Phân lập đoạn gen Cyp79D1 liên quan đến sự tổng hợp Hydrogen Cyanide của cây sắn (Manihot Esculenta) (Luận văn thạc sĩ)

45 10 0
  • Loading ...
1/45 trang

Thông tin tài liệu

Ngày đăng: 02/04/2019, 07:48

Phân lập đoạn gen Cyp79D1 liên quan đến sự tổng hợp Hydrogen Cyanide của cây sắn (Manihot Esculenta)Phân lập đoạn gen Cyp79D1 liên quan đến sự tổng hợp Hydrogen Cyanide của cây sắn (Manihot Esculenta)Phân lập đoạn gen Cyp79D1 liên quan đến sự tổng hợp Hydrogen Cyanide của cây sắn (Manihot Esculenta)Phân lập đoạn gen Cyp79D1 liên quan đến sự tổng hợp Hydrogen Cyanide của cây sắn (Manihot Esculenta)Phân lập đoạn gen Cyp79D1 liên quan đến sự tổng hợp Hydrogen Cyanide của cây sắn (Manihot Esculenta)Phân lập đoạn gen Cyp79D1 liên quan đến sự tổng hợp Hydrogen Cyanide của cây sắn (Manihot Esculenta)Phân lập đoạn gen Cyp79D1 liên quan đến sự tổng hợp Hydrogen Cyanide của cây sắn (Manihot Esculenta)Phân lập đoạn gen Cyp79D1 liên quan đến sự tổng hợp Hydrogen Cyanide của cây sắn (Manihot Esculenta)Phân lập đoạn gen Cyp79D1 liên quan đến sự tổng hợp Hydrogen Cyanide của cây sắn (Manihot Esculenta)Phân lập đoạn gen Cyp79D1 liên quan đến sự tổng hợp Hydrogen Cyanide của cây sắn (Manihot Esculenta)Phân lập đoạn gen Cyp79D1 liên quan đến sự tổng hợp Hydrogen Cyanide của cây sắn (Manihot Esculenta)Phân lập đoạn gen Cyp79D1 liên quan đến sự tổng hợp Hydrogen Cyanide của cây sắn (Manihot Esculenta) ĐẠI HỌC THÁI NGUYÊN TRƯỜNG ĐẠI HỌC PHẠM ––––––––––––––––––––– NGUYỄN THỊ THÙY PHÂN LẬP ĐOẠN GEN CYP79D1 LIÊN QUAN ĐẾN SỰ TỔNG HỢP HYDROGEN CYANIDE CỦA CÂY SẮN (MANIHOT ESCULENTA) LUẬN VĂN THẠC SĨ SINH HỌC THÁI NGUYÊN - 2018 ĐẠI HỌC THÁI NGUYÊN TRƯỜNG ĐẠI HỌC PHẠM ––––––––––––––––––––– NGUYỄN THỊ THÙY PHÂN LẬP ĐOẠN GEN CYP79D1 LIÊN QUAN ĐẾN SỰ TỔNG HỢP HYDROGEN CYANIDE CỦA CÂY SẮN (MANIHOT ESCULENTA) Ngành: DI TRUYỀN HỌC Mã số: 42 01 21 LUẬN VĂN THẠC SĨ SINH HỌC Cán hướng dẫn khoa học: TS Hoàng Phú Hiệp THÁI NGUYÊN - 2018 LỜI CAM ĐOAN Tôi xin cam đoan nội dung trình bày luận văn kết nghiên cứu hướng dẫn trực tiếp TS Hoàng Phú Hiệp Các số liệu, kết sử dụng luận văn trung thực đồng ý cán hướng dẫn nhóm nghiên cứu Tơi xin hồn tồn chịu trách nhiệm kết nghiên cứu luận văn Tác giả luận văn Nguyễn Thị Thùy i LỜI CẢM ƠN Em xin bày tỏ lòng kính trọng biết ơn sâu sắc tới TS Hồng Phú Hiệp tận tình hướng dẫn, giúp đỡ bảo để em hoàn thành luận văn Em xin chân thành cảm ơn thầy cô, cán Bộ môn Sinh học đại & Giáo dục Sinh học, khoa Sinh học, trường Đại học phạm - Đại học Thái Nguyên tận tình giúp đỡ em trình làm luận văn Em xin bày tỏ lời cảm ơn động viên giúp đỡ gia đình bạn bè suốt thời gian học tập thực đề luận văn Trong trình nghiên cứu, thời gian khả có hạn, luận văn nhiều hạn chế Em mong nhận đóng góp ý kiến thầy cô bạn Thái Nguyên, tháng 09 năm 2018 Tác giả luận văn Nguyễn Thị Thùy ii MỤC LỤC Trang LỜI CAM ĐOAN i LỜI CẢM ƠN ii MỤC LỤC iii BẢNG CHỮ VIẾT TẮT iv