ĐÁNH GIÁ NGUỒN GEN KHÁNG BỆNH SƯƠNG MAI TRÊN CÀ CHUA BẰNG CHỈ THỊ PHÂN TỬ SSR

50 13 0
  • Loading ...
1/50 trang

Thông tin tài liệu

Ngày đăng: 27/02/2019, 12:09

BỘ GIÁO DỤC VÀ ĐÀO TẠO TRƯỜNG ĐẠI HỌC NÔNG LÂM THÀNH PHỐ HỒ CHÍ MINH BỘ MƠN CƠNG NGHỆ SINH HỌC KHÓA LUẬN TỐT NGHIỆP ĐÁNH GIÁ NGUỒN GEN KHÁNG BỆNH SƯƠNG MAI TRÊN CÀ CHUA BẰNG CHỈ THỊ PHÂN TỬ SSR Ngành học : CÔNG NGHỆ SINH HỌC Sinh viên thực : NGUYỄN XUÂN NAM Niên khóa : 2006 – 2010 Tháng 7/2010 BỘ GIÁO DỤC VÀ ĐÀO TẠO TRƯỜNG ĐẠI HỌC NÔNG LÂM THÀNH PHỐ HỒ CHÍ MINH BỘ MƠN CƠNG NGHỆ SINH HỌC KHĨA LUẬN TỐT NGHIỆP ĐÁNH GIÁ NGUỒN GEN KHÁNG BỆNH SƯƠNG MAI TRÊN CÀ CHUA BẰNG CHỈ THỊ PHÂN TỬ SSR Hướng dẫn khoa học Sinh viên thực ThS TRƯƠNG QUỐC ÁNH NGUYỄN XUÂN NAM Tháng 7/2010 LỜI CẢM ƠN Đầu tiên em xin cảm ơn quý thầy cô Bộ môn Công nghệ sinh học, trường Đại học Nông lâm TP HCM tận tình dạy dỗ, bảo giúp đỡ em trình học tập Em xin chân thành cảm ơn Thạc sĩ Trương Quốc Ánh Viện Khoa học kỹ thuật Nông nghiệp miền Nam, tận tình giúp đỡ, hướng dẫn động viên em trình thực đề tài Em xin cảm ơn tập thể anh chị phòng Cơng nghệ sinh học nhiệt tình giúp đỡ em thời gian thực tập viện Cảm ơn anh Khoa, bạn Nhung em thực đề tài Xin cảm ơn bạn bè lớp giúp đỡ mặt tinh thần đóng góp ý kiến để tơi hồn thành luận văn TP Hồ Chí Minh, Tháng năm 2010 Nguyễn Xuân Nam   i TÓM TẮT Cà chua (Lycopersicon esculentum Mill.) loại rau màu trồng phổ biến giới đứng thứ hai sau khoai tây Cà chua chịu ảnh hưởng nhiều lồi trùng dịch bệnh bệnh sương mai gây nấm Phytophthora infestans (Mont) de Bary bệnh nguy hiểm Tác nhân gây bệnh công lá, thân, hạt cà chua Biện pháp hoá học sử dụng thuốc trừ nấm biện pháp có hiệu để kiểm sốt bệnh Chiến lược làm tăng chi phí sản xuất ảnh hưởng đến môi trường với mức độ cao thuốc trừ nấm Sử dụng giống kháng phương pháp hiệu để kiểm soát dịch bệnh Việc sử dụng kỹ thật chọn lọc nhờ thị phân tử (MAS) dễ dàng chọn tạo giống cà chua nhằm cải tiến tính trạng nơng sinh học tính kháng bệnh Trình tự lặp lại đơn giản (SSR) phổ biến thay đổi gen sinh vật nhân thật Cho nên đề tài dựa vào kết đánh giá kiểu hình để xác định giống kháng giống nhiễm bệnh sương mai Sau thực phản ứng PCR để tìm marker SSR cho đa hình liên kết với gen kháng bệnh sương mai cà chua Kết xác định marker TOM236 liên kết với gen kháng bệnh sương mai Ph-3 nằm nhiễm sắc thể số giống L3708 Tạo tiền đề cho chọn tạo giống cà chua kháng bệnh sương mai   ii SUMMARY Subject title “Evaluation of late blight resistant sources on tomato varieties by molecular marker SSR” The cultivated tomato (Lycopersicon esculentum Mill.) is a worldwide-grown vegetable crop in the second grade after potato Cultivated tomato influenced by many pest and disease which late blight caused by Phytophthora infestans (Mont.) de Bary is a most devastating disease of tomato This oomycete pathogen attacks leaves, stems, fruits and seeds of tomato Chemical spray containing fungicides is the only effective method to control the disease This strategy increases production costs and exposes the environment to higher levels of fungicides Introduction of resistant varieties is the most effective measure to control this disease The use of molecular markers can facilitate tomato breeding through