Nghiên cứu xây dựng công nghệ xử lý nước thải axit (AMD) từ hoạt động khai thác và chế biến khoáng sản bằng biện pháp sinh học

98 10 0
  • Loading ...
1/98 trang

Thông tin tài liệu

Ngày đăng: 20/11/2019, 23:21

PHẦN I THÔNG TIN CHƯNG 1.1 Tên đề tài: Nghiên cứu xây dựng công nghệ xử lý nước thải axit (AMD) từ hoạt động khai thác chế biến k h o n o sản bàng biện pháp sinh học Mã số: Q G.15.33 1.3 Danh sách chủ trì, thành viên tham gia thực đề tài — TT jo Chức danh, học vị, họ tên TS Đinh Thúy Hãng ThS Nguyên Thị Hiêu Thu ThS NCS Nguyễn Thị Hải CN Nguyên Văn Hưne Đon vị công tác Viên v sv Viên v s v Viên v sv Viện vsv & CNSH & CNSH & CNSH & CNSH Vai trò thực đề tài Chủ nhiêm đê tài Thành viên thực hiện, thư ký Thành viên thưc hiện, NCS Thành viên thưc hiên 1.4 Đon vị chủ trì: Viện Vi sinh vật Cơng nghệ sinh học, ĐHQGHN 1.5 Thòi gian thực hiện: 24 tháng 1.5.1 Theo họp đồng: từ tháng năm 2015 đến tháng năm 2017 5.2 đến tháng năm Gia hạn (nếu có): 1.5.3 Thực thực tế: từ tháng năm 2015 đến tháng năm 2017 1.6 Những thay đổi so vói thuyết minh ban đầu (nếu có): (Ve mục tiêu, nội dung, phương pháp, kết quà nghiên cứu tô chức thực hiện; Nguyên nhún; Y kiến cua Cơ quan quàn lỷ) 1.7 Tống kinh phí phê duyệt đề tài: 200 triệu đồng PHÀN II TỐNG QUAN KÉT QUẢ NGHIÊN c ứ u Viết theo cấu trúc báo khoa học tổng quan từ 6-15 trang (báo cáo đăng trẽn tạp chí khoa học ĐHQGHN sau đề tài nghiệm thu), nội dung gôm phân: Đ ặt vấn đề Ngành khai thác khống sản nước ta chiếm vị trí quan trọng kinh tế, đóng góp tới 5,6% GDP Tuy nhiên mối nguy hại ô nhiễm nước thải từ mỏ khai thác khoáng sản đặt mức báo động (Báo cáo Đánh giá môi trường chiến lược Quy hoạch phát triển ngành Vinacomin đến năm 2020) Tổng lượng nước thải từ mỏ năm 2009 ước tính 38.914.075 m3, nhiên số chưa phàn ánh đầy đủ thực trạng chưa tính đến lượng nước rửa trơi lớn từ bãi thải mỏ (Hồ Sỹ Giao, Mai Thế Tồn, 2010) Hoạt động khai thác khống sản tạo điều kiện cho quặng sulfide tiếp xúc với oxy, dân đên việc oxy hóa thành phần khống pyrite quặng hòa tách ion sắt từ quăng Đồng hành q trình này, kim loại khác có mặt quặng hòa tách, dẫn đên việc tạo dòng thải mò axit có chứa nhiều kim loại nặng (AMD - Acid Mine Drainage) Như AMD có hai điểm đặc trưng pH thấp (thường mức - 3), hòa tan nhiều kim loại nặng khác nồng độ cao (tới hàng trăm ppm), độc sinh vật môi trường nước đất quanh khu vực khai thác mỏ (Johnson, Hallberg, 2005) Biện pháp sinh học sử dụng vi khuẩn khử sulfate (SRB) để xử lý nước thải có hàm lượng kim loại nặng cao đưa vào áp dụng từ năm 1950 (Sheoran et CIỈ., 2010) SRB vi khuẩn sinh trưởng kỵ khí, sừ dụng sulfate làm chất nhận điện tử cuối để oxy hóa hydro hay hợp chất hữu tận thu lượng cho mục đích sinh trưởng (Rabus et a i, 2006) Bê phản ứng khử sulfate sinh học (bê SR) công nghệ xử lý thụ động sử dụng vi khuân khử sulfate (SRB) tạo sản phẩm trao đổi chất sulfide để kết tủa ion kim loại dạng muôi sulfide, đồng thời tăng pH mơi trường Cơ chế hóa học trình xử lý AMD nhờ vi khuân khứ sulfate minh họa qua phương trình sau (Gusek, 2002): CH20 + SO,2- -> H2S+ HCO3" H2S + Me2+ — MeS + 2H+ Công nghệ ứng dụng rộng rãi việc loại kim loại nặng nước thái AMD có hiệu cao thân thiện với môi trường Nhiều kim loại sắt, chì, đơng, nikel, cadmium kẽm kết tủa dễ dạng dạng muối sulfide, nhiên số kim loại khác kim molvbden, arsen antimony thường tạo phức hợp với sulfide (Figueroa, 2005) Ngồi ra, arsen uranium vi khuẩn khử sulfate sử dụng làm chất nhận điện tử cuôi để oxy hóa hợp chất hữu đơn giản, qua khử dạng tan nước uranium (VI) khử thành uranium (IV) (Spear, 2000), arsen (VI) thành arsen (V) (Macy et al., 2000) Bên cạnh đó, tăng pH nhờ sản phẩm trao đổi chất SRB HCO 3- HS~ tạo điêu kiện thích hợp cho q trình kêt tủa kim loại nặng dạng hydroxide muôi carbonate Để vận hành bể xử lý khử sulfate sinh học cách hiệu quả, hiệu điện oxy hóa khử bể cần trì mức -200 mV, thích hợp cho hai q trình khử sulfate khử Fe3+ (Cabrera et al., 2006) Be SR sinh học khơng hoạt động nhiệt độ ấm mà hoạt động nhiệt độ thấp, chí °c, lồi SRB ưa ấm loài chịu lạnh thuộc chi Desul/ơvibrio spp., Desulfobulbus spp tìm thấy chiếm un thê (Zhang Wang, 2016; Bomberg et cii; 2015) Cơ chất phù hợp cho SRJB axit béo mạch ngắn lactate, acetate, propionate rượu (Logan el al., 2005) Trong bể SR sinh học, chất giá thể cho SRB thường nguyên liệu có thành phần phức tạp phoi bào, rơm rạ, thành phân cellulose thủy phân lên men để tạo hợp chất cacbon đơn giản thích hợp cho SRB (Logan et a i, 2005) Trong số trường họp, chất hữu dạng dịch thể methanol hay ethanol bổ sung vào bể SR sinh học, nhiên làm tăng giá thành vận hành toàn hệ thống (Tsukamoto et al., 2004) Do AMD có pH thấp, khả chịu axit đặc tính ưu cua SRB tham gia vào trình xử lý loại nước thải SRB biết đến với khả sinh trưởng biên độ pH rộng, thực tốt q trình khử sulfate pH - 4, khả giảm mạnh pH < 3,5 (Jong, Paưy, 2006) Để trì hoạt tính SRB mức cao tạo điều kiện tơt cho q trình kết tủa sulfide kim loại, pH nước thải đưa vào bể phản ímg khử sulfate cần điều chỉnh tới mức ~ Vì việc đưa nguồn vi khuẩn khử sulfate có khả chịu pH thấp vào hệ thống xử lý AMD làm tăng hiệu xử lý (Johnson, Halỉberg, 2005) Bên cạnh đó, hàm lượng kim loại nặng yếu tố ức chế quan trọng trình khứ sulfate Nghiên cứu thực chủng SRB khiết cho thấy hàm lượng ion kim loại nặng cao hạn chế sinh trưởng SRB, chí gây chết (Cabera et a i, 2006) Tố hợp SRB thể tính bền vững cao chủng khiết điều kiện mơi trường có hàm lượng kim loại nặng cao (Cabera et al., 2006) Giới hạn số kim loại nặng (nồng độ hòa tan nước) trình khử sulfate (EC 100) xác định sau: kẽm, 20 mg/L; crom, 60 mg/L; chì 75 mg/L (Hao et al., 1996; Ưtgikar et a i, 2001) Như vậỵ nguồn SRB phù hợp cho công nghệ xử lý AMD cần hội tụ hai yếu tố (i) chịu pH thấp (ii) sinh trưởng điều kiện nồng độ kim loại nặng cao (Higgins et al., 2003) Trong 10 năm trở lại đây, nhóm nghiên cứu TS Kiều Thị Quỳnh Hoa Viện CNSH, Viện Hàn lâm KH&CN Việt Nam theo đuôi hướng nghiên cứu ứng dụng vi khuân khử sulfate