DANH MỤC CÁC BẢNG v DANH MỤC CÁC HÌNH vi MỞ ĐẦU 1 Lý chọn đề tài Mục tiêu nghiên cứu Nội dung nghiên cứu Chương 1: TỔNG QUAN TÀI LIỆU 1.1 Cây sắn (Manihot esculenta Crantz) 1.1.1 Phân loại, nguồn gốc phân bố sắn 1.1.2 Đặc điểm sắn 1.1.3 Hướng sử dụng sản phẩm từ sắn 1.1.4 Tình hình sản xuất - tiêu thụ sắn Việt Nam 1.2 Độc tố sắn 11 1.3 Họ gen CYP79 tình hình nghiên cứu gen CYP79D1 CYP79D2 14 1.3.1 Đặc điểm họ gen CYP79 14 1.3.2 Tình hình nghiên cứu gen CYP79D1 CYP79D2 16 Chương 2: VẬT LIỆU VÀ PHƯƠNG PHÁP NGHIÊN CỨU 18 2.1 Vật liệu địa điểm nghiên cứu 18 2.1.1 Vật liệu thực vật 18 2.1.2 Địa điểm nghiên cứu 18 2.2 Thiết bị hóa chất 18 2.3 Phương pháp nghiên cứu 19 iii 2.3.1 Phương pháp tách chiết RNA tổng số 19 2.3.2 Phương pháp tạo cDNA 20 2.3.3 Phương pháp tách chiết DNA tổng số 20 2.3.4 Phương pháp PCR 20 2.3.5 Phương pháp điện di sản phẩm PCR 22 2.3.6 Phương pháp tinh sản phẩm PCR 22 2.3.7 Phương pháp đọc trình tự 23 Chương 3: KẾT QUẢ VÀ THẢO LUẬN 24 3.1 Kết tách chiết RNA, tạo cDNA nhân đoạn gen CYP97D1 24 3.2 Kết tách chiết DNA nhân đoạn gen CYP97D1 25 3.3 Xác định phân tích trình tự đoạn gen CYP79D1 giống sắn Xanh Vĩnh Phú KM94 26 KẾT LUẬN VÀ ĐỀ NGHỊ 31 Kết luận 32 Đề nghị 32 TÀI LIỆU THAM KHẢO 33 iv BẢNG CHỮ VIẾT TẮT STT VIẾT TẮT VIẾT ĐẦY ĐỦ BLAST Basic Local Alignment Search Tool cDNA Complementary deoxyribonucleotide acid CYP Cytochrome P450 DNA Deoxyribonucleotide acid FAO Food and Agriculture Organization of the United Nations HCN Hydro cyanua IAA β - Indole acetic acid IAOx Indole - - acetaldoxime PCR Polymerase Chain Reaction 10 ppm Parts per million 11 RNA Ribonucleotide acid iv DANH MỤC CÁC BẢNG Bảng 1.1 Thành phần hóa học giá trị dinh dưỡng tinh bột sắn Bảng 1.2 Sản lượng sắn theo vùng Việt Nam giai đoạn 2000-2015 Bảng 1.3 Nồng độ cyanide sản phẩm thức ăn từ sắn 12 Bảng 1.4 Họ gen CYP79 thực vật 14 Bảng 2.1 Thành phần phản ứng PCR 21 Bảng 2.2 Chu kỳ nhiệt phản ứng PCR 22 v DANH MỤC CÁC HÌNH Hình 1.1 Phân bố sản lượng sắn nước giới (2013) Hình 1.2 Sản lượng sắn nước giai đoạn 1995-2016 Hình 1.3 Q trình chuyển hóa HCN từ sắn xuống củ 15 Hình 3.1 Kết tách chiết RNA tổng số 24 Hình 3.2 Kết PCR nhân đoạn gen CYP79D1 từ RNA tổng số 24 Hình 3.3 Kết điện di DNA tổng số 25 Hình 3.4 Kết PCR nhân đoạn gen CYP79D1 Hình 3.5 So sánh đồ họa trình tự đoạn gen CYP79D1 27 Hình 3.6 Vị trí phân bố số gen CYP hệ gen sắn 31 vi MỞ ĐẦU Lý chọn đề tài Nhóm chất cyanide gồm nhiều hợp chất với cấu tạo hóa học phức tạp Những chất có 2.650 loài thực vật khác thuộc khoảng 550 chi 130 họ, bao gồm dương xỉ, thực vật hạt kín, hạt trần [20] Nhiều ăn chứa cyanogenic glycosides với nồng độ khác nhau, khác biệt chủ yếu yếu tố di truyền, môi trường, vị trí, mùa loại đất [6] Ở Việt Nam, sắn đóng góp phần khơng nhỏ cơng xóa đói giảm nghèo cho nơng dân vùng thiểu số, vùng sâu vùng xa Sản phẩm từ sắn ứng dụng nhiều ngành sản xuất: chế biến bột ngọt, bánh kẹo, mì