marker assisted selection (MAS) for improvement of agronomic traits such as disease resistance Simple sequence repeats (SSR) are not only very common but also hyper variable among the types of tandem repetitive DNA in the genome of eukaryotes Result was identified TOM236 marker shown linkage tighly to Ph-3 resistant gene located on chromosome by L3708 tomato variety open up for selection of Ph-3 resistant gene into cultivated tomato by masker asissted selection   iii MỤC LỤC Trang LỜI CẢM ƠN i TÓM TẮT ii SUMMARY iii MỤC LỤC iv DANH SÁCH CÁC CHỮ VIẾT TẮT vii DANH SÁCH CÁC BẢNG viii DANH SÁCH CÁC HÌNH viii Chương MỞ ĐẦU .1 1.1 Đặt vấn đề 1.2 Yêu cầu .1 1.3 Nội dung thực Chương TỔNG QUAN TÀI LIỆU 2.1 Giới thiệu cà chua 2.1.1 Phân loại cà chua 2.1.2 Nguồn gốc 2.1.3 Giá trị dinh dưỡng 2.1.4 Đặc tính thực vật 2.2 Tình hình sản xuất cà chua giới nước 2.2.1 Tình hình sản xuất cà chua giới 2.2.2 Tình hình sản xuất cà chua nước 2.3 Bệnh sương mai cà chua .6 2.3.1 Triệu chứng bệnh 2.3.2 Nguyên nhân gây bệnh 2.3.3 Biện pháp phòng trừ bệnh sương mai 2.4 Các nghiên cứu bệnh sương mai 2.4.1 Các nghiên cứu giới 2.4.2 Các nghiên cứu nước 11 2.5 DNA marker 12 2.5.1 Các loại DNA marker 12   iv 2.5.2 Marker RFLP .12 2.5.3 Marker AFLP .13 2.5.4 Marker RAPD 14 2.5.5 Marker SSR 14 2.5.5.1 Khái niệm microsatellite 14 2.5.5.2 Các loại microsatellite 15 2.5.5.3 Vai trò microsatellite 15 2.5.5.4 Nguyên tắc phát microsatellite phản ứng PCR 16 2.5.5.5 Ưu điểm phương pháp microsatellite .17 2.5.5.6 Ứng dụng phương pháp microsatellite .18 2.6 Phản ứng PCR 19 2.6.1 Nguyên tác PCR 19 2.6.2 Các yếu tố ảnh hưởng đến phản ứng PCR 20 2.7 Phương pháp điện di gel agarose 21 Chương VẬT LIỆU VÀ PHƯƠNG PHÁP NGHIÊN CỨU .22 3.1 Thời gian địa điểm nghiên cứu 22 3.2 Vật liệu 22 3.2.1 Mẫu thí nghiệm 22 3.2.2 Hóa chất .22 3.2.3 Dụng cụ thiết bị 24 3.3 Phương pháp nghiên cứu 24 3.3.1 Phương pháp đánh giá kiểu hình 24 3.3.2 Phương pháp đánh giá kiểu gen 24 3.3.2.1 Phương pháp li trích DNA tổng số 24 3.3.2.2 Kiểm tra DNA tổng số phương pháp điện di 25 3.3.2.3 Định lượng DNA máy đo quang phổ kế 25 3.3.2.4 Thực phản ứng PCR với marker SSR 26 3.3.2.5 Xác định marker SSR liên kết với gen kháng bệnh sương mai 27 4.1 Đánh giá kiểu hình 29 4.2 Đánh giá kiểu gen 35 4.2.1 Kiểm tra DNA tổng số 35 4.2.2 Thực phản ứng PCR với primer SSR 35   v Chương KẾT LUẬN VÀ ĐỀ NGHỊ 38 5.1 Kết luận 38 5.2 Đề nghị 38 TÀI LIỆU THAM KHẢO .39   vi DANH SÁCH CÁC CHỮ VIẾT TẮT al : allele AFLP : Amplified Fragment Length Polymorphism BC : Backcross cM : centi Morgan ctv : cộng tác viên DNA : Deoxyribonucleotide Acid dNTP : Deoxyribonucleotide Triphosphate MAS : Marker Assisted Selection OD : Optical Density PCR : Polymerase Chain Reaction QTL : Quantitative Trait Loci RAPD : Random Amplified Polymorphism DNA RFLP : Restriction Fragment Length Polymorphism SSR : Simple Sequence Repeat STR : Short Tandem Repeats Tm : Melting temperature UV : Ultra violet VNTR : Variable Number of Tandem Repeats   vii DANH SÁCH CÁC BẢNG Trang Bảng 2.1 Các loại DNA marker 12 Bảng 3.1 Thành phần hóa chất cho phản ứng PCR 26 Bảng 3.2 Chu trình nhiệt cho phản ứng PCR 26 Bảng 3.3 Danh sách cặp primer sử dụng thí nghiệm 26 Bảng 4.1 Kết mức độ nhiễm bệnh tập