Cloning and functional characterization

8 10 0
  • Loading ...
1/8 trang

Thông tin tài liệu

Ngày đăng: 17/09/2019, 08:50

Gene 330 (2004) 115 – 122 www.elsevier.com/locate/gene Cloning and functional characterization of PELP1/MNAR promoter Sandip K Mishra, Seetharaman Balasenthil, Diep Nguyen, Ratna K Vadlamudi * Department of Molecular and Cellular Oncology, Unit 108, The University of Texas M D Anderson Cancer Center, 1515 Holcombe Blvd, Houston, TX 77030, USA Received 10 October 2003; received in revised form 29 December 2003; accepted 15 January 2004 Received by A.J van Wijnen Abstract Proline-, glutamic acid- and leucine-rich protein (PELP1)/modulator of nongenomic activity of estrogen receptor (MNAR), a novel coactivator of estrogen receptors (ERs; ERa and ERh), modulates the genomic and nongenomic functions of the ERs PELP1 expression is developmentally regulated in mammary glands and overexpressed in breast tumors However, little is known about the regulation of PELP1 In this study, we examined whether PELP1 expression is modulated by steroid hormone 17h-estradiol (E2) – ER pathway We found that in MCF-7 breast cancer cells, E2 upregulated PELP1 expression threefold and that this upregulation was reduced by antiestrogen We also found that E2 modulated PELP1 levels in an actinomycin-D-sensitive manner, suggesting transcriptional regulation Cloning and analysis of the 2-kb PELP1 promoter region revealed two estrogen-responsive element (ERE) half sites in the PELP1 promoter region In transient transfection assays, E2 upregulated PELP1 promoter activity in breast, endometrial and osteosarcoma model cancer cell lines in an ICI 182,780-sensitive manner We demonstrated the recruitment of ER to the PELP1 promoter in vitro using EMSA assays and in vivo using a chromatin immunoprecipitation assay The PELP1 promoter was similarly upregulated by both ERa and ERh and differentially regulated by selective estrogen receptor modulators in a cell line-dependent manner Our results suggest that PELP1 expression is modulated by the E2-ER pathway and that PELP1 is an ER target gene D 2004 Elsevier B.V All rights reserved Keywords: PELP1; MNAR; Estrogen receptor; Promoter Introduction The steroid hormone 17h-estradiol (E2) plays an important role in controlling the expression of genes involved in a wide variety of biological processes, including the development, homeostasis and progression of breast cancer (Couse and Korach, 1999; McDonnell and Norris, 2002) The biological effects of E2 occur when it binds to the structurally and functionally distinct estrogen receptors (ERs; ERa and ERh) (Warner et al., 1999) For example, when E2 binds to ERa, the ligand-activated ERa translocates to the nucleus, binds to the 13-bp palindromic estrogen responseenhancer (ERE) element in the target genes and stimulates gene transcription (Kumar and Chambon, 1988) ERs can Abbreviations: E2, 17h-estradiol; ER, estrogen receptor; ERE, estrogen response element; PELP1, proline-, glutamic acid- and leucine-rich protein; MNAR, modulator of nongenomic activity of estrogen receptor; luc, luciferase * Corresponding author Tel.: +1-713-745-5239; fax: +1-713-745-2050 E-mail address: rvadlamu@mdanderson.org (R.K Vadlamudi) 0378-1119/$ - see front matter D 2004 Elsevier B.V All rights reserved doi:10.1016/j.gene.2004.01.011 also induce expression of genes containing imperfect or ERE half sites (half ERE) (Klinge, 2001) ERs also interact with other DNA-bound transcription factors such as activating protein (AP1) and SP1, and confer E2 responsiveness to heterologous promoters (Gaub et al., 1990; Webb et al., 1992; Safe, 2001; Petz et al., 2002) ERa comprises an N-terminal activation function (AF1) domain, a DNA-binding domain, and a C-terminal ligand-binding region that contains an activation function (AF2) domain ERh has a domain structure similar to that of ERa (Kumar et al., 1987; Kumar and Chambon, 1988; Berry et al., 1990) The two receptors are most similar in their DNA-binding