ăn liền, bao bì, phụ gia, màng phủ thực phẩm hay thành phần ethanol Cyanide có mặt sắn hai dạng cyanogenic glycoside: linamarin lotaustralin Trong đó, linamarin chiếm 80% có mặt tất phận sắn, đặc biệt rễ HCN tạo tích tụ nhiều vỏ, đầu phần lõi ruột sắn [24] Căn vào hàm lượng HCN (hydro cyanua) sắn, người ta chia giống sắn thành nhóm: nhóm sắn nhóm sắn đắng Trong trình chế biến sắn, khơng loại HCN chất gây ngộ độc cho người động vật Khả chống chịu hàm lượng HCN động vật phụ thuộc vào giống, độ tuổi [7] Để làm giảm hàm lượng HCN sản phẩm sắn thường phải thông qua phương pháp làm khô; ủ chua để lên men, ngâm nước củ, thân non Độc tố sắn phát lần đầu vào năm 1885 Peckolt, có tên gọi manihotoxin Q trình sinh tổng hợp độc tố sắn có tham gia enzyme hydrolytic, enzyme phân giải dạng cyanogenic glycoside thành dạng cyanide tự [8] Như vậy, hàm lượng độc tố sắn giảm cách sử dụng kĩ thuật knock-out gen RNAi tác động vào chu trình chuyển hóa cDNA khn 10 - 20 ng/µl 0,5µl Tổng thể tích 15µl Bảng 2.2 Chu kỳ nhiệt phản ứng PCR Bước Phản ứng Nhiệt độ (oC) Thời gian Chu kỳ Biến tính 94 phút Biến tính 94 40 giây Gắn mồi 59 40 giây Kéo dài chuỗi 72 40 giây Hoàn tất kéo dài 72 10 phút Kết thúc ∞ 35 Sản phẩm lưu trữ oC 2.3.5 Phương pháp điện di sản phẩm PCR Điện di sản phẩm PCR khoảng 30 phút gel agarose 1% 110V dung dịch đệm TAE 1X Gel sau điện di nhuộm với ethidium bromide nồng độ 0,5mg/ml phút, rửa sạch, sau soi đèn UV có bước sóng 320 nm chụp ảnh 2.3.6 Phương pháp tinh sản phẩm PCR Quá trình tinh thực theo Kit GenJET PCR Purification gồm bước sau: (1) Bổ sung Binding buffer vào sản phẩm PCR theo tỉ lệ : thể tích (2) Chuyển sang cột lọc, li tâm 12000 vòng/phút phút 4oC, loại bỏ dịch (3) Bổ sung 700 µl Washing buffer, li tâm 12000 vòng/phút phút (4) Chuyển cột lọc sang ống eppendort 1,5 ml, mở nắp phút cho bay cồn (5) Bổ sung 25µl nước khử ion, để phút, li tâm 12000 vòng/phút phút, thu dịch đáy 22 (6) Sản phẩm tinh điện di kiểm tra gel agarose 1% TAE 1X có marker chuẩn chụp ảnh ánh sáng cực tím Bảo quản sản phẩm tủ -20oC 2.3.7 Phương pháp đọc trình tự Sau tinh sản phẩm PCR, trình tự đoạn gen CYP79D1 xác định thiết bị giải trình tự nucleotide tự động ABIPRISM@3100 Genetic Analyzer (Applied Biosytem) Viện Công nghệ Sinh học 23 Chương KẾT QUẢ VÀ THẢO LUẬN 3.1 Kết quả tách chiết RNA, tạo cDNA nhân đoạn gen CYP97D1 Mẫu sắn sau thu thập tiến hành tách chiết RNA tổng số kit mô tả phần 2.3.1 - Chương Hình 3.1 Kết tách chiết RNA tổng số KM94: sắn KM94; XVP: sắn Xanh Vĩnh Phú Kết tách chiết RNA tổng số cho thấy mẫu RNA đạt hiệu suất độ tinh cao Sau tách chiết RNA tổng số tạo cDNA, q trình nhân đoạn gen mã hóa CYP79D1 tiến hành với cặp mồi đặc hiệu ME-F ME-R Thành phần chu trình nhiệt trình bày phần 2.3.3 Chương Hình 3.2 Kết PCR nhân đoạn gen CYP79D1 từ RNA tổng số 1-5: sắn KM94; 6-10: sắn Xanh Vĩnh Phú; M: Marker 1kb 24 Trên điện di đồ (hình 3.2) cho thấy sản phẩm