đoàn cà chua 29 Bảng 4.2 Thang điểm đánh giá mức độ kháng – nhiễm 31 Bảng 4.3 Kết mức độ nhiễm bệnh giống có gen kháng 32 Bảng 4.4 Kết lây nhiễm tách rời 34 Bảng 4.5 Kết lây nhiễm 34 DANH SÁCH CÁC HÌNH Trang Hình 2.1 Cà chua bị bệnh sương mai Hình 2.2 Bào tử nấm Phytophthora infestans .8 Hình 2.4 Marker SSR phương pháp phát 17 Hình 4.1 Kết điện di DNA tổng số 35 Hình 4.2 Kết PCR với primer SSR112 35 Hình 4.3 Kết PCR với primer TOM236 36   viii 3.3.2.4 Thực phản ứng PCR với marker SSR DNA khuếch đại với primer SSR phản ứng PCR Trong đề tài này, chúng tơi sử dụng thành phần hóa chất chu trình nhiệt theo ZHU Hai-shan ctv (2006) Bảng 3.1 Thành phần hóa chất cho phản ứng PCR Hóa chất Nồng độ sử dụng PCR buffer 1X MgCl2 1.5 mM dNTP 0,4 μM Primer μM Taq polymerase 1.5U DNA mẫu 30 ng H2O Thêm vừa đủ 25 μl Bảng 3.2 Chu trình nhiệt cho phản ứng PCR Số chu kỳ Nhiệt độ (oC) Thời gian 95 10 phút 95 phút Ta 30 giây 72 30 giây 72 10 phút 30 Giữ 4oC Bảng 3.3 Danh sách primer SSR sử dụng   Số thứ tự (1) Primer (2) SSR19 SSR28 Trình tự (3) F CCGTTACCTTGGTCCATCAC R GGGAGATGCCACATCACATA F ACCAAATGGAAATGGGTCAA R CCCTAAGACTAACGACAACCAA 26 Trình tự lặp lại (4) (AT)16 (CT)13 Bảng 3.3 (tt) Danh sách primer SSR sử dụng (1) (2) SSR69 SSR70 SSR73 SSR99 SSR155 SSR237 SSR340 10 SSR383 11 SSRB56555 12 SSR110 13 SSR333 14 SSR599 15 SSR112 16 TOM236 (3) F TTGGCTGGATTATTCCTGTTG R GCATTTGATAGAAGGCCAGC F TTTAGGGTGTCTGTGGGTCC R GGAGTGCGCAGAGGATAGAG (TAT)7 (AT)20 F TGGGAAGATCCTGATGATGG (AG)2 R TTCCCTTTCCTCTGGACTCA (AGA)7 F GCCTCGGATTCAATAGCATTA (AG)6 R CACAAAGAAGCAAACAACTCCA (AT)5 F TACATGGTGCTCAAACTCGC R TGGTTGAGAAGGACAGGTGA F GTGGTAACGGCAAAGGGACT R CTTATGGCCTTAGCAGCCAG (TAT)9 (AT)11 F TTCTCTCTGTCGCCATTGTG (GTTGA)2 R AAATCAACGCCAATGGTAGG (GA)7 F ATTGTACAAAGACCCGTGGC R GTTGCACACTGGATCAATGC F TGCGGTAGACCCACTGAGTTATCTC R AAAAGGGAAGCATTTCTTCTCTCCC F TGTAACGTCAAACTTCAGGTG R CTCCGCAATGTGTTGTATGG F GTTCCCGCTTGAGAAACAAC R CCAATGCTGGGACAGAAGAT (AT)11 (AT)10 (AT)13 F GGATTTCTCATGGAGAATCAGTC (TCA)6 R TCCCTTGATCTTGATGATGTTG (TCATTA)2 F GGAACACAACCAAGAAGTGGA R TATCGGCTTAGGGTTGTTGG F GTTTTTTCAACATCAAAGAGC R GGATAGGTTTCGTTAGTGAACT     (4) 27 (AAT)7 (AT)16 3.3.2.5 Xác định marker SSR liên kết với gen kháng bệnh sương mai Sản phẩm PCR điện di giống kiểm tra DNA tổng số gel agarose sử dụng 2%, sau nhuộm ethidium bromide 20 phút chụp gel tia UV Từ kết chụp gel, so sánh band điện di với để tìm locus cho đa hình mẫu từ kháng bệnh mẫu từ nhiễm bệnh   28 Chương KẾT QUẢ VÀ THẢO LUẬN 4.1 Đánh giá kiểu hình Tất mẫu giống địa phương, kể dạng cà chua hoang dại thu thập vùng chịu áp lực bệnh lớn (có nhiệt độ mát mẻ, ẩm độ cao, trồng cà chua nhiều vụ: Đà Lạt - Lâm Đồng, Quản Bạ - Hà Giang), giống chọn tạo, giống F1 trồng phổ biến xuất vết bệnh lan rộng với tất isolate (chỉ số bệnh > 3) Điều cho thấy mơ cà chua khơng có phản ứng kháng sau bị nấm bệnh xâm nhập   Bảng 4.1 Kết mức độ nhiễm bệnh tập đoàn cà chua   Mẫu giống Tên, nơi thu thập (1) (2) Chỉ số bệnh trung bình LS TF6 PF12 (3) (4) (5) 08TP01 Viện nghiên cứu rau 4.33 4.33 - 08TP02 Viện nghiên cứu rau 3.80 4.93 4.93 08TP03 Viện nghiên cứu rau 3.87 4.44 - 08TP04 Viện nghiên cứu rau 4.40 4.40 - 08TP05 Viện nghiên cứu rau 3.73 4.67 - 08TP06 Viện nghiên cứu rau 4.33 