domains (95%) and ligand-binding domains (58%) (Katzenellenbogen et al., 2001) The transcription functions of ERs are influenced by several coactivators, including SRC1, GRIP1, AIB1, CBP, p300, PGC1, E6AP, PCAF and SNF2 (Kumar et al., 1987; Kumar and Chambon, 1988; Berry et al., 1990; Hermanson et al., 2002; McDonnell and Norris, 2002; McKenna and Malley, 2002) It is generally accepted that some of the diverse functions of estrogens depend on the differential recruitment of coregu- 116 S.K Mishra et al / Gene 330 (2004) 115–122 lators to the ligand-bound ERa complex (McDonnell and Norris, 2002) Coregulators that affect the activity of ERs are thought to play a role in tumor progression (Anzick et al., 1997) On the basis of this, it has been speculated that the differential expression of coregulators among tissues contributes at least in part to different hormonal responses Proline-, glutamic acid- and leucine-rich protein (PELP1)/modulator of nongenomic activity of estrogen receptor (MNAR), a novel ER coregulator, contains 10 LXXLL motifs for nuclear receptor interaction and plays an important role in estrogen-mediated genomic functions (Vadlamudi et al., 2001, Balasenthil and Vadlamudi, 2003) and nongenomic actions of ERs via activation of Src/mitogen-activated protein kinase pathways (Wong et al., 2002) PELP1 interacts with ERa and ERh, and with retinoblastoma protein, and upregulates cyclin D1 expression and its overexpression sensitizes cells to estrogen-mediated cellcycle progression (Balasenthil and Vadlamudi, 2003) The ER-signaling pathway has been implicated in breast cancer tumorigenesis, and approximately 70% of breast cancer cells express ER (Osborne et al., 2001) Initial studies suggested that PELP1 expression is upregulated in mammary tumors and in mammary gland during pregnancy when cells are highly proliferative (Vadlamudi et al., 2001) These results led us to hypothesize that PELP1expression is regulated by the E2-ER pathway Our results suggest that E2 does regulate PELP1 expression at the transcriptional level and that the ERE half site present in the proximal region of the PELP1 promoter plays an important role in induction of E2-mediated responses Methods 2.1 Cell lines and reagents MCF-7 human breast cancer cells (Vadlamudi et al., 2001) and Ishikawa endometrial cells (Apparao et al., 2001) were maintained in Dulbecco’s Modified Eagle’s Medium – F12 (1:1) supplemented with 10% fetal calf serum (Vadlamudi et al., 2001) SAOS2 osteosarcoma cells, MDAMB-231 breast cancer cells and HeLa cervical cancer cells were obtained from the American Type Culture Collection (Manassas, VA) Steroid hormone E2, tamoxifen and charcoal-stripped serum (DCC serum) was purchased from Sigma Propyl pyrazole triol (PPT), diarcylproprionitrile (DPN), ICI-182,780 were purchased from Tocris, Ellisville, MO Faslodex (AstraZeneca Pharmaceuticals, Wilmington, DE) and Raloxifene tablets (Eli Lilly Indianapolis, IN) were obtained from MD Anderson Pharmacy We then purchased this BAC clone from BACPAC Resources (Children’s Hospital Oakland Research Institute, CA) The PELP1 promoter region containing 2-kb upstream 5V region was amplified by polymerase chain reaction (PCR) using primers PELP1 Pro-2000F-5V-GCCAGGACTTGAAGGATTGGA-3V and PELP1 Pro + 1R-5V-GGTTCCAGTGGTGGCGTGGC-3V The amplified product was cloned into the Topo vector (Invitrogen, Carlsbad, CA) and then subcloned into the PGL3 luciferase (luc) reporter vector (Promega, Madison, WI) using HindIII and Xho sites The sequence of the construct was verified by comparing its sequence with that in the human genome database Deletions in the PELP1 promoter were created using PCRbased approach Mutation in the proximal ERE half site was created by PCR approach using the following primers WT 5V-CACTTCTCGAGGCCAAGGCGGGCGGAAC ACCT GAGGTCAG GAGTTCAAGACCAT CCTGGGC-3V; MT 5V-CACTTCTCGAGGCCAAGGCGGG CGGA ACACCTGAGAGCAGGAGTTCAAGACCATCCTG GGC-3V 2.3 Reporter gene assays For the reporter gene transient transfections, MCF-7, Ishikawa, SAOS2 