PCR mẫu sắn có kích thước khoảng 0,5kb Kích thước hồn tồn phù hợp với tính tốn lý thuyết Các băng sáng, đậm, rõ nét khơng có sản phẩm phụ 3.2 Kết quả tách chiết DNA nhân đoạn gen CYP97D1 Song song với trình nhân đoạn gen CYP79D1 từ RNA tổng số, chúng tơi tiến hành nhân đoạn gen CYP79D1 từ DNA tổng số DNA tổng số tách chiết theo phương pháp mô tả phần 2.3.1 - Chương Hình 3.3 Kết điện di DNA tổng số Sắn KM94 Sắn xanh Vĩnh Phú Kết điện di gel agarose 1% cho thấy mẫu xuất băng sáng, rõ chứng tỏ tách DNA tổng số giống sắn với độ nguyên vẹn đảm bảo cho nhân đoạn DNA kĩ thuật PCR (Hình 3.3) Sau tách chiết thành cơng DNA tổng số, q trình nhân đoạn gen mã hóa CYP79D1 tiến hành với cặp mồi đặc hiệu ME-F ME-R Thành phần chu trình nhiệt trình bày phần 2.3.3 Chương Hình 3.4 Kết PCR nhân đoạn gen CYP79D1 M: marker 1kb; sắn KM94; 2: sắn Xanh Vĩnh Phú 25 Trên điện di đồ (Hình 3.4) cho thấy sản phẩm PCR mẫu sắn có kích thước khoảng kb Các băng sáng, đậm, rõ nét khơng có sản phẩm phụ 3.3 Xác định phân tích trình tự đoạn gen CYP79D1 giống sắn Xanh Vĩnh Phú KM94 Do sản phẩm PCR thu sau phản ứng khuếch đại gen có tạp chất mồi, đệm PCR, nucleotide dư đơi chứa sản phẩm phụ ảnh hưởng đến kết trình xác định trình tự nucleotide Chúng tiến hành tinh sản phẩm PCR mẫu sắn theo Kit GenJET DNA Purification Các đoạn gen sau tinh điện di gel agarose 1% để kiểm tra chất lượng giải trình tự gen Xác định trình tự nucleotide Sau giải trình tự, đoạn gen CYP79D1 xử lý chương trình BLAST NCBI phần mềm BioEdit Các trình tự đoạn gen CYP79D1 giống sắn xanh Vĩnh Phú giống sắn KM-94 so sánh với trình tự gen CYP79D1 có mã số AF140613 GenBank Sau xác định trình tự nucleotide phân tích phần mềm, kết cho thấy đoạn gen CYP79D1 giống sắn KM-94 sắn xanh Vĩnh Phú tách chiết từ RNA có kích thước 669 bp, gen CYP79D1 tách chiết từ DNA có kích thước 999 bp Tiếp theo, chúng tơi so sánh trình tự gen CYP79D1 giống sắn KM-94 sắn xanh Vĩnh Phú với trình tự gen AF140613 So sánh trình tự đoạn gen CYP79D1 giống sắn KM-94 sắn xanh Vĩnh Phú với trình tự có mã số AF140613 Genbank Trình tự gen CYP79D1 mã số AF140613 có kích thước 1629 bp Trình tự gen AF140613 phân lập từ cDNA trình tự gen gồm đoạn exon Kết so sánh cho thấy, đoạn gen CYP79D1 giống sắn KM-94 26 giống sắn xanh Vĩnh Phú có mức độ tương đồng với gen AF140613 99% Cặp mồi mà thiết kế để nhân đoạn gen CYP79D1 nằm từ nucleotide 674 tới nucleotide 1342 trình tự gen CYP79D1 mã số AF140613 Đây vùng bảo thủ họ gen đảm bảo cho trình làm câm lặng gen sau Khi so sánh trình tự nucleotide đoạn gen CYP79D1 giống Sắn Xanh Vĩnh Phú sắn KM94 tách từ DNA với gen có mã số AF140613 chúng tơi nhận thấy có khác vị trí nucleotide thứ 100 (từ nucleotide G thành nucleotide A) Tuy nhiên đoạn trình tự chúng tơi có vùng exon xen kẽ vùng intron, vùng intron nằm vị trí từ 345 đến 675 Do tương đồng đoạn gen với gen có mã số AF140613 chia làm vùng mơ tả hình 3.5 Hình 