4.13 4.83 08TP07 Viện nghiên cứu rau 5.67 4.83 - 08TP08 Viện nghiên cứu rau 4.80 4.20 - 08TP09 Viện nghiên cứu rau 3.47 3.87 5.27 08TP10 Viện nghiên cứu rau - 4.67 - 08TP12 Viện nghiên cứu rau - 4.25 - 08TP13 Viện nghiên cứu rau 3.67 4.87 - 08TP14 Viện nghiên cứu rau 4.13 5.00 - 08TP15 Viện nghiên cứu rau 4.33 4.80 - 08TP16 Viện nghiên cứu rau 3.50 4.80 - 08TP17 Viện nghiên cứu rau 4.47 4.60 - 08TP18 Viện nghiên cứu rau 3.73 4.80 - 29 Bảng 4.1 (tt) Kết mức độ nhiễm bệnh tập đoàn cà chua (1)   (2) (3) (4) (5) 08TP20 Viện nghiên cứu rau 4.60 4.53 - 08TP21 Viện nghiên cứu rau - 4.78 - 08TP22 Viện nghiên cứu rau - 4.50 - 08TP24 Viện nghiên cứu rau - 4.67 - 08TP25 Viện nghiên cứu rau - 4.67 - 08TP34 Chợ Hòa An, TX Cao Bằng, Cao Bằng 3.20 4.93 2.73 08TP35 Cà Kiu 3.53 4.73 3.07 08TP36 Cà chua Thóc , Phú lương, Thái nguyên 4.60 4.73 - 08TP37 Cà chua trái vụ, Quản Bạ, Hà Giang 4.53 4.73 - 08TP38 Chợ Cần Thơ, Hậu Giang 4.60 4.87 - 08TP39 Thắng Lợi, Kon tum 4.13 5.27 - 08TP40 Thành Hưng, Thạch Thành, Thanh Hóa 3.00 4.93 5.07 08TP41 Vĩnh Hưng, Vĩnh Lộc, Thanh Hóa 2.53 4.93 3.20 08TP42 Cà chua Lèng, Quảng Bình 5.93 5.13 - 08TP43 Cà chua Thóc, Na Rỳ, Bắc Cạn 2.80 4.80 2.87 08TP44 Cà chua Thóc, Tân Thành, Bắc sơn, Lạng Sơn 3.93 4.93 - 08TP45 Cà chua ta, Vĩnh Hưng, Vĩnh Lộc, Thanh Hóa 3.27 4.67 2.00 08TP46 Kia sui, Đà Bắc, Hòa Bình 3.87 4.80 - 08TP47 Cà chua Miếng, Lệ Thủy, Quảng Bình - 4.60 - 08TP48 Cà chua dại, Lâm Đồng 3.27 4.87 3.47 08TP49 Kiêm Lúng Piêu, Mường Cơi, Phù Yên, Sơn La 4.67 5.17 - 08TP50 Chí Nừ Xúa, Thanh Nưa, Điện Biên 4.87 4.73 - 08TP51 Mác Chẻ, Hồng Thái, Nà Hang, Tuyên Quang 4.13 4.93 - 08TP52 Cà chua Ba Lan, Chí Linh, Hải Dương 3.20 4.75 3.07 08TP59 Cà chua Hồng Lan, Gia Lộc, Hải Dương 2.87 4.67 2.07 08TP61 Tường Sơn, Anh Sơn, Nghệ An 2.33 4.47 2.83 08TP77 Poseidon (F1) 3.40 4.67 - 08TP78 Zeus 42 (F1) 4.13 4.87 - 08TP79 Ta Sie (F1) 4.40 4.87 - 30 Bảng 4.1 (tt) Kết mức độ nhiễm bệnh tập đoàn cà chua (1) (2) (3) (4) (5) 08TP80 European Rapsodie (F1) 4.00 4.92 - 08TP81 Reliance (F1) 4.50 4.93 - 08TP82 Rafito (F1) 4.00 4.33 - 08TP85 Kim Cương Đỏ (F1) 3.08 3.13 - 08TP86 Hồng Ngọc (F1) 4.07 4.87 - 08TP87 Savior (F1) 3.93 4.33 - 08TP88 TH1389 (F1) 4.07 4.73 - 08TP89 ANNA (F1) 4.00 4.53 - 08TP90 Suvival Tomato (F1) 3.75 5.07 - 08TP91 CS1, Viện nghiên cứu rau 4.00 4.00 - 08TP92 PT18, Viện nghiên cứu rau 3.40 5.07 - Bảng 4.2 Thang điểm đánh giá mức độ kháng – nhiễm Điểm Mức độ kháng – nhiễm Kháng mạnh Kháng trung bình Kháng nhẹ Nhiễm nhẹ Nhiễm trung bình Nhiễm nặng Nhìn chung mẫu giống mẫn cảm cao với isolate TF6 phân lập từ cà chua Đà Lạt – Lâm Đồng Trong nhóm isolate phân lập từ khoai tây, isolate PF12 (Lâm Đồng) có độc tính cao isolate LS nhiều mẫu giống Kết phản ánh isolate TF6 có độc tính cao nhất, tiếp đến PF12 LS Đây xem kết tìm kiếm nguồn gen kháng bệnh sương mai mẫu giống địa phương phương pháp lây bệnh nhân tạo Trong mẫu giống thu thập khơng xác định mẫu giống kháng bệnh Theo Rick (1982) hầu hết nguồn gen kháng bệnh cà chua tìm thấy lồi hoang dại Trong nước ta nơi nguyên sản cà chua mà du   31 nhập trồng trọt khoảng 100 năm Bên cạnh đó, giống cà chua thương mại (F1) công ty giống phổ biến, nên quỹ gen giống địa phương vốn nghèo nàn lại ngày bị xói