and MDA-MB-231 cells were cultured for 24 h in minimal essential medium without phenol red containing 5% DCC serum The PELP1-luciferase (luc) reporter constructs were transfected using FuGENE according to the manufacturer’s instructions (Roche Molecular Biochemicals, Indianapolis, IN) Twenty-four hours later, the cells were treated with E2 for 24 h The cells were then lysed with a passive-lysis buffer, and the luc assay was performed using a luc reporter assay kit (Promega) The total amount of DNA used in the transfections was kept constant by adding a parental vector Each transfection was carried out in six-well plates in triplicate wells 2.4 Northern hybridization MCF-7 cells were treated with E2 for h, and PELP1 levels were analyzed by Northern blotting Total cytoplasmic RNA 20 Ag was isolated using the Trizol reagent (Invitrogen) and analyzed by Northern hybridization using a 1200-bp N-terminal fragment of PELP1cDNA Glyceraldehyde-3-phosphate dehydrogenase levels were measured to assess the integrity of the RNA and to control RNA loading Autoradiogram was developed using Phosphoimager and band intensities were quantitated using SigmaGelGel Analysis Software 2.5 Cell extracts and immunoblotting 2.2 Cloning of the PELP1 promoter To clone the PELP1 promoter, we first identified the BAC clone (ID RP11-314A20) containing the PELP1 genomic region using human genome sequence information To prepare cell extracts, cells were washed three times with phosphate-buffered saline and then lysed in RIPA buffer (50 mM Tris – HCl, pH 7.5, 150 mM NaCl, 0.5% NP-40, 0.1% sodium dodecyl sulfate (SDS), 0.1% sodium S.K Mishra et al / Gene 330 (2004) 115–122 deoxycholate, Â protease inhibitor mixture (Roche Molecular Biochemicals), mM sodium vanadate) for 15 on ice The lysates were centrifuged in an Eppendorf centrifuge at jC for 15 Cell lysates containing an equal amount of protein ( f 200 Ag) were then resolved on a SDS – polyacrylamide gel (PAGE) (8% acrylamide), transferred to a nitrocellulose membrane, probed with the appropriate antibodies and developed using the enhanced chemiluminescence method Quantiation of the bands were done using SigmaGel-Gel Analysis Software 117 representing the ERE half site present in the promoter of PELP1/MNAR Sequence of the forward and reverse primers used are as For:5V-CACTTTGGGAGGCCAAGGCGGGCGGAACACCTGAGGTCA GGAGTTCAAGACCATCCTGGC-3; Rev:5V GCCAGGATGGTCTTGAACTCCTGACCTCAGGTGTTC CGCCCGCCTTGGC CTC CCAAAGTG-3V The DNA – protein complexes were resolved in 5% polyacrylamide gels For supershift assays, Al of antibody (ERa, supershift antibody by Santa Cruz Biotechnology) was used Antibody was incubated with the reaction mixture for 15 2.6 Chromatin immunoprecipitation assay 2.8 Statistical analysis Approximately 106 cells were treated with 1% formaldehyde (final concentration, v/v) for 10 at 37 jC to cross-link histones to DNA The cells were washed twice with phosphate-buffered saline, pH 7.4 containing protease inhibitor cocktail (Roche Molecular Biochemicals) Chromatin immunoprecipitation (ChIP) assay was performed as described previously (Mazumdar et al., 2001) An ERaspecific antibody purchased from Upstate biotechnology (Upstate, Lake Placid, NY) was used for immunoprecipitation of ER-bound chromatin PCR using primers flanking the proximal half ERE site ( À 690 For-5V-ATAAATCTTTGGCGGCGCGTA-3V and À 294 Rev-5V-ACGATTTCCATTTAGCGGACG-3V) produced a 396-bp DNA fragment An amplified fragment was sequence verified 2.7 Electrophoresis mobility shift assay Electrophoresis mobility shift assay (EMSA) was performed as described earlier (Mandal et al., 2001) with some modifications Cells were maintained in DCC medium for at least 48 h and treated with E2 (final conentration, 10À M) for 12 h Nuclear extract prepared from the estrogen-treated cells was incubated with 32 P-radiolabeled oligonucleotide Statistical analysis was done using Student’s t-test, and values with p < 0.05 were considered statistically significant Results 