đề xử lý kim loại nặng nước thải từ khu vực tái chế chất thải công nghiệp Những kêt nghiên cứu phòng thí nghiệm nhóm thực cho thấy việc sử dụng tổ hợp chủng vi khuân khử sulfate làm giàu phòng thí nghiệm SRB làm giàu trực tiêp từ nguôn nước thải chô, sử dụng chât hữu từ phân trâu bò cho trình xử lý, đơng thời hiệu chinh yếu tố dinh dưỡng (nguồn cacbon, ty lệ COD/SO ) yếu tố lý hóa (pH độ kiềm) loại bo ion kim toại nước thái (Fe, Cr, Al, Pb) mức > 90% (Kieu QH t7 £//., 2004; Kiều Thị Quỳnh Hoa cs., 2013) Tuy nhiên nghiên cứu cho thấy trinh thích nghi khởi động SRB hệ thống thường kéo dài - tuần Việc chủ động tạo nguồn SRB thích hợp có đặc tính sinh học phù hợp chịu pH tháp sinh trưởng mơi trường có ham lượng kim loại nặng cao giúp khởi động nhanh bể phản ứng khử sulfate, tăng hiệu xử lý khơi phục lại q trình xử lý có cố kỹ thuật Mặc dù có ý nghĩa khoa học ímg dụng lớn, vấn đề chưa nhà khoa học nước quan tâm thỏa đáng Trong nàm gần đây, công nghệ vi bao tế bào vi sinh vật polymer sinh học quan tâm nghiên cứu để tạo sản phẩm sinh học từ vi sinh vật đưa vào đời sống Ở trạng thái vi bao màng polymer, vi sinh vật có nhiều ưu đưa ngồi mơi trường nhờ (i) tránh ảnh hưởng bất lợi trực tiếp từ mơi trường (như nhiệt độ, oxy hòa tan, chất ức chế sinh trưởng ), (ii) có thời gian thích nghi với mơi trường bên ngồi (iii) có khả cạnh tranh cao với vi sinh vật địa (Covarrubias et a i, 2012; Wu et a i, 2011) Đối với vi sinh vật kỵ khí, vi khuẩn khử sulfate nghiên cứu này, việc đưa tế bào vào cấu trúc hạt vi bao màng polymer giúp cho vi khuẩn tránh ảnh hướng oxy trình bảo quản đưa ứng dụng môi trường Công nghệ ứng dụng thành công để tạo hạt bùn kỵ khí, tố hợp nhiều nhóm vi sinh vật kỵ khí khác (trong có methanogens) (Youngsukkasem et a i, 2012) Mục tiêu Mục tiêu đề tài xây dựng công nahệ xử lý AMD biện pháp sinh học sử dụng vi khuẩn khử sulfate thay cho phương pháp hóa học áp dụng khu vực khai thác mỏ Việt Nam Đe đạt mục tiêu trên, đề tài hướng tới việc tạo nguồn SRB thích hợp cho cơng nghệ (có đặc tính, sinh học quý chịu pH thấp, chịu nồng độ kim loại nặng cao) dạng chế phẩm sinh học, dễ dàng sử dụng có độ ổn định cao Chế phẩm cần kiểm tra hiệu quy mơ phòng thí nghiệm với nước thải AMD nhân tạo Phưong pháp nghiên cứu Làm giàu SRB Vi khuẩn khử sulfate làm giàu từ mẫu bùn hệ thống xử lý nước thải chế biến thủy sản Bình Dương bùn thải AMD từ mỏ wolfram mơi trường khống nước kỵ khí (thành phần L gồm có: Na 2S 4, g; NaCl, g; M gƠ H , 0,4 g; CaCỈ2 H , 0,15 g; K-Cl, 0,5 g; M gS0 7H20 , 0,25 g; NH 4CI, 0,25 g; KH 2PO 4, 0,2 g), có bổ sung hỗn hợp vitamin vi lượng (Widdel, Bak, 1992) theo tỷ lệ ml/L Na-lactate (10 mM) nguồn carbon điện tử pH môi trường chỉnh mức hoăc bàng dung dịch HC1 IM Mầu làm giàu đặt nuôi tĩnh tối 28°c, cấy chuyển sang môi trường tươi sau ngày Sinh trưởng SRB đánh giá thông qua hàm lượng sulfate bị khử lượng sulfide tạo thành Phân lập chủng SRB khiết Mầu làm giàu lần cấy chuyển thứ dùng để phân lập SRB Việc phân lập tiến hành theo