mòn Sau khơng tìm giống cà chua có khả kháng tốt với bệnh sương mai giống cà chua sản xuất, tiếp tục nghiên cứu khả kháng giống có gen kháng bệnh Bảng 4.3 Kết mức độ nhiễm bệnh giống có gen kháng Lá tách rời PF12 TF6 LS Mẫu giống Gen kháng Chỉ số bệnh Cả RiFAV Chỉ Số bào số tử bệnh (x103) Chỉ số bệnh NOVA Ph-1 5,00 - 4,33 - - - West Virginia 700 Ph-1 ,Ph-2 1,47 2,33 4,67 5,33 5,33 3,87 L3708 Ph-3 - - 1,16 2,00 0,5 1,04 LA3151 Ph-2 4,33 1,73 4,60 - - 4,98 LA3152 Ph-2 4,00 1,66 4,58 4,00 10,0 4,67 PT18 Nhiễm 3,90 - 5,57 - - - 08TP03 Nhiễm 3,90 - 4,44 5,00 13,5 3,50 Sự khác rõ nét kiểu gen isolate thể bảng 4.2 Các mẫu giống đối chứng mẫn cảm bệnh thể nhiễm bệnh nặng lần lây, điều thể chất di truyền chúng khẳng định độ ổn định xác lây nhiễm nhân tạo Tương tự nhận định bảng 4.1, số bệnh hầu hết mẫu giống tăng lây isolate TF6 phân lập từ cà chua Đà Lạt Giống cà chua chế biến NOVA mang gen kháng Ph-1, xác định gen trội hồn tồn có nguồn gốc từ số mẫu cà chua hoang dại thuộc nhóm S.pimpinellifolium (West Virginia 19 731) Nhưng lây với chủng nấm LS TF6 bị nhiễm bệnh nặng Tương tự ảnh hưởng gen Ph-1, giống mang gen Ph-2 (LA3151, LA3152) khơng thể tính kháng isolate LS TF6 Tuy nhiên gen Ph-2   32 phần thể tính kháng isolate PF12 Điều lại lần khẳng định khác biệt độc tính isolate dùng thí nghiệm Mẫu giống West Virginia 700 (thuộc nhóm L pimpinellifolium) mang đồng thời gen Ph-1 Ph-2, thể tính kháng rõ rệt isolate có độc tính khơng cao (LS) Điều cho thấy tạo giống cần tạo giống tổ hợp nhiều gen kháng, qua khơng đạt mức kháng cao mà kháng bền vững với isolate Đối với isolate có độc tính cao (TF6), tác động cộng gộp gen Như tạo giống mang nhiều gen kháng cần thiết trường hợp tổ hợp gen Ph-1 Ph-2 không tạo kết vượt trội isolate có độc tính cao Kết cho thấy gen Ph-1 Ph-2 tỏ khơng hiệu isolate nấm sương mai hại cà chua Việt nam Đối với isolate TF6, tất mẫu giống thể nhiễm bệnh cao, ngoại trừ L3708 (thuộc nhóm Solanum pimpinellifolium) mang gen Ph-3 Điều cho thấy gen có hiệu cao isolate mà gen Ph-1 Ph-2 hiệu lực Qua đánh giá biểu L3708 cho thấy mẫu giống kháng bệnh cao với chủng nấm sương mai Đài loan, châu Á, châu Phi Nam Mỹ (Black ctv, 1996b) Với mục tiêu tìm mẫu giống kháng nhiều isolate tiếp tục lây nhiễm mẫu giống xác định kháng isolate trước (LS, PF12, TF6) với isolate RIFAV (được phân lập từ cà chua Viện nghiên cứu rau quả) Kết hợp tiêu số bệnh số bào tử tạo ra, cho thấy L3708 mẫu giống kháng bệnh cao Bên cạnh kỹ thuật lây bệnh tách rời, lây bệnh non (5-6 thật) cho kết tương tự Điều phản ánh: với tiêu theo dõi khác (chỉ số bệnh tách rời, cây, số bào từ tạo ra) phương pháp lây bệnh khác tính kháng bệnh L3708 ln thể nhiều isolate, qua chứng tỏ tính kháng bệnh ổn định gen Ph-3 có L3708 Đây nguồn gen để phục vụ cơng tác tạo giống cà chua kháng bệnh sương mai Việt Nam Do chúng tơi thực đánh giá với nhóm: − Nhóm 1: dòng có tính kháng cao với bệnh sương mai xuất phát từ giống L3708: B26-13, B28-4, B29-4, B30-2, B32-3 − Nhóm 2: dòng mẫn cảm cao với bệnh sương mai: B2-8, B3-4, B4-6, B11-10, A26-2   33 Dưới kết đánh giá mức độ nhiễm mẫu thuộc nhóm với isolate RIFAV: Bảng 4.4 Kết lây nhiễm tách rời Mẫu Chỉ số bệnh trung bình Số bào tử (x103) B2-8 B4-6 10 B26-13 B28-4 B29-2 Bảng 