3.1 E2 upregulates PELP1 expression E2 treatment of the MCF-7 cells induced PELP1 mRNA to a level threefold greater than that in the untreated cells (Fig 1A) In contrast, cells pretreated with antiestrogen ICI182780 showed no increase in PELP1 levels suggesting that E2-mediated upregulation of PELP1 levels occurs via the ER (Fig 1B) On the other hand, the treatment of the MCF-7 cells with cycloheximide, a translation inhibitor, did not affect E2-mediated upregulation of PELP1 (Fig 1C) However, treatment of these cells with actinomycin D, an inhibitor of transcription, completely prevented the E2-mediated induction of PELP1, suggesting that E2 regulates PELP1 expression at the transcriptional level To confirm that the increase in PELP1 mRNA levels correlated with PELP1 protein levels, we treated the MCF-7 cells with E2 for Fig E2 upregulated PELP1 expression (A) Northern analysis of PELP1 expression in MCF-7 cells treated with E2 for h (B) Blockage of E2-mediated PELP1 expression by ICI-182780 pretreatment (C) Northern analysis of PELP1 expression in MCF-7 cells treated with E2 in the presence or absence of cycloheximide (CHX) and or actinomycin-D (ACD) (D) MCF-7 cells were treated with E2 for various lengths of time, and PELP1 expression was analyzed by Western blotting using a PELP1-specific antiserum 118 S.K Mishra et al / Gene 330 (2004) 115–122 various times and analyzed PELP1 expression by Western blotting (Fig 1D) Our results showed that E2 increased the expression of PELP1 protein by three- to fourfold and that the PELP1 protein level increased after h of E2 treatment 3.2 E2 increases PELP1 promoter activity in breast cancer, endometrial and osteosarcoma cells To elucidate the mechanism by which E2 increases PELP1 expression at the transcriptional level, we analyzed the sequence of the PELP1 promoter region (Fig 2) and found that it lacked consensus TATA and CCAAT motifs This 2-kb region also lacked consensus palindromic ERE sites, although it did contain two ERE half sites, seven AP1 sites and five SP1 sites (Fig 2) Other putative transcription factor elements present in the PELP1 promoter included thyroid receptor binding elements, GATA and E2F binding sites Sequence was submitted to the GenBank (AY427960) To examine whether the cloned region ( À 2000 to + 1) of the PELP1 promoter did indeed confer E2 inducibility, we constructed and measured the activity of PELP1 promoter luc reporter We found that E2 upregulated PELP1 promoter activity to threefold more in MCF-7 cells than in the untreated cells The E2-mediated increase in PELP1 promoter activity was also sensitive to antiestrogen ICI182780 treatment To examine the generality of PELP1 promoter upregulation, we examined whether E2 also upregulated PELP1 promoter activity in the Ishikawa and SAOS2 cells The results showed that the PELP1 basal activity varied among the three cell lines and that E2 was able to induce the PELP1 promoter in the three cells lines two to three times above their basal activity (Fig 3) Fig Sequence of the PELP1 promoter (A) Nucleotide sequence of the 5Vflanking region, including part of the first exon of the PELP1 gene The first exon region is shown in bold, and the translation start site is shown by a box The numbers shown to the left are relative to the putative start sites of PELP1 mRNA Consensus sequences for the AP1, SP1 and ERE half transcription factor sites are underlined (B) Schematic representation of AP1, SP1 and ERE half sites in the PELP1 promoter S.K Mishra et al / Gene 330 (2004) 115–122 119 Fig Activity of the PELP1 promoter in different cell lines PELP1 promoter ( À 2000 to + 1) fused to the luciferase reporter was transiently transfected into (A) breast model cell line MCF-7, (B) endometrial model cell line Ishikawa, (C) and osteosarcoma cell line SAOS2 The cells were treated with E2 or E2 + ICI182,780, and after 24 h, the luciferase reporter activity was measured Significant ( p < 0.05) induction by E2 is indicated with an asterisk Fig