3.5 So sánh đồ họa trình tự đoạn gen CYP79D1 Khi so sánh trình tự nucleotide phân lập từ RNA tổng số với trình tự gen CYP79D1 mã số AF140613 Genbank cho thấy đoạn gen CYP79D1 giống sắn KM-94 giống sắn xanh Vĩnh Phú có mức độ tương đồng 99%, trình tự có khác vị trí nucleotide thứ 100 (từ nucleotide G thành nucleotide A) vị trí nucleotide thứ 130 (từ nuceotide G thành nuceotide A) Khi so sánh trình tự nucleotide phân lập từ DNA với trình tự nucleotide phân lập từ RNA tổng số chúng tơi nhận thấy có khác nhau: trình tự nucleotide phân lập từ RNA tổng số khơng có đoạn intron phân lập từ DNA 10 20 30 27 40 50 60 | | | | | | | | | | | | AF140613_CYP79D1 KM94-RNA CAAGAGATACTTCGGCAAGGGAATGCCGGACGGAGGACCAGGGCCTGAAGAAATCGAGCA -Xanh Vinh Phu-RNA KM94- DNA Xanh Vinh Phu-DNA 70 80 90 100 110 120 | | | | | | | | | | | | AF140613_CYP79D1 CATTGATGCCGTTTTCACTGCCTTGAAATACTTGTATGGGTTTTGCATATCAGATTTCTT KM94-RNA A Xanh Vinh Phu-RNA .A KM94- DNA A Xanh Vinh Phu-DNA .A 130 140 150 160 170 180 | | | | | | | | | | | | AF140613_CYP79D1 GCCTTTCTTGTTGGGACTTGATCTGGATGGCCAAGAAAAATTTGTGCTTGATGCAAATAA KM94-RNA A Xanh Vinh Phu-RNA A KM94- DNA Xanh Vinh Phu-DNA 190 200 210 220 230 240 | | | | | | | | | | | | AF140613_CYP79D1 GACCATAAGGGATTATCAGAACCCTTTAATTGATGAAAGGATTCAACAATGGAAGAGTGG KM94-RNA Xanh Vinh Phu-RNA KM94- DNA Xanh Vinh Phu-DNA 250 260 270 280 290 300 | | | | | | | | | | | | AF140613_CYP79D1 TGAAAGGAAGGAAATGGAGGACTTGCTTGATGTTTTCATCACTCTCAAGGATTCAGACGG KM94-RNA Xanh Vinh Phu-RNA KM94- DNA Xanh Vinh Phu-DNA 28 310 320 330 340 350 360 | | | | | | | | | | | | AF140613_CYP79D1 CAACCCATTGCTCACTCCTGACGAGATCAAGAATCAAATAGCTG KM94-RNA Xanh Vinh Phu-RNA -KM94- DNA TAAGATCACTCTCACT Xanh Vinh Phu-DNA TAAGATCACTCTCACT 370 380 390 400 410 420 | | | | | | | | | | | | AF140613_CYP79D1 KM94-RNA Xanh Vinh Phu-RNA KM94- DNA TCTTACAATTGCATGCTAATGATTGATTATGATGGTGAAATTTATATGGGACTCACTTTT Xanh Vinh Phu-DNA TCTTACAATTGCATGCTAATGATTGATTATGATGGTGAAATTTATATGGGACTCACTTTT 430 440 450 460 470 480 | | | | | | | | | | | | AF140613_CYP79D1 KM94-RNA Xanh Vinh Phu-RNA KM94- DNA TATTTTTTTATAGTAATTAGTATTTAATTATGATAAAAAAAAATTGGGTGAGGAAACATT Xanh Vinh Phu-DNA TATTTTTTTATAGTAATTAGTATTTAATTATGATAAAAAAAAATTGGGTGAGGAAACATT 490 500 510 520 530 540 | | | | | | | | | | | | AF140613_CYP79D1 KM94-RNA Xanh Vinh Phu-RNA KM94- DNA TCTAATTCATATTTTAAAAAAAAAAAAAAAGAAAAAAAAAACTTTTTTTGGGTATTTTGA Xanh Vinh Phu-DNA TCTAATTCATATTTTAAAAAAAAAAAAAAAGAAAAAAAAAACTTTTTTTGGGTATTTTGA 550 560 570 580 590 600 | | | | | | | | | | | | AF140613_CYP79D1 KM94-RNA Xanh Vinh Phu-RNA KM94- DNA ATTTCCCCCACAAAATTTTTATTTTTTTAAAAAAAAAAAAAAGAAAAGAGAAACTTTTTC Xanh Vinh Phu-DNA ATTTCCCCCACAAAATTTTTATTTTTTTAAAAAAAAAAAAAAGAAAAGAGAAACTTTTTC 29 610 620 630 640 650 660 | | | | | | | | | | | | AF140613_CYP79D1 KM94-RNA Xanh Vinh Phu-RNA KM94- DNA TGTGTATTTTGAATTTCTCGCACAAAATTTATATATATTTAAAAGAAATTAACATAAGTA Xanh Vinh Phu-DNA