over 100 ◦C during heat processing

un-der normal atmosphere pressure was significant as well as the fact that the size of the amplicon produced by the designed primers, which was comparatively short (<150 bp), influenced the situation

As a result of this study, the detection limit of both techniques was sufficient to detect accidental contamination (<0.1%) in meat products However, the real-time PCR method performed bet-ter due to the fact that it was more sensitive, practical and less time-consuming as well as providing quantitative data for labelling purposes

References

Alberts B, Bray D, Lewis J, Raff M, Robets K, Watson JD 1994 Molecular biology of cell 3rd ed New York and London: Gorland Publishing Inc

Andrews CD, Berger RG, Mageau RP, Schwab B, Jhonston RW 1992 Detection of the beef, sheep, deer, and horse meat in cooked meat products by enzyme-linked immunosorbent assay J AOAC Int 75:572–6

Ansfield M, Reaney SD, Jackamn R 2000 Production of a sensible immunoassay for detection

of ruminant and porcine proteins, heated to>130◦C at 2.7 bar, in compound animal feedstuff

Food Agric Immunol 12:273–84

Calvo JH, Zaragoza P, Osta R 2001 Random amplified polymorphic DNA fingerprints for identification of species in poultry pˆat´e Poul Sci 80:522–4

Chung GS, Lee MH, Kim JM, Park JM 1998 Differentiation the species of origin of meats on the basis of the contents of histidine dipeptides in muscle J Vet Sci 40:1–6

Cota-Rivas M, Vallejo-Cordoba BV 1997.Capillary electrophoresis for meat species differenti-ation J Capil Electrophor 4(4):195–9

Dooley JJ, Paine KE, Garrett SD, Brown HM 2004 Detection of meat species using TaqMan real-time PCR assays Meat Sci 68:431–8

Girish PS, Anjaneyulu ASR, Viswas KN, Santhosh FH, Bhilegaonkar KN, Agarwal RK, Kondaiah N, Nagappa K 2007 Polymerase chain reaction–restriction fragment length poly-morphism of mitochondrial 12S rRNA gene: a simple method for identification of poultry meat species Vet Res Comm 31:447–55

Hayashi J, Walle MJVD 1985 Absence of extensive recombination between inter and intraspecies mitochondrial DNAin mammalian cells Experim Cell Res 160:387–95

Heptinstall J, Rapley R 2002 Spectrophotometric analysis of nucleic acids In R Rapley, editor The nucleic acid protocols handbook pp 57–60 Totowa, N.J.:Humana Press

Herman L 2001 Determination of animal origin of raw food by species-species PCR J Dairy Res 68:429–36

Higgins DG, Bleasby AJ, Fuchs R 1992 CLUSTAL W: improved software for multiple sequence alignment Comp Appl Biosci 8:4420–49

Hird H, Chisholm J, Brown J 2005 The detection of commercial duck species in food using a single probe-multiple species-specific primer real-time PCR assay Eur Food Res Technol 221:559–63

Holland PM, Abramson RD, Watson R, Gelfand DH 1991 Detection of specific polymerase chain reaction product by utilizing the 5’- 3’ exonuclease activity of Termus aquaticus DNA polymerase Proc Nat Acad Sci 88:7276–80

Hopwood AJ, Fairbrother KS, Lockley AK, Bardsley RG 1999 An actin gene-related poly-merase chain reaction (PCR) test for identification of chicken in meat mixtures Meat Sci 53(4):227–31

Jonker KM, Tilburg JJHC, HăaGele GH, De Boer E 2008 Species identification in meat products using real-time PCR Food Add Contam 25(5):527–33

Kang’ethe EK, Gathuma JM, Lindqvist KJ 1986 Identification of the species of origin of fresh, cooked and canned meat on meat products using antisera to thermostable muscle antigens by Ouchterlony’s double diffusion test J Sci Food Agric 37:157–62

Kesmen Z, Gulluce A, Sahin F, Yetim H 2009 Identification of meat species by TaqMan-based real-time PCR assay Meat Sci 82:444–9