Localization of the E2-responsive region in the PELP1 promoter (A) MCF-7 cells were transfected with various PELP1 promoter deletion constructs, treated with E2 for 24 h, and the PELP1-luciferase reporter activity was measured (B) Chromatin immunoprecipitation analysis ERs bound to the chromatin were immunoprecipitated using an ERa-specific antibody, and its recruitment to the PELP1 promoter was analyzed using primers spanning the proximal ERE half site of the PELP1 endogenous promoter (C) Gel mobility shift assays using proximal ERE half site ( À 610/ À 550) containing oligonucleotides Estrogentreated nuclear extract was incubated with 32P-labeled oligonucleotide First lane shows free probe Second, third and fourth lanes show complex formation with 5, 10 and 20 Ag of nuclear extract A 100-fold excess of unlabeled oligonucleotide retarded the complex formation with the radiolabeled probe (lane 5) (D) ERa-specific antibody was used to supershift the complex Lane shows free probe Lane shows complex formation with the nuclear extract Lane 3, a 10fold excess of unlabeled oligonucleotide retarded the complex formation with the radiolabeled probe, and lane 4, anti-ERa antibody supershifted most of the complex (E) Activity of the PELP1 promoter À 600/ À containing wild-type ERE half site or mutated ERE half site were transfected into MCF-7 cells, treated with or without E2 and luciferase activity was measured Significant ( p < 0.05) induction by E2 is indicated with an asterisk 120 S.K Mishra et al / Gene 330 (2004) 115–122 3.3 Proximal ERE half site of PELP1 promoter confers E2 inducibility To identify the E2-responsive region in the PELP1 promoter, we generated serial deletions of PELP1 promoter Deletion of the 1300-bp distal region containing one ERE half site did not noticeably affect the E2 inducibility of the PELP1 promoter containing the À 700 to + region However, an additional deletion of 200 bp prevented E2 induction of the PELP1 promoter (Fig 4A) Since the PELP1 À 700 to À 500 promoter region contained one ERE half site, these results suggested that this proximal ERE half site conferred E2 inducibility (Fig 4A) To examine in vivo the possibility that ER is recruited to the PELP1 promoter, we performed a chromatin immunoprecipitation assay using the primers spanning PELP1 promoter region ( À 690 to À 294) Results showed that ER is recruited to the PELP1 promoter region À 690 to À 294, which contains proximal ERE half site, after E2 treatment in a time-dependent manner (Fig 4B) Gradual recruitment of ER to the PELP1 promoter with peak at 60 and lack of its recruitment at 120 suggests cyclical recruitment of ER at the PELP1 promoter as predicted with other promoters including ER-responsive gene pS2 (Me´tivier et al., 2003) We did not observe any recruitment of ER in chromatin immunoprecipitation assay to the PELP1 promoter containing the distal ERE half site (data not shown) To determine whether ER is directly recruited to the region containing proximal ERE half site, 32P-labeled oligos containing À 610/ À 550 region of the PELP1/MNAR promoter was incubated with increasing amounts of estrogentreated MCF-7 nuclear extract Results showed formation of higher order protein – DNA complexes, and the specific band formed as a result of complex formation could be competed out with 100-fold excess cold probe (Fig 4C) The same band could be supershifted with anti-ER-a antibody (Fig 4D) Mutation of the proximal ERE half site (GGTCA to GTGCA) in the PELP1 À 600/ À construct substantially reduced the ability of estrogen to induce reporter gene activity (Fig 4E) Collectively, these results suggest that proximal ERE half sites play an important role in the estrogen-mediated upregulation of PELP1/MNAR promoter activity 3.4 PELP1 promoter is upregulated by both ERa and ERb Since many E2-responsive tissues express distinct forms of ER (ERa and ERh),we next examined whether both ERa and ERh regulate PELP1 promoter activity For this experiment, we have used HeLa