TGTGTATTTTGAATTTCTCGCACAAAATTTATATATATTTAAAAGAAATTAACATAAGTA 670 680 690 700 710 720 | | | | | | | | | | | | AF140613_CYP79D1 AAATTATGATAGCAACAGTAGATAACCCATCAAACGCAATCGAATG KM94-RNA Xanh Vinh Phu-RNA KM94- DNA TATATGGTTGCAGG Xanh Vinh Phu-DNA TATATGGTTGCAGG 730 740 750 760 770 780 | | | | | | | | | | | | AF140613_CYP79D1 GGCAATGGGGGAGATGCTAAATCAACCAGAAATCCTGAAGAAGGCCACAGAAGAGCTCGA KM94-RNA Xanh Vinh Phu-RNA KM94- DNA Xanh Vinh Phu-DNA 790 800 810 820 830 840 | | | | | | | | | | | | AF140613_CYP79D1 CAGGGTGGTCGGCAAAGACAGGCTTGTTCAAGAATCCGACATCCCCAACCTTGACTATGT KM94-RNA Xanh Vinh Phu-RNA KM94- DNA Xanh Vinh Phu-DNA 850 860 870 880 890 900 | | | | | | | | | | | | AF140613_CYP79D1 CAAAGCCTGTGCAAGAGAAGCCTTCAGGCTCCATCCAGTAGCACACTTCAATGTCCCTCA KM94-RNA Xanh Vinh Phu-RNA KM94- DNA Xanh Vinh Phu-DNA 910 920 930 30 940 950 960 AF140613_CYP79D1 KM94-RNA Xanh Vinh Phu-RNA KM94- DNA Xanh Vinh Phu-DNA | | | | | | | | | | | | TGTAGCCATGGAAGACACTGTCATTGGTGATTACTTTATTCCAAAGGGCAGCTGGGCAGT 970 980 990 | | | | | | | AF140613_CYP79D1 TCTCAGCCGCTATGGGCTCGGCAGGAACCCAAAGACATG KM94-RNA Xanh Vinh Phu-RNA KM94- DNA Xanh Vinh Phu-DNA Dựa trình tự gen CYP79D1 CYP79D2 họ cytochrome P450, sử dụng thuật tốn Blast để xác định tồn vị trí gen CYP79D1 CYP79D2 sở liệu sắn Khi tìm kiếm gen CYP79 sắn sở liệu sắn, nhận thấy gen CYP79D1 nằm nhiễm sắc thể 13 có mã định danh cassava4.1_005059m nằm locus Manes.13G094200, CYP79D2 nằm nhiễm sắc thể 12 có mã định danh cassava4.1_005079m nằm locus Manes_12G133500 Ngoài ra, chúng tơi tìm thấy gen CYP84A1 nằm nhiễm sắc thể có mã định danh cassava4.1_024692m nằm locus Manes.04G084200, gen CYP81D1 nằm nhiễm sắc thể có mã định danh cassava4.1_024196m nằm locus Manes.05G178600, gen CYP93A2 nằm nhiễm sắc thể có mã định danh cassava4.1_027206m nằm locus Manes.07G003300 (hình 3.6) Hình 3.6 Vị trí phân bố số gen CYP hệ gen sắn KẾT LUẬN VÀ ĐỀ NGHỊ 31 Kết luận Đã tách chiết DNA tổng số khuếch đại thành công đoạn gen CYP79D1 kỹ thuật PCR mẫu sắn xanh Vĩnh Phú KM94 Đã tách chiết RNA tổng số khuếch đại thành công đoạn gen CYP79D1 kỹ thuật PCR mẫu sắn xanh Vĩnh Phú KM94 Đã phân lập thành cơng xác định trình tự nucleotide đoạn gen CYP79D1 từ DNA giống sắn xanh Vĩnh Phú giống sắn KM-94 Đoạn gen CYP79D1 thu có kích thước 999 bp, bao gồm vùng exon vùng intron Đã phân lập thành cơng xác định trình tự nucleotide đoạn gen CYP79D1 từ RNA tổng số giống sắn xanh Vĩnh Phú giống sắn KM-94 Đoạn gen CYP79D1 thu có kích thước 669 bp Đề nghị Kết nghiên cứu đặt tiền đề cho việc tiếp tục nghiên cứu ứng dụng đoạn gen kỹ thuật RNAi nhằm làm giảm hàm lượng HCN sắn Việt Nam Đề nghị tiếp tục nghiên cứu trình tự đoạn gen liên quan đến trình tổng hợp hydrogen cyanide sắn số lồi thực vật có chứa chất 32 TÀI LIỆU THAM KHẢO TIẾNG VIỆT Hoàng Kim Anh, Ngơ Kế Sương, Nguyễn Xích Liên (2004), Tinh bột sắn sản phẩm từ tinh bột sắn , Nhà xuất Khoa học Kỹ thuật, Hà Nội Hoàng Kim, Trần Ngọc Ngoạn, Nguyễn