phương pháp pha loãng dãy ống thạch bán lỏng ( %) với mơi trường có thành phần tương tự môi trường dùng bước làm giàu (Widdel, Bak, 1992) ô n g thạch bán lỏng sau bổ sung nguồn vi sinh vật (10%) từ mẫu làm giàu sục khí N 2/CO (90:10, v:v) ủ tư đảo ngược 30°c bóng tối Các khuẩn lạc đơn lẻ phát triển ống thạch tách bang pipet Pasteur chuyển sang mơi trường dịch thể Q trình tình lặp lại thêm - lần thu chủng SRB khiết Nghiên cứu đặc diêm sinh lý chung phân lập Nghiên cứu ánh hướng cùa nliiệt độ tới sinh trưởng: Các chùng SRB khiết nuôi mơi trường dịch thể ky khí có pH = nhiệt độ: 15°c, 20°c, 25°c 30°c 37°c Sinh trưởng cua SRB đánh giá thông qua xác định nồng độ sulfide mật độ quang dịch nuôi (ODfioo) theo thời gian (dược xác định lần/ngày ngày) Nghiên cứu ánh hương p H tới sinh trưởng: Các chủng SRB khiết nuôi mơi trường dịch thể kỵ khí có pH khác nhau: pH pH pH pH 7, pH nhiệt độ 30°c Sinh trưởng cua SRB đánh giá thông qua xác định nồng độ sulfide mật độ quang dịch nuôi (OD 6oo) theo thời gian (được xác định lần/ngày ngày) Ngliìên cửu ảnli lutởng nồng độ m uối tới sinh trưởng: Các chủng SRB khiết nuôi mơi trường dịch thể kỵ khí pH 7, có độ muối NaCl khác 0, 1, 10, 15, 20 25 g/L Sinh trưởng SRB đánh giá thông qua xác định nồng độ sulfide mật độ quang dịch ni (ODóoo) theo thời gian (được xác định lần/ngày ngày) Ngliiên cửu ảnh hưởng kim loại nặng tới sinh trưởng: Các chủng SRB khiết ni mơi trường khống dịch thể (đã loại oxy) chứa Na-lactate (10 mM) sulfate (28 niM) làm chất cho nhận diện tử Mơi trường khử oxy hồn tồn bàng cách bố sung dung dịch ascorbate M (1 ml/L môi trường) thay cho dung dịch Na 2S M cách thông thường đế tránh kết tủa kim loại nặng Các kim loại thường có mặt AMD bổ sung vào môi trường nồng độ khác nhau, cụ thể Fe (60, 200, 500 mg/1), Zn (20, 100, 150 mg/l), Cu (20, 50, 100 mg/L), Pb (10, 50, 70 mg/L), Mg (5, 10, 20 mg/L), Mn (20, 50, 100 mg/L) Sinh trưởns vi khuẩn môi trường có sulfate đánh giá thơng qua xác định lượng sulfate bị khử theo thời gian Sinh trưởng vi khuẩn môi trường chứa NO:r đánh giá thông qua giá trị mật độ quang dịch nuôi ODóooXác địnli chất cho điện tử tiềm năng: Các chủng SRB khiết nuôi môi trường dịch kỵ khí có bổ sung chất cho điện tử khác lactate, acetate, methanol (10 mM mồi loại) sulfate (28 mM) chất nhận diện tử Sinh trưởng SRB đánh giá sau ngày nuôi cấy thông qua xác định nồng độ sulfide mật độ quang dịch ni (ODóoo)Xác địnlt chất nhận điện tử tiềm năng: Các chủng SRB khiết nuôi môi trường dịch thể kỵ khí có bo sung lactate (10 mM) chất cho điện tử chất nhận điện tử khác Fe(III)-citrate (20 mM) Na-nitrate (5 mM) Dịch nuôi với sulfate (28 mM) dối chứng dương Sinh trưởng cúa SRB đánh giá sau ngày nuôi cấy thông qua xác định mật độ quang dịch nuôi (ODơoũ)Giải trình tự 16S rDNA chủng khiết xác định vị trí phân loại DNA tổng số mẫu làm giàu mẫu thí nghiệm xử lý AMD mơ hình tách chiết theo phương pháp Zhou cộng (1996) mô tả với cải biến nồng độ đệm phosphate (tăng từ 100 mM lên 120 mM) đệm tách (gồm: 100 mM Tris (pH ); 100 mM EDTA (pH ); 120 mM đệm phosphate (Na 2HP /NaH 2PƠ 4); 1,5 M NaCl; 1% CTAB) DNA genome chủng khiết tinh theo phương pháp Marmur (1961) Đoạn 16S rDNA gần đủ (-1500 bp) chủng SRB khiết khuếch đại phản ứng PCR sử dụng cặp mồi 27F (AGAGTTTGATCCTGGCTCAG) 1492R (GGTTACCTTGTTACGACT T) (Weisburg et a i, 1991) Thành phần phản ứng gồm có H 2O (MQ) 27 |il, đệm lOx J.il, BSA (3 mg/ml) Ịi.1, MgCỈ2 (20 mM) |0,1, dNTP (2,5 mM) ịi\, mồi 27F (50 pmol/^1) JJ.1, mồi 1492R (50 pmol/|il) |il, Taq polymerase (5U/ịil) |il, DNA khuôn (~ 100 ng/p.1) Ị0.1 Chu trình nhiệt phản ímg khuyếch đại 16S rDNA sau: phút biến tính 94°c, 35 chu kỳ gồm bước tách sợi 94° 30 giây, bắt mồi 55°c 45 giây kéo dài chuỗi 72°c 1,5 phút Chu trình kết thúc bàng phút kéo dài chuồi 72 c v dìm g 20 c Sản phẩm PCR tinh bàng PCR-purification Kit (Bioneer - Hàn Quốc), sau sử dựna làm khn phản ứng đọc trình tụ' với ABI Prism BigDye Terminator cycle sequencing kit đọc trình tự máy tự động 3110 Avant Appied Biosystems Trình tự gen sau phân tích, so sánh với trình tự 16S rDNA cùa lồi có liên quan cơng bơ Database DDBJ/EMBL/GenBank sử dụng phần mềm BLAST Search Cây phân loại dựng theo phương pháp neighbour-joining (Saitou, Nei, 1987), định dạng tiến hành dựa 1000 phép so sánh đa chiều (Felsenstein, 1985) Phân tích thành phần SRB mẫu làm giàu Thành phần vi sinh vật mẫu làm giàu phân tích thơng qua phương pháp điện di biến tính đoạn V3-V5 16S rDNA Theo DNA tổng số mẫu làm giàu tách chiết theo phương pháp Zhou cộng (1996) mô tả với cải biến nồng độ đệm phosphate (tăng từ 100 mM lên 120 mM) đệm tách (gồm: 100 mM Tris (pH ); 100 mM EDTA (pH ); 120 mM đệm phosphate (Na 2HP /NaH 2P 4); 1,5 M NaCl; 1% CTAB) Vùng V3 - V5 16S 1'DNA với độ dài 550 bp khuếch đại phản ứng PCR sử dụng cặp mồi GM5F (CCTACGGGAGGCAGCAG)-GC 907R (CCGTCAATTCCTTTRAGTTT) (Muyzer et a i; 1993) Touch-down PCR với nhiệt độ gắn mồi giảm dần từ 65°c tới 55°c sử dụng để tăng độ đặc hiệu giảm hình thành sản phẩm phụ (Muyzer el al., 1993) Điện di tiến hành gel polyacrylamide 6% với dải biến tính urea/formamide từ 30% đến 60% Quá trình điện di thực điện di DcoderM System (BioRad) đệm TAE, nhiệt độ 60°c, 200 V, 3,5 Sau điện di, gel polyacrylamide nhuộm dung dịch ethidium bromide (5 mg/ml) 30 phút, sau rửa nước chụp ảnh tia u v máy GelDoc (BioRad) Các băng điện di đại diện cắt, rửa nước qua đêm 4°c Dịch DNA dùng làm khuôn để thực phản ứng PCR chu trình nhiệt phản ứng PCR cho DGGE với cặp mồi GM5F (khơng có kẹp GC) 907R Sàn phẩm PCR sau tinh bàng PCR-purification Kit (Bioneer, Hàn Qc) giải trình tự Xác định mật độ SRB phương pháp MPN Mầu chứa SRB pha lỗng mơi trường khống dịch thể kỵ khí (khơng có chất), sau cấy lên ống nghiệm chứa mơi trường dịch thể kỵ khí (có đầy đủ chất cho SRB) dãy MPN Kết đếm đọc sau 10 ngày, có mặt SRB ống MPN xác định bàng phương pháp test nhanh phát sulfide môi trường (Cord-Ruwish, 1985) Xác định nồng độ sulfide Hàm lượng sulfide dịch nuôi SRB xác định theo phương pháp Cord-Ruwisch (1985) mô tả, dựa nguyên lý phản ứng ion s 2_ với ion Cu2+ tạo CuS có màu nâu đen dạng huyền phù, xác định nhanh bước sóng 480 nm Đường chuẩn xây dựng cho dãy dung dịch Na S có nồng độ từ - 20 mM Xác định hàm lượng Fe2+ Hàm lượng Fe2T xác đinh thuốc thử phenanthrolin theo phương pháp chuẩn DIN 38406 El-1 (1983) Mô tả ngắn gọn phương pháp sau: Mẩu sau thu hạ pH tới dung dịch H SO lỗng (1% thể tích) Thêm vào 50 ml mẫu ml dung dịch ammonium acetate 5,2 M ml dung dịch hydroxyl ammonium chloride 1,4 M trộn bang vortex (hỗn hợp cần có pH nằm khoảng 3,4 - 5,5, tối ưu 4,5) Sau thêm ml dung dịch phenanthrolin 21 mM, trộn thêm nước 100 ml, trộn giữ nhiệt độ phòng 15 phút Đo mầu bước sóng 510 nm, đường chuẩn tiến hành với dung dịch có nồng độ Fe2' từ - 50 ị.iM Xác định hàm lượng sulfate Hàm lượng sulfate xác định theo trọng lượng BaSƠ kết tủa phản ứng ml mẫu với thể tích tương đương dung dịch BaCb 0,2 M HC1 0,2 M sau lọc sấy khô tới mức trọns krợng ổn định (Dinh et aỉ., 2004) Xác định hàm luọng COD nitơ tông số Ham lượng COD xác định theo phương pháp chuẩn TCVN 6491:1999; Nitơ tổng số xác định theo phương pháp chuẩn TCVN 8557:2010 Tạo chế phẩm chứa SRB vi bao alginate Vi khuẩn ni mơi trường khống dịch thể chứa Na-lactate (10 mM) nitrate (5 mM) chất cho nhận điện từ, điều kiện nuôi 28°c thời gian ngày Đe đảm bảo trình khử nitrate diễn tới sản phẩm cuối N 2, chất nhận điện tử NƠ 3- đưa vào môi trường nuôi cấy nồng độ mM, sau bổ sung ngày lần (hạn chế q trình khử khơng hồn tồn dẫn đến tích lũy NO 2” môi trường làm ức chế sinh trưởng vi khuẩn) Sinh khối SRB thu từ dịch ni thơng qua bước ly tâm 5000 vòng/phút 10 phút Tế bào sau hòa dung dịch Na-alginate khử trùng qua màng 0,2 |am loại oxy thổi khí N Nhỏ hỗn hợp tế bào dung dịch alginate vào bình đựng dung dịch CaCh (đã vô trùng đuổi oxy khí N 2) điều kiện kỵ khí khuấy liên tục Sau đậy kín bình để tĩnh để tạo độ cứng cho hạt gel Tiếp theo, chắt bò dung dịch CaCỈ2, rửa hạt gel - lần nước cất vô trùng loại oxy Cuối giữ hạt gel nước cất bình kín khí có nắp cao su kẹp nhơm, bảo quản nhiệt độ phòng Mật độ SRB hạt geỉ xác định thời điểm ngày sau tạo hạt sau định kỵ lần/ tháng thời gian tháng Hạt gel hòa dung dịch Na-citrate 0,2 M đếm số lượng tế bào theo phương pháp MPN sử dụng mơi trường khống dịch thể kỵ khí chứa lactate (10 mM) làm chất cho điện tử sulfate (28 mM) làm chất nhận điện tử Ống MPN dương tính nhận biết thơng qua việc tạo sản phẩm trao đổi chat sulfide phát nhờ phản ứng tạo kết tủa màu đen với dung dịch C 11SO Thiết lập thí nghiệm xử lý AMD Thí nghiệm x lý mơ hình phòng thí nghiệm Thí nghiệm tiến hành với nước thải AMD nhân tạo gồm thành phần sau: Fe2+ 200 mg/L; Cu2+ 10 mg/L; Zn2+ 10 mg/L; Pb2+ 20 mg/L; Ni2+ 10 mg/L; As + mg/L; Ca2+ 80 mg/L; Na 175 mg/L; K+ 20 mg/L; NH mg/L; Mg2+ 24 mg/L; PO 43 16 mg/L; SO 42" 2000 mg/L; pH chỉnh tới dưng dịch H 2SO M (Wang et a i, 2003; Kim et al., 2014) Mơ hình phòng thí nghiệm 10 L gồm bốn ngăn nối tiếp tích chứa L, 3,5 L, L 2,5 L (tổng thể tích 10 