cells, which have no detectable levels of ERa or ERh Cotransfection of ERa and ERh along with the PELP1 ( À 2000 to + 1) luc reporter resulted in a 2.6- and 2.2-fold induction, respectively, upon E2 stimulation (Fig 5A) To confirm these results, we transfected PELP1 promoter construct into breast cancer cells that selectively expressed either ERa (MCF-7 cells) or ERh (MDA-MB-231) The cells were then treated with either ERa-selective agonist PPT or ERh-selective agonist DPN The results showed that in the MCF-7 cells, which only express ERa, PPT but not DPN upregulated PELP1 promoter activity (Fig 5B) Similarly, in the MDA-MB-231 cells, which only express ERh, DPN but not PPT upregulated PELP1 promoter activity (Fig 5C) These results suggest that both ER isoforms have the potential to modulate PELP1 expression Fig 5D shows the expression of ERa and ERh in MCF-7 and MDA-MB-231 cell lines 3.5 Differential regulation of the PELP1 promoter by selective estrogen receptor modulators We next examined whether selective estrogen receptor modulators regulate the expression of the PELP1 promoter In the MCF-7 cells, the selective estrogen receptor modulators did not upregulate PELP1 promoter activity; how- Fig Regulation of PELP1 promoter activity by ERa and ERh (A) HeLa cells were cotransfected with the PELP1-luciferase reporter gene alone with ERa or ERh, and treated with E2 or E2 + ICI-182,780 for 24 h The reporter activity was then measured (B) ERa-positive MCF-7 cells and (C) ERh-positive MDAMD-231 cells were transfected with the PELP1-luciferase reporter ( À 2000 to + 1) and treated with PPT (ERa-specific ligand) or DPN (ERh-specific ligand) After 24 h, the luciferase activity was measured Significant ( p < 0.05) induction by E2/PPT/DPN is indicated with an asterisk S.K Mishra et al / Gene 330 (2004) 115–122 121 Fig Regulation of PELP1 promoter activity by selective estrogen receptor modulators MCF-7 and Ishikawa cells were transfected with the PELP1luciferase reporter gene ( À 2000 to + 1), and the cells were treated with the indicated selective estrogen receptor modulators for 24 h The luciferase activity was measured Significant ( p < 0.05) induction by E2, tamoxifen and raloxifene is indicated with an asterisk ever, in the endometrial Ishikawa cells, tamoxifen and raloxifene upregulated PELP1 promoter activity (Fig 6) These results suggest that selective estrogen receptor modulators may modulate PELP1 expression in a tissue-dependent manner Discussion The following results of this study strongly suggest that PELP1 is an E2-inducible gene (1) E2 upregulated PELP1 mRNA and PELP1 protein levels; (2) E2-mediated PELP1 expression was sensitive to antiestrogen ICI-182780; (3) ERE half sites were present in PELP1 promoter, and ER was recruited to the À 690/ À 294 region of PELP1 promoter which contains proximal ERE half site; (4) EMSA and supershift assays showing the ability of ER to recruit to À 610/ À 550 oligonucleotide which contains proximal ERE half site; (5) E2 upregulated the PELP1 promoter in breast cancer, endometrial and osteosarcoma cell lines; and (6) both ERa and ERh regulated the PELP1 promoter activity Ligand-bound ERs are thought to bind to the 13-bp ERE element Emerging evidence from several studies also suggested that ER regulates promoters containing ERE half sites (Klinge et al., 1997; Lee and Mouradian 1999; Klinge 2001; Martini and Katzenellenbogen, 2001, Ediger et al., 2002) PELP1 promoter did not have a classical palindromic 13-bp ERE site, although it did contained two ERE half sites, seven AP1 and five SP1 sites In this study, we have only focused on the characterization of two ERE half sites present in the promoter region Our ChIP analysis indicated ER recruitment in the promoter region containing À 690 to À 294 Mobility shift assays support recruitment of ER to the proximal ERE half site Further, mutation of ERE half site in PELP1 À 600/ À construct abolished the E2-mediated induction These results suggest that proximal