4.5 Kết lây nhiễm Mẫu Chỉ số bệnh trung bình B2-8 4,4 B3-4 5,2 B4-6 5,5 B26-13 1,7 B28-4 1,3 B29-4 1,7 B30-2 1,5 B32-3 2,2 Kết cho thấy có khác biệt rõ ràng mức độ nhiễm bệnh nhóm dòng có tính kháng nhóm dòng mẫn cảm Nhóm lây nhiễm bệnh rời có số nhiễm bệnh trung bình từ – 2, nhóm từ – Khi lây nhiễm bệnh con, nhóm có số nhiễm bệnh trung bình từ 1,3 – 2,2, nhóm từ 4,4 – 5,5 Tương tự kết số nhiễm bệnh, số bào tử nấm hai nhóm chênh lệch hồn tồn Trong nhóm có số bào tử nấm từ – 1.000 nhóm có số bào tử lên đến 6.000 – 10.000 Điều phản ảnh thực tế mẫu nhóm gần khơng có vết bệnh, mẫu nhóm vết bệnh lan rộng   34 4.2 Đánh giá kiểu gen 4.2.1 Kiểm tra DNA tổng số Hình 4.1 Kết điện di DNA tổng số Hình điện di cho thấy mẫu DNA li trích cho thấy bị tạp nhiều, nhiên băng DNA rõ ràng, hoàn toàn sử dụng cho phản ứng PCR 4.2.2 Thực phản ứng PCR với primer SSR Qua sàng lọc primer cho thấy có primer TOM236 cho band đa hình giống kháng nhiễm nên tập trung vào primer Kết PCR với primer SSR112 Hình 4.2 Kết PCR với primer SSR112.B30-2, B29-2 mẫu kháng, B2-8, B11-10 mẫu nhiễm, ĐC đối chứng âm   35 Kết điện di hình 4.2 cho thấy, primer SSR112 khơng cho đa hình giống kháng chứa gen Ph-3 giống mẫn cảm với bệnh sương mai ko chứa gen Ph-3, chứng tỏ locus khơng liên kết với gen kháng Ph-3 Kết PCR với primer TOM236 B26-13 B28-4 B29-4 B30-2 B32-2 B3-4 B4-6 B2-8 A26-2 ĐC Ladder 500bp 185bp 155bp Hình 4.3 Kết PCR với primer TOM236 B26-13, B28-4, B29-4, B30-2, B32-3 mẫu kháng, B3-4, B4-6 B2-8, A26-2 mẫu nhiễm, ĐC đối chứng âm Kết điện di hình 4.4 cho thấy sản phẩm PCR thu tốt với band sáng, rõ chứng tỏ quy trình ly trích chu trình nhiệt PCR đề tài cho kết tốt Có thể áp dụng cho nghiên cứu Từ kết thấy primer TOM236 cho sản phẩm band đa hình mẫu kháng mẫu nhiễm Qua cho thấy, gen Ph-3 định vị nhiễm sắc thể số 9, khu vực cánh tay dài Chungwongse ctv (1998) nghiên cứu lập đồ gen Ph-3 ZHU Hai – shan ctv (2006) nghiên cứu xác định marker SSR liên kết với gen kháng bệnh sương mai cà chua có kết tương tự đánh giá Nghiên cứu ZHU Hai – shan xác định kích thước band kháng 155bp band nhiễm 185bp Từ kết ta thấy gen kháng bệnh sương mai Ph-3 chuyển từ giống L3708 sang hệ con, từ tạo điều kiện cho thực lai hồi giao để tạo quần thể lai vừa có gen Ph-3 có khả kháng cao   36 với isolate gây bệnh sương mai vừa đảm bảo di truyền giống có suất cao Nhờ tạo giống cà chua có suất cao, kháng bệnh tốt, phuc vụ cho sản xuất Như vậy, qua thí nghiệm thực phản ứng PCR với primer SSR dòng cà chua mang gen kháng Ph-3 dòng cà chua mẫn cảm với bệnh sương mai, nhận thấy primer TOM236 cho sản phẩm PCR ổn định tất dòng cà chua nghiên cứu phân biệt dòng kháng nhiễm bệnh với Kết cho thấy rằng, sử dụng primer TOM236 cơng cụ nhằm dự đốn có mặt gen kháng Ph-3 dòng, giống cà chua kháng bệnh sương mai Vì vậy, bước đầu sử dụng primer TOM236 cho mục đích chọn tạo giống cà chua kháng bệnh sương mai Do hạn chế thời gian thực đề tài mà quần thể nghiên cứu lại lớn nên số liệu liệu đánh giá kiểu hình chưa tổng hợp hết Đề tài đánh giá kiểu gen số dòng Tuy nhiên xác định đươc marker TOM236 kiên kết với gen Ph-3 kháng bệnh sương mai cà chua, tạo tiền đề cho nghiên cứu sau   37 Chương KẾT LUẬN VÀ ĐỀ NGHỊ 5.1 Kết luận Từ đánh giá kiểu hình xác