lít) Chức ngăn hệ thống sau: ngăn làm chức điều hòa, chứa đá dăm tới 1/3 thể tích, ngăn bể sinh học khử sulfate chứa giá thể (phoi bào đá dăm, tới 1/3 thể tích), ngăn bể kiếu khí cấp khí liên tục để loại kim loại kết tủa dạng muối sulfide, ngăn bể lắng lọc cát (Hình 1A) Mơ hình phòng thí nghiệm 50 L có cấu tạo tương tự, gồm ngăn tích 10, 30, 10 lít (tổng thể tích 50 lít) (Hình 1B; mơ hình đặt phòng thí nghiệm Công ty cổ phần Tin học Môi trường - Vinacomin) Chức ngăn hệ thống sau: ngăn bể điều hòa, chứa đá dăm tới 1/3 thể tích, ngăn bể sinh học khử sulfate chứa giá thể (phoi bào đá dăm, tới 1/3 thể tích), ngăn bể sục khí kết hợp lọc cát Nước thải AMD nhân tạo bơm từ thùng chứa bơm định lượng để vận hành hệ thống theo chế độ liên tục Nguồn SRB khởi động bề khử sulfate sinh học chế phẩm SRS chứa chủng SRB có hoạt tính khử sulfate cao chịu điều kiện pH axit bố sung vào bế theo tỷ lệ 0,1% tích nước thải bế Cơ chất bổ sung vào bể cám gạo lên men với tỷ lệ khác nhằm xác định hàm lượng COD tối ưu cho trình khử sulfate bể SR Nước thải chuyển qua be xử lý theo nguyên lý chảy tràn, riêng từ bế số sang bế số dòng chảy hướng đáy, từ bế số sang bế dòng chảy tràn bề mặt Thí nghiệm tiến hành theo chế độ liên tục sau thời gian - ngày khởi động Hiệu qua xử lý đánh giá qua thay đổi giá trị pH, nồng độ sulfate kim loại nặng điểm lấy mẫu sau bể lắng cuối Hình Mơ hình xử lý A M D phòng thí nghiệm A - M hình 10 lít/ngày: - B ể trung hòa; - B ể khử sulfate sinh học; - B ể sục khí; - B ể láng lọc cát.; B - Mơ hình 50 lít/ngày: - B e trung hòa; ' Be khử sulfate sinh học; - B e sục khí kết họp lọc cát Thí nghiệm xử lý mơ hình pilot Mơ hình pilot có tống thể tích xử lý ~7,2 m Vngày đêm, gồm bể có kích thước 1.5 m X 1.25 m X 1.5 m (dài X rộng X cao; thể tích chứa nước thải -2 ,4 m3) (Hình 2) Be nhồi đá dăm xây dựng (kích thước - cm) tới Vi thể tích, có nhiệm vụ trung hòa phần pH axit nước thải Bể (bể khử sulfate sinh học) chứa lớp phoi bào đá dăm (tới ‘/2 thể tích), giá thể cho SRB sinh trưởng bể, đồng thời nguồn cacbon nhả chậm cho nhóm vi khuẩn Bế bế hiếu khí (có hệ thống sục khí đáy) để loại số kim loại khó kết tủa với sulfide Al, Mn Nước thái từ bể đưa vào hồ chứa đế lắng ổn định trước xả vào hệ thống thoát nước chung H ìn h M hình pilot xử lý A M D A - S đồ m hình; B - M hình ngồi thực tế Mơ hình pilot đặt nhà máy chế biến thiếc Thiện Kế (Thái Nguyên) Vinacomin quản lý Nước thải nhà máy có thành phần nhiễm sau: Cu2t 16,32 mg/L; Mn2+ 10,9 mg/L; Fe2 143,1 mg/L; S 42~ 982,7 mg/L; pH 2,8 - 3,2 Nước thải có hàm lượng cacbon thấp, COD 28,6 mg O 2/L, BOD5 17,6 mg O 2/L Nguồn SRB khởi động bể khử sulfate sinh học chế phẩm SRS, bổ sung vào bể theo tỷ lệ 0,1% thể tích Hệ thống vận hành theo chế độ liên tục, chất lượng nước thải sau xử lý (mẫu nước thu đường xả sau bể số 3) đánh giá theo phương pháp quy chuẩn phòng thí nghiệm Cơng ty cố phần Tin học Môi trường - Vinacomin Tổng kết kết nghiên cứu 4.1 Làm giàu phân lập SRB Các mầu làm giàu SRB sử dụng nguồn nước