ERE site contributes at least 50% of the E2-mediated induction However, deletion of the PELP1 promoter sequence upstream of PELP1 À 600/ À also results in approximately 50% reduction in the fold of activation of PELP1-luciferase activity These data denote the importance of the AP1 or SP1 sites located upstream the proximal half ERE, in the E2-induced regulation of PELP1 promoter Our ongoing studies are currently focused on the characterizing the role of AP1 and SP1 in E2-mediated induction of PELP1/MNAR promoter E2 regulates cell proliferation in a wide variety of tissues, including breast tissue (Prall et al., 1998) The highest rate of mitosis in ductal epithelial cells (the origin of most breast cancer cells) is during the luteal phase, when the level of E2 is generally high (Foster et al., 2001) PELP1 expression is high in mammary glands during pregnancy, when cell proliferation is high (Vadlamudi et al., 2001) In a previous study, we found that overexpression of PELP1 was accompanied by a persistent hyperphosphorylation of pRb in an E2-dependent manner, and overexpression of PELP1 sensitized cells to G1/S progression (Balasenthil and Vadlamudi, 2003) Our finding in this study that E2 upregulates PELP1 expression suggests that upregulated PELP1 may in turn help in E2-mediated cell cycle progression in physiological settings However, in pathological conditions such as breast cancer, ER-positive tumors may upregulate PELP1 expression via activation of the E2-ER pathway Since PELP1 is a coactivator of ERs which modulates both the genomic and nongenomic functions of ERs, deregulation of PELP1 may contribute to excessive proliferation or hormonal independence in ER-positive tumors or to both In summary, we have shown that PELP1 expression is modulated by the E2-ER pathway and that selective estrogens differentially regulate PELP1 reporter activity The ERE half site localized to the proximal region of PELP1 plays an important role in the E2-mediated regulation of PELP1 expression 122 S.K Mishra et al / Gene 330 (2004) 115–122 Acknowledgements This study was supported in part by NIH grants CA095681, CA90970 and 98823 We are grateful to Rakesh Kumar, UTMDACC for thoughtful discussions and critical reading of this manuscript We thank Bruce A Lessey, UNC for Ishikawa cell line References Anzick, S.L., Kononen, J., Walker, R.L., Azorsa, D.O., Tanner, M.M., Guan, X.Y., Sauter, G., Kallioniemi, O.P., Trent, J.M., Meltzer, P.S., 1997 AIB1, a steroid receptor coactivator amplified in breast and ovarian cancer Science 277, 965 – 968 Apparao, K.B., Murray, M.J., Fritz, M.A., Meyer, W.R., Chambers, A.F., Truong, P.R., Lessey, B.A., 2001 Osteopontin and its receptor alphavbeta(3) integrin are coexpressed in the human endometrium during the menstrual cycle but regulated differentially J Clin Endocrinol Metab 86, 4991 – 5000 Balasenthil, S., Vadlamudi, R.K., 2003 Functional interactions between the estrogen receptor coactivator PELP1/MNAR and retinoblastoma protein J Biol Chem 278, 22119 – 22127 Berry, M., Metzger, D., Chambon, P., 1990 Role of the two activating domains of the oestrogen receptor in the cell-type and promoter-context dependent agonistic activity of the anti-oestrogen 4-hydroxytamoxifen EMBO J 9, 2811 – 2818 Couse, J.F., Korach, K.S., 1999 Estrogen receptor null mice: what have we learned and where will they lead us? Endocr Rev 20, 358 – 417 Ediger, T.R., Park, S.E., Katzenellenbogen, B.S., 2002 Estrogen receptor inducibility of the human Na+/H+ exchanger regulatory factor/ezrinradixin-moesin binding protein 50 (NHE-RF/EBP50) gene involving multiple half-estrogen response elements Mol Endocrinol 16, 1828 – 1839 Foster, J.S., Henley, D.C., Ahamed, S., Wimalasena, J., 2001 Estrogens and cell-cycle regulation in breast cancer Trends Endocrinol Metab 12, 320 – 327 Gaub, M.P., Bellard, M., Scheuer, I., Chambon, P., Sassone-Corsi, P., 1990 Activation of the ovalbumin gene by the estrogen receptor involves the fos-jun complex Cell 63, 1267 – 1276 