định giống cà chua L3708 với gen kháng Ph-3 có khả kháng tốt với nấm gây bệnh sương mai Đề tài xác định marker TOM236 có liên kết với gen Ph-3, phục vụ cho công tác chọn tạo giống cà chua kháng bệnh sương mai sau 5.2 Đề nghị Tiếp tục sử dụng primer TOM236 nhằm nghiên cứu sâu mức độ liên kết marker gen kháng Ph-3 quần thể F2 quần thể hồi giao, từ xác định xác khoảng cách di truyền marker gen kháng Ph-3 để ứng dụng chiến lược chọn tạo giống cà chua kháng bệnh sương mai nhờ marker phân tử Việt Nam Tiếp tục nghiên cứu để tìm marker liên kết với gen Ph-1 nằm nhiễm sắc thể số gen Ph-2 nằm nhiễm sắc thể số 10 Phát triển quần thể lai từ giống L3708 với giống có gen Ph-1, Ph-2 để tạo quần thể lai có tính kháng ổn định phương pháp chồng gen kháng   38 TÀI LIỆU THAM KHẢO Tiếng Việt Bùi Chí Bửu Nguyễn Thị Lang 1999 Di truyền phân tử - Những nguyên tắc chọn giống trồng Nhà xuất Nông nghiệp, Tp Hồ Chí Minh Phạm Hồng Cúc 2008 Cây cà chua Nhà xuất Nơng nghiệp, Tp Hồ Chí Minh Hà Viết Cường 2008 Giáo trình Bệnh nơng nghiệp Hà Nội Trịnh Đình Đạt, 2006 Cơng nghệ sinh học tập 4: Công nghệ di truyền Nhà xuất giáo dục Vũ Triệu Mân 2007 Giáo trình Bệnh chuyên khoa Hà Nội Bùi Lê Minh 2007 Đánh giá tính đa hình liên kết tính kháng bệnh gỉ sắt (Puccinia arachidis) tập đoàn lạc F4 (ICG950166 x L12) thị SSR Báo cáo khoa học sinh viên Khuất Hữu Thanh 2003 Cơ sở di truyền phân tử kỹ thuật gen Nhà xuất khoa học kỹ thuật, Hà Nội Nguyễn Văn Viên Đỗ Tấn Dũng 2008 Bệnh hại cà chua nấm, vi khuẩn biện pháp phòng chống Nhà xuất Nông nghiệp, Hà Nội Tiếng Anh Beckmann, J.S and Weber, J.l 1992 Survey of human and rat microsatellites Gemonics 12, pp: 627 – 631 10 Black, L.L., T.C Wang and Y.H Huang 1996 New sources of late blight resistance identified in wild tomatoes Tropical vegetable Information Service Newsletter, 1: 15 – 17 11 Black, L.L., T.C.Wang, P.M Hanson and J.T Chen 1996 Late blight resistance in four wild tomato accessions, effectiveness in diverse locations and inheritance of resistance Phytopathology 96: S24 (Abstract) 12 Brouwer, D J., and St Clair, D A 2004 Fine mapping of three quantitative trait loci for late blight resistance in tomato using near isogenic lines (NILs) and sub-NILs Theor Appl Genet, pp: 628 – 638 13 Christine D Smart, Steven D Tanksley, Hilary Mayton, William E Fry 2007 Resistaice to Phytophthora infestans in Lycopersicon pennellii Plant Dis, 91: 1045 – 1049 14 Clayberg, C D., Butler, L., Rick, C M., and Robinson, R W 1965 List of tomato genes as of January 1965 Rep Tomato Genet Coop, 15: – 21 15 Cohen, Y 2002 Populations of Phytophthora infestans in Israel underwent three major genetic changes during 1983 to 2000 Phytopathology, 92: 300 – 307 16 Dorokhov BD, Klocke E 1997 A rapid and economic technique for RAPD analysis of plant genomic Russ J Genet, 33: 358-365 17 Duglas J Brouwer, Elizabeth S Jone, and Dona A St Clair 2003 QTL analysis of quantitative resistance to Phytophthora infestans (late blight) in tomato and comparisons with potato Genome , 47: 475 – 492   39 18 Foolad, M.R., Stoltz, T., Dervinis, C., Rodriguez, R.L., and Jones, R.A 1997 Mapping QTLs conferring salt tolerance during germination in tomato by selective genotyping Mol Breed, 3: 269 – 277 