Kesmen Z, Sahin F, Yetim H 2007 PCR assay for the identification of animal species in cooked sausages Meat Sci 77(4):649–53

Kocher TD, Thomas WK, Meyer A, Edwards SV, Păaăabo S, Villablanca FX, Wilson AC 1989 Dynamics of mitochondrial DNA evolution in animals: amplification and sequencing with conserved primers Proc Nat Acad Sci USA 86:6196–200

K ¨oppel R, Ruf J, Rentsch J 2011 Multiplex real-time PCR for the detection and quan-tification of DNA from beef, pork, horse and sheep Eur Food Res Technol 232: 151–5

Laube I, Zagon J, Spiegelberg A, Butschke A, Kroh LW, Broll H 2007 Development and design of a ‘ready-to-use’ reaction plate for a PCR-based simultaneous detection of animal species used in foods Int J Food Sci Technol 42:9–17

L ´opez-Andreo M, Garrido-Pertierra A, Puyet A 2006 Evaluation of postpolymerase chain reaction melting temperature analysis for meat species identification in mixed DNA samples J Agric Food Chem 54(21):7973–8

Mane BG, Mendiratta SK, Tiwari AK 2009 Polymerase chain reaction assay for identification of chicken in meat and meat products Food Chem 116:806–10

Mart´ın I, Garc´ıa T, Fajardo V, Rojas M, Pegels N, Hern´andez PE, Mart´ın IG 2009 SYBR-Green real-time PCR approach for the detection and quantification of pig DNA in feedstuffs Meat Sci 82:252–9

Monteil-Sosa JF, Ruiz-Pesini E, Montoya J, Roncales P, L ´opez-P´erez MJ, P´erez-Martos A 2000 Direct and highly species-specific detection of pork meat and fat in meat products by PCR amplification of mitochondrial DNA J Agric Food Chem 48: 282932

ă

Ozgen-Arun O, Ugur M 2000 Animal species determination in sausages using an SDS–PAGE technique Archiv fur Lebensmittelhygiene 51:49–53

Palmieri L, Bozza E, Giongo L 2009 Soft fruit traceability in food matrices using real-time PCR Nutrients 1:316–28

C:

Fo

od

Chemistr

y

in foie gras by species-specific polymerase chain reaction J Agric Food Chem 51: 1524–9

Rodriguez MA, Garc´ıa T, Gonz´alez I, Hern´andez PE, Mart´ın R 2005 TaqMan real-time PCR for detection and quantitation of pork in meat mixtures Meat Sci 70:113–20

Rojas M, Gonz´alez I, Pav ´on M ´A, Pegels N, Hern´andez PE, Garc´ıa T, Mart´ın R 2011

Appli-cation of a real-time PCR assay for the detection of ostrich (Struthio camelus) mislabelling in

meat products from the retail market Food Control 22(3–4):523–31

Saez R, Sanz Y, Toldr´a F 2004.PCR-based fingerprinting techniques for rapid detection of animal species in meat products Meat Sci 66:659–65

Sawyer J, Wood C, Shanahan D, Gout S, McDowell D 2003 Real-time PCR for quantitative meat species testing Food Cont 14:579–83

Skarpeid HJ, Kvaal K, Hildrum KI 1998 Identification of animal species in ground meat mix-tures by multivariate analysis of isoelectric focusing protein profiles Electrophoresis 19:3103–9

Tanabe S, Hase M, Yano T, Sato M, Fujimura T, Akiyama H 2007 Real-time quantitative PCR detection method for pork, chicken, beef, mutton, and horseflesh in foods Biosci Biotechnol Biochem 71:3131–5

Yusop MHM, Mustafa S, Che Man YB, Omar AR, Mokhtar NFK 2011 Detection of raw pork targeting porcine-specific mitochondrial cytochrome b gene by molecular beacon probe real-time polymerase chain reaction Food Anal Meth DOI:10.1007/s12161-011-9260-y Walker JA, Hughes DA, Anders BA, Shewale J, Sinha SK, Batzer MA 2003 Quantitative

intra-short interspersed element PCR for species-specific DNA identification Anal Biochem 316:259–69