Hermanson, O., Glass, C.K., Rosenfeld, M.G., 2002 Nuclear receptor coregulators: multiple modes of modification Trends Endocrinol Metab 13, 55 – 60 Katzenellenbogen, B.S., Sun, J., Harrington, W.R., Kraichely, D.M., Ganessunker, D., Katzenellenbogen, J.A., 2001 Structure-function relationships in estrogen receptors and the characterization of novel selective estrogen receptor modulators with unique pharmacological profiles Ann N Y Acad Sci 949, – 15 Klinge, C.M., 2001 Estrogen receptor interaction with estrogen response elements Nucleic Acids Res 29, 2905 – 2919 Klinge, C.M., Bodenner, D.L., Desai, D., Niles, R.M., Traish, A.M., 1997 Binding of type II nuclear receptors and estrogen receptor to full and half-site estrogen response elements in vitro Nucleic Acids Res 25, 1903 – 1912 Kumar, V., Chambon, P., 1988 The estrogen receptor binds tightly to its responsive element as a ligand-induced homodimer Cell 55, 145 – 156 Kumar, V., Green, S., Stack, G., Berry, M., Jin, J.R., Chambon, P., 1987 Functional domains of the human estrogen receptor Cell 51, 941 – 951 Lee, S.H., Mouradian, M.M., 1999 Up-regulation of D1A dopamine receptor gene transcription by estrogen Mol Cell Endocrinol 156, 151 – 157 Mandal, M., Olson, D.J., Sharma, T., Vadlamudi, R.K., Kumar, R., 2001 Butyric acid induces apoptosis by up-regulating Bax expression via stimulation of the c-Jun N-terminal kinase/activation protein-1 pathway in human colon cancer cells Gastroenterology 120, 71 – 78 Martini, P.G., Katzenellenbogen, B.S., 2001 Regulation of prothymosin alpha gene expression by estrogen in estrogen receptor-containing breast cancer cells via upstream half-palindromic estrogen response element motifs Endocrinology 142, 3493 – 3501 Mazumdar, A., Wang, R.A., Mishra, S.K., Adam, L., Bagheri-Yarmand, R., Mandal, M., Vadlamudi, R.K., Kumar, R., 2001 Transcriptional repression of oestrogen receptor by metastasis-associated protein corepressor Nat Cell Biol 3, 30 – 37 McDonnell, D.P., Norris, J.D., 2002 Connections and regulation of the human estrogen receptor Science 296, 1642 – 1644 McKenna, N.J., Malley, B.W., 2002 Combinatorial control of gene expression by nuclear receptors and coregulators Cell 108, 465 474 Metivier, R., Penot, G., Huăbner, M.R., Reid, G., Brand, H., Kosˇ, M., Gannon, F., 2003 Estrogen receptor-a directs ordered, cyclical, and combinatorial recruitment of cofactors on a natural target promoter Cell 115, 751 – 763 Osborne, C.K., Schiff, R., Fuqua, S.A., Shou, J., 2001 Estrogen receptor: current understanding of its activation and modulation Clin Cancer Res 7, 4338s – 4342s Petz, L.N., Ziegler, Y.S., Loven, M.A., Nardulli, A.M., 2002 Estrogen receptor alpha and activating protein-1 mediate estrogen responsiveness of the progesterone receptor gene in MCF-7 breast cancer cells Endocrinology 143, 4583 – 4591 Prall, O.W., Rogan, E.M., Sutherland, R.L., 1998 Estrogen regulation of cell cycle progression in breast cancer cells J Steroid Biochem Mol Biol 65, 169 – 174 Safe, S., 2001 Transcriptional activation of genes by 17 beta-estradiol through estrogen receptor-Sp1 interactions Vitam Horm 62, 231 – 252 Vadlamudi, R.K., Wang, R.A., Mazumdar, A., Kim, Y., Shin, J., Sahin, A., Kumar, R., 2001 Molecular cloning and characterization of PELP1, a novel human coregulator of estrogen receptor alpha J Biol Chem 276, 38272 – 38279 Warner, M., Nilsson, S., Gustafsson, J.A., 1999 The estrogen receptor family Curr Opin Obstet Gynecol 11, 249 – 254 Webb, P., Lopez, G.N., Greene, G.L., Baxter, J.D., Kushner, P.J., 1992 The limits of the cellular capacity to mediate an estrogen response Mol Endocrinol 6, 157 – 167 Wong, C.W., McNally, C., Nickbarg, E., Komm, B.S., Cheskis, B.J., 2002 Estrogen receptor-interacting protein that modulates its nongenomic activity-crosstalk with Src/Erk phosphorylation cascade Proc Natl Acad Sci U S A 99, 14783 – 14788
- Xem thêm -

Xem thêm: Cloning and functional characterization, Cloning and functional characterization

Gợi ý tài liệu liên quan cho bạn