19 Frary, A., Graham, E., Jacobs, J., Chetelat, R.T., and Tanksley, S D 1998 Identification of QTL for late blight resistance from L pimpenellifolium L3708 Rep Tomato Genet Coop, 48: 19 – 21 20 Irit Irzhansky and Yigal Cohen 2006 Inheritance of resistance against Phytophthora infestans in Lycopersicon pimpenellifolium L3707 Euphytica, 149: 309 – 316 21 Leontine Colon, Bent J., Nielsen and Ulrich Darsow 2004 Detached leaf test for foliage blight resistance Eucablight, version 1.2 22 M.Rossetto – Centre for plant conservation genetics, Southern Cross University, Australia 2001 Sourcing of SSR markers from related plant species 23 Ma, Z.Q., Roder, M and Sorrells, M.E 1996 Frequencies and sequence characteristics of di-, tri-, and tetra-nucleotide microsatellites in wheat , Genome, 39 : 123 – 130 24 Moreau, P., Thoquet, P., Olivier, J., Laterrot, H., and Grimsley, N 1998 Genetic mapping of Ph-2, a single locus controlling partial resistance to Phytophthora infestans in tomato.Mol Plant - Microbe Interact, 11: 259 – 269 25 Morgante M and Olivieri A.M 1993 PCR- Amplified microsatellites as markers in plant genetics - Plant Journal 3, pp: 175 – 182 26 Paterson, B.D 1998 Genes for cold resistance from wild tomatoes HortScience, 23: 795 – 795 27 Powell, W., Morgante, M., Andre, C., Hanafey, M., Vogel, J., Tingey, S and Rafalski 1996 The comparison of RFLP, RAPD, AFLP and SSR (microsatellite) markers for germplasm analysis- Molecular Breeding 2, pp: 225 – 238 28 QIU Yi – Peng, LI Hai-tao, ZHANG Zi – Jun ZOU Qing – Dao RAPD marker of the resistant gene Ph-3 for tomato late blight China National Knowledge Infrastructure 2009 29 Rick, C.M 1982 The potential of exotic germplasm for tomato improvement In Plant improvement and somatic cell genetics Edited by I.K Vasil, W.R Scowcroft, and K.J Freys Academic Press, New York, pp: – 28 30 Tanksley, S.D., N.D Young, A.H Paterson and M Bonierbale 1989 RFLP mapping in plant breeding: New tools for an old science Biotechnology, pp: 257 – 264 31 ZHU Hai – Shan, WU Tao and ZHANG Zhen – Xian 2006 Inheritance analysis and identification of SSR markers linked to late blight resistant gene in Tomato Agricultural Sciences in China, 5: 517 – 521 Website 32 http://agdev.anr.udel.edu 33 http://faostat.fao.org 34 http://solgenomics.net 35 http://www bioweb.uwlax.edu 36 http://www.hort.purdue.edu 37 http://www.nass.usda.gov   40 ... gốc Cà chua có nguồn gốc vùng Trung Nam châu Mỹ Hiện nay, dạng cà chua hoang dại tìm thấy Bolivia, Chile, Ecuador Peru Cà chua phổ biến vào Trung Quốc nước Đông Nam Á khoảng kỉ thứ 17 trở thành... Đức, bệnh gây thiệt hại 60 – 75%, chí 100% cà chua Bệnh phá hoại nghiêm trọng Mỹ, Nam Phi Trung Quốc Ở Việt Nam, từ nhiều năm bệnh thường xuyên gây thiệt hại vùng trồng cà chua, thiệt hại trung... tinh thần đóng góp ý kiến để tơi hồn thành luận văn TP Hồ Chí Minh, Tháng năm 2010 Nguyễn Xuân Nam   i TÓM TẮT Cà chua (Lycopersicon esculentum Mill.) loại rau màu trồng phổ biến giới đứng thứ
- Xem thêm -

Xem thêm: ĐÁNH GIÁ NGUỒN GEN KHÁNG BỆNH SƯƠNG MAI TRÊN CÀ CHUA BẰNG CHỈ THỊ PHÂN TỬ SSR , ĐÁNH GIÁ NGUỒN GEN KHÁNG BỆNH SƯƠNG MAI TRÊN CÀ CHUA BẰNG CHỈ THỊ PHÂN TỬ SSR

Từ khóa liên quan

Gợi ý tài liệu liên quan cho bạn