thải khác gồm có E1 (nước thải chế biến thủy sản), E2 (bùn bế biogas), E3 (nước thải sau biogas), EA (bùn thải axit từ mỏ volfram), mẫu đặt song song hai điều kiện pH khác Ớ điều kiện làm giàu (mơi trường khống kỵ khí chứa Na-lactate sulfate, 28°C), sinh trưởng SRB mẫu làm giàu nhận biết sau - ngày nuôi cấy, thể rõ qua hàm lượng hàm lượng sulfide tạo thành dịch làm giàu, làm dịch ni chuyển màu đen (Hình 3A) Sinh trưởng SRB ổn định qua bước cấy truyền sau - ngày, đạt mức cao lần cấy truyền thứ tư (Hình 3B) Có thể nhận thấy điều kiện pH mẫu làm giàu E1 thể hoạt tính khử sulfate cao mẫu lại, điều kiện pH5 mẫu EA có hoạt tính khử sulfate cao ba mẫu lại Do hai mẫu làm giàu E1 (ở pH ) EA (ở pH 5) sử dụng để phân lập chủng SRB khiết có khả chịu pH thấp H ìn h Làm giàu SR B điều kiện pH thấp A - B ình làm giàu; B —H àm lượng sulfide tạo thành mẫu làm giàu (đo lần cấy truyền thứ 4) Quá trình phân lập tiến hành theo phương pháp dãy ống thạch bán lỏng chứa mơi trường có pH mẫu làm giàu E1 pH mẫu làm giàu EA Sau - ngày, khuẩn lạc riêng rẽ màu xám đen xuất ống thạch (Hình 4A) với hình thái khác (Hình 4B, 4C) H ìn h Phân lập SR B từ mẫu làm giàu A - SR B tạo khuẩn lạc ống thạch bán lỏn g kỵ khí; B, c - H ình thái khuẩn lạc SR B đại diện tách riêng tinh Từ hai mẫu làm giàu E1 EA, tống cộng năm chủng SRB phân lập dựa hình thái khác khuấn lạc (Bảng 1) Vị trí phân loại chủng SRB phân lập so với loài SRB có liên hệ gần gùi dựa trình tự gần đủ 16S rDNA biểu diễn phát sinh chủng loại (Hình 5) Trên sở so sánh tìn h tự gen 16S rDNA, chủng SRB phân lập định danh tương ứng Desulfomicrobium sp SR2, Desulfobulbus sp SR3, Desulfovibrio sp SR4, Desulfovibrio sp S4 Desulfovibrio sp S10 Bảng Các chủng SRB khiết phân lập từ mẫu làm giàu E1 EA M ẩu làm giàu Chủng p h ân lập SR H ìn h th k h u ẩn lạc L oài gần gũ i n h ấ t (T ỷ lệ tương đồng v ề trình tự gần đủ 16S rD N A ) H ìn h th i tế bào Trực khuân, có độ dài khác tày thuộc thời gian điều kiện ni cấy K ích thước tế bào nhỏ 1x3,5 um, không ch u yên động SR Hình múi khế canh, màu đen D esu lfobu lbu s p ro p io n icu s (98% ) O val đơn xêp chuỗi, kích thước 1*1,52 um , chuyển động chậm SR4 Hình đĩa lồi mặt, màu đen D esu lfo vib rio m cigneticus (98% ) Phây khuân, kích thuớc 1x2-3 um , chuyển động nhanh E1 V - ỉ'- - ' < * > ì i" & -A ‘ V Í r* S 10 Hình đĩa lồi mặt, màu đen D esu l/o vib rio Phẩy khuẩn, kích thước a lco h o lvo n s (99% ) 2* um , chuyển động nhanh S4 Hình đĩa lồi mặt, màu đen D esu lfo vib rio oxam icu s (99% ) —** < sV V Phây khuân, kích thước 0,6 X ,7 )im, chuyển động nhanh ầ 'J V - ' s k EA I -S S N l D esu lfom icrobiu m bacu latu m (98% ) Hình múi khế cạnh, màu đen " *0 J ' *> •
- Xem thêm -

Xem thêm: Nghiên cứu xây dựng công nghệ xử lý nước thải axit (AMD) từ hoạt động khai thác và chế biến khoáng sản bằng biện pháp sinh học , Nghiên cứu xây dựng công nghệ xử lý nước thải axit (AMD) từ hoạt động khai thác và chế biến khoáng sản bằng biện pháp sinh học

Gợi ý tài liệu liên quan cho bạn