Thị Trúc Mai, Võ Văn Quang, Nguyễn Bạch Mai, Nguyễn Thị Lệ Dung, Nguyễn Phương, Hồng Long, Nguyễn Minh Cường, Đào Trọng Tuấn, Trần Cơng Khanh, Nguyễn Minh Hiếu, Nguyễn Văn Bộ, Nguyễn Thị Cách, Nguyễn Trọng Hiển, Lê Huy Ham, H Ceballos and M Ishitani (2014a), Kết chọn tạo phát triển giống sắn KM419, Bộ Nông nghiệp Phát triển Nông thôn, Hội đồng Giống Quốc gia, Hà Nội ngày 16 tháng 11 năm 2014 Hoàng Kim (2013), Cây Lương thực Việt Nam (lúa, ngô, sắn, khoai lang), Đại học Nơng Lâm, TP Hồ Chí Minh, 279 trang Hồng Kim, Nguyễn Đăng Mãi (2001), Sắn Việt Nam: Hiện trạng, định hướng giải pháp phát triển năm đầu kỷ 21, Nhà xuất Nông nghiệp Đinh Thế Lộc, Võ Nguyên Quyền, Bùi Thế Hùng, Nguyễn Thế Hùng (1997), Giáo trình Cây lương thực, Nhà xuất Nông nghiệp, Hà Nội, tr 121- 134 TIẾNG ANH FAO/WHO (1993), Cyanogenic glycosides In “Toxicological evaluation of certain food additives and naturally occurring toxicants” Geneva, World Health Organization, 39th Meeting of the Joint FAO/WHO Expert Committee on Food Additives (WHO Food Additives Series 30) Halstrom F, Moller KO (1945), “The content of cyanide in human organs from cases of poisoning with cyanide taken by mouth; with a contribution to the toxicology of cyanides”, Acta Pharmacol Toxicol (Copenh), 1(1), pp 18-28 33 Heuberger C (2005), Cyanide Content of Cassava and Fermented Products with Focus on Attiéké and Attiéké Garba, Swiss Federal Institute of Technology, Zurich, Switzerland IPCS (2004), Hydrogen cyanide and cyanides: human health aspects, Geneva, World Health Organization, International Programme on Chemical Safety (Concise International Chemical Assessment Document No 61) 10 Joey Kwok (2008), Cyanide Poisoning and Cassava, Food Safety Focus (19) 11 Jorgensen K., Bak S., Busk PK., Sorensen C., Olsen CE., Puonti-Kaerlas J., Moller BL (2005a), Cassava plants with a depleted cyanogenic glucoside content in leaves and tubers: distribution of cyanogenic glucosides, their site of synthesis and transport, and blockage of the biosynthesis by RNA interference technology, Plant Physiol, 139, pp 363-374 12 Hoang Kim, Nguyen Van Bo, Hoang Long, Nguyen Trong Hien, H Ceballos and R Howeler (2010), “Current situation of cassava in Vietnam”, A New Future for Cassava in Asia: Its Use as Food, Feed and Fuel to Benefit the Poor, Proc 8th Regional Workshop, held in Vientiane, Lao PDR Oct 20-24, 2008, pp 100-112 13 Kirsten A.N., Olsen CE., Pontoppidan K., Møller BL (2002), LeucineDerived Cyano Glucosides in Barley, Plant Physiol., 129 (3): 1066-1075 14 Li H.Q (1996), Genetic transformation of cassava (Manihot esculenta Crantz), Nature Biotech., 14: 736-740 15 Mette Dahl Andersen (1999), “Cytochromes P-450 from Cassava (Manihot esculenta Crantz) - Catalyzing the First Steps in the Biosynthesis of the Cyanogenic Glucosides Linamarin and Lotaustralin”, The journal of biological chemistry, 275 (3), pp 1966 - 1975 16 M.P.Cereda, M.C.Y.Mattos (1996), Linamarin - the toxic compound of cassava, Journal of Venomous Animals and Toxins, 2(1) 34 17 Narayanan N Narayanan, Uzoma Ihemere, Claire Ellery, Richard T Sayre (2011), Overexpression of Hydroxynitrile Lyase in Cassava Roots Elevates Protein and Free Amino Acids while Reducing Residual Cyanogen Levels, PloS one., 6(7): e21996 18 Nartey F (1980), Toxicological aspects of cyanogenesis in tropical foods, In: Smith RL, Bababumni ER, eds Toxicology in the tropics London, Taylor & Francis, 53-73 19 Padmaja G (1995), Cyanide detoxification in cassava for food and feed uses, Crit Rev Food Sci Nutr; 35(4), pp 299-339 20 Seigler DS (1991), Cyanide and cyanogenic glycosides In “Herbivores: their interactions with secondary plant metabolites” (Eds GA Rosenthal, MR Berenbaum), pp 35-77 21 Takos AM, Knudsen C, Lai D, Kannangara R, Mikkelsen L, Motawia MS, Olsen CE, Sato S, Tabata S, Jørgensen K, Møller BL, Rook F (2011), Genomic clustering of cyanogenic glucoside biosynthetic genes aids their id entificationin Lotus japonicus and suggests the repeated evolution of this chemical defencepathway, Plant J., 68(2), pp 273-86 22 Y.P.Abrol, A.Ahmad (2003), Sulphur in Plants, 147-149; Mikkelsen MD, Halkier BA., Metabolic engineering of valine- and isoleucine-derived glucosinolates in Arabidopsis expressing CYP79D2 from Cassava, Plant Physiol 2003 Feb;131(2):773-9 TÀI LIỆU THAM KHẢO KHÁC 23 Độc tố HCN sản phẩm sắn, http://lib.dntu.edu.vn:8080/dspace/bitstream/DNTU_123456789/1140/2/Gia o%20trinh%20doc%20to%20trong%20thuc%20an%20chan%20nuoi%20% 202.pdf 24 Giá trị dinh dưỡng sắn, http://iasvn.org/chuyen-muc/Gia-tri-dinh-duongcua-San-4488.html, 29.10.2016 35 25.https://vi.wikipedia.org/wiki/S%E1%BA%AFn#Ngu%E1%BB%93n_g%E1 %BB%91c,_l%E1%BB%8Bch_s%E1%BB%AD 26 Tổng cục Thống kê (2017), http://www.gso.gov.vn 27 https://www.genome.jp/kegg-bin/get_htext?ko00199+K13401 36 ... ––––––––––––––––––––– NGUYỄN THỊ THÙY PHÂN LẬP ĐOẠN GEN CYP79D1 LIÊN QUAN ĐẾN SỰ TỔNG HỢP HYDROGEN CYANIDE CỦA CÂY SẮN (MANIHOT ESCULENTA) Ngành: DI TRUYỀN HỌC Mã số: 42 01 21 LUẬN VĂN THẠC SĨ SINH HỌC Cán hướng... Phân lập đoạn gen CYP79D1 liên quan đến tổng hợp Hydrogen cyanide sắn (Manihot esculenta) Mục tiêu nghiên cứu - Phân lập đoạn gen mã hóa cytochrome P450 sắn Nội dung nghiên cứu - Tách chiết RNA tổng. .. sắn - Nhân đoạn gen CYP79D1 kỹ thuật PCR - Xác định trình tự đoạn gen CYP79D1 Chương TỔNG QUAN TÀI LIỆU 1.1 Cây sắn (Manihot esculenta Crantz) 1.1.1 Phân loại, nguồn gốc phân bố sắn Cây sắn (Manihot
- Xem thêm -

Xem thêm: Phân lập đoạn gen Cyp79D1 liên quan đến sự tổng hợp Hydrogen Cyanide của cây sắn (Manihot Esculenta) (Luận văn thạc sĩ), Phân lập đoạn gen Cyp79D1 liên quan đến sự tổng hợp Hydrogen Cyanide của cây sắn (Manihot Esculenta) (Luận văn thạc sĩ)

Gợi ý tài liệu liên quan cho bạn

Nhận lời giải